Symptomless Plants Research Articles

Microscope studies of symptomless growth of Botrytis cinerea in Lactuca sativa and Arabidopsis thaliana.

The grey mould pathogen Botrytis cinerea forms systemic associations in some hosts, spreading into plant organs produced a considerable time after initial infection. These infections may have no macroscopic symptoms during much of the hosts' lifetime and are at least partially within the host tissue. The aim of the studies reported here was to locate and visualize these infections at a cellular level in Lactuca sativa (lettuce) and Arabidopsis thaliana. Symptomless but infected plants were produced by dry spore inoculation of plants growing in conditions previously shown to result in fungal spread from the initial inoculation site to newly developing plant organs. Tissue taken from inoculated plants was examined using confocal laser scanning microscopy. Two B. cinerea isolates were used: B05.10 and its GFP-labelled derivative Bcgfp1-3. Spore germination on leaf surfaces was followed by development of subcuticular inclusions and plant cell damage in single infected epidermal cells and sometimes a few nearby cells. Sparsely branched long hyphae arose and spread from the inclusions, mostly on the outer surface of the epidermal layer but occasionally below the cuticle or epidermal cells, where further inclusions formed. This was consistent with the pattern in time of recovery of B. cinerea from surface-sterilized leaf tissue. In the late symptomless phase, mycelium arising from internal fungal inclusions formed mycelial networks on the surface of leaves. Symptomless exterior mycelium grew on the roots in A. thaliana.

First Report of Phytoplasma Belongs to 16SrV Group Associated with Witches'-broom Disease of Taxillus chinensis in China.

Taxillus chinensis (DC.) Danser is a hemiparasitic shrub, widespread in Southern China (Fu et al., 2001). T. chinensis can parasitize a wide range of species (e.g., Camellia spp., Ficus virens and Osmanthus fragrans), which obviously suppressed host growth by robbing nutrient and water through haustorium, causing considerable tree damage. During field visits to Dongguan (22°86'N, 13°97'E) and Guangzhou (23°19'N, 113°31'E), Guangdong Province, in April-July 2021, the typical phytoplasma-suspected symptom manifested as stunting, leaflet, leaf chlorosis and witches'-broom were observed in almost 36% of T. chinensis plants. Leaf samples were collected from six randomly collected plants with symptoms and six symptomless plants (Fig 1). Among them, half of T. chinensis plants parasitized on the host Elaeocarpus sylvestris, the other half on the O. fragrans. No apparent symptoms were observed on both two host plants. Total DNA was extracted from 0.5 g fresh leaf of T. chinensis plants with and without symptoms, as well as two host plants E. sylvestris and O. fragrans, using the CTAB method (Doyle et al., 1990). Nested polymerase chain reactions (PCRs) were performed on DNA extracts of all tested plants with primer pairs of P1/P7 and R16mF2/R16mR1 for 16S rRNA gene (Lee et al., 1993) and rp(v)F1/rpR1 for rp gene (Lee et al., 1998). All amplicons were obtained from symptomatic samples of T. chinensis and host plant E. sylvestris, whereas no such products resulted from DNAs of symptomless plants and O. fragrans. The amplicons were purified and sequenced by Sanger method (Rui Biotech, Guangzhou, China). The amplicon of 16S rRNA and rp genes is 1346 bp and 938 bp, respectively. BLAST comparison of the 16S rRNA (accession no. OL412744) and rp (accession no. OL473789) sequences of the T. chinensis witches'-broom phytoplasma yielded 99.6% sequence identity with those of phytoplasmas of group 16SrV jujube witches'-broom (JWB) phytoplasma (accession no. CP025121 for 16S rRNA gene and AF396941 for rp gene). The 16S rRNA gene sequence of phytoplasma in host plant E. sylvestris (accession no. OM885990) is 99.7% similarity to the 'Elaeocarpus zollingeri' yellows phytoplasma (accession no. LC257960) and 99.4% similarity to the 'Elaeocarpus sylvestris' decline phytoplasma (accession no. MW553140), but 95.8% similarity to the 16S rRNA gene of phytoplasma in T. chinensis. The virtual RFLP tool, iPhyClassifier delineated the T. chinensis phytoplasma (accession no. OL412744) to group 16SrV-B (accession no. AB052876) with the similarity coefficient 1.0 (Fig 2), and phytoplasma in E. sylvestris to group 16Sr group XXXII with the similarity coefficient 0.97. Phylogeny analyses of 16S rRNA and rp genes (MEGA version 7.0.14, USA) using reference phytoplasmas from GenBank confirmed sequencing results and placed the T. chinensis phytoplasma in group 16SrV-B (Fig. 3 and 4). In China, the 16SrV-B phytoplasma group has been reported in Amaranthus retroflexus (Yang et al., 2011), Liriodendron chinense (Li et al., 2012), Prunus salicina (Gao et al., 2020) and sweet potato (Li et al., 2021). This is the first report of a 'Ca. Phytoplasma ziziphi', 16SrV-B related phytoplasma associated with parasitic T. chinensis in China. The results of this study indicate that T. chinensis could be a vector to spread phytoplasmas 16SrV group through parasitism and this can be helpful for related research.

Molecular detection and identification of phytoplasmas associated with Catharanthus roseus, Pinus eldarica, and Petunia hybrida in southeastern Iran's urban green spaces

AbstractGiven the potential for urban green spaces to provide fresh and healthy environments for humans, exploring the issues that threaten plants in these places is crucial. Phytoplasma‐related symptoms were encountered on some plants in urban green spaces in the province of Kerman, southeastern Iran, between 2017 and 2019. Affected periwinkles and petunias exhibited phytoplasma disease symptoms, including virescence, phyllody, and witches'‐broom. However, ball or disc‐like shoot proliferation symptoms were noticed on the trunks and branches of pine trees. PCR was performed with phytoplasma‐detecting universal primers, targetting and amplifying the 16S rRNA gene, and determining whether phytoplasmas are implicated in the symptomatic plants. The infection of the symptomatic plants was confirmed using nested‐PCR amplification of expected DNA sizes for phytoplasmas. No product, however, was amplified from sampled symptomless plants. The sequencing of nested‐PCR products was performed to obtain sequences encasing the standard F2nR2 fragments. The resulted sequences were submitted to iPhyClassifier, the universal phytoplasma classification platform, for the taxonomic assignment of the found phytoplasmas compared with previously identified ‘Candidatus Phytoplasma’ species, groups, and subgroups. The results revealed that phytoplasma strains related to the species ‘Ca. P. trifolii’ (16SrVI‐A subgroup) infect periwinkles and pines. However, strains from the species ‘Ca. P. aurantifolia’ (16SrII‐D subgroup) and ‘Ca. P. phoenicium’ (16SrIX‐C subgroup) were found in petunias and periwinkles, respectively. To the best of our knowledge, phytoplasmas from the 16SrVI‐A and 16SrII‐D subgroups are the first reported to infect these plants in Kerman province, while a related strain from the subgroup 16SrIX‐C is the first recorded to infect periwinkles in Iran and the second in the world.

EVALUATION OF XANTHOMONAS AXONOPODIS PV. MANIHOTIS POPULATION IN INFECTED STEMS OF CASSAVA VARIETIES AND THE IMPACT ON NEW SPROUTS

A prerequisite for a healthy cassava plantation is the use of non-infected planting material. Therefore, the distribution of Xanthomonas axonopodis pv. manihotis in cassava stems of four genotypes was determined with the aim to develop recommendations for the selection of healthy stem material for planting to avoid cassava bacterial blight. X. axonopodis pv. manihotis was detected in stems of the susceptible varieties Ben86052 and Fetonegbodji, in a discontinuous colonization pattern and not restricted to any part of the stem, with higher numbers in the upper parts of the stem (107 cfu/g for Ben86052 and 106 cfu/g for Fetonegbodji), than in the middle and basal parts (103 to 104 cfu/g). Although 90-100% and 50-90% of cuttings of varieties Ben86052 and Fetonegbodji, respectively, harbored the pathogen, only 40-50% and 20-40%, respectively, of emerging sprouts were infected. From most of the cuttings in which the bacterium was not detected, healthy sprouts emerged. No bacterial blight symptoms occurred on the known relatively resistant genotypes TMS30572 and Ggazekoute in the field, and X. axonopodis pv. manihotis was not found in any part of the plants, nor did any of the new sprouts from the planted cuttings show disease symptoms. Thus, symptomless plants of the two genotypes can be considered free of bacteria and therefore can be recommended to farmers as suitable planting material to reduce disease incidence.

An HLD Model for Tomato Bacterial Canker Focusing on Epidemics of the Pathogen Due to Cutting by Infected Scissors

A healthy, latently infected, diseased (HLD) plant model for botanical epidemics was defined for tomato bacterial canker (TBC) caused by the pathogenic plant bacteria, Clavibacter michiganensis subsp. michiganensis (Cmm). To estimate the infection probability parameter, inoculation experiments were conducted in which it was assumed that infection is transferred to healthy plants through contaminated scissors used to cut symptomless infected plants. The approximate concentration of Cmm in symptomless infected plants was 1 × 106 cells/mL, and the probability of infection of healthy tomato plants was approximately 0.75 due to cutting with scissors soaked in a cell suspension of Cmm at 1 × 106 cells/mL. Three different HLD models were developed by changing some parameters, and the D curve calculated by the developed HLD model A was quite similar to the curve of the proportion of diseased plants observed in fields that had a severe disease incidence. Under a simulation of disease incidence using this model, the basic reproduction number (R0) was 2.6. However, if the infected scissors were disinfected using ethanol, R0 was estimated as 0.3. The HLD model for TBC can be used to simulate the increasing number of diseased plants and the term of disease incidence.

Development of a nested PCR assay for detecting Colletotrichum siamense and Colletotrichum fructicola on symptomless strawberry plants.

Anthracnose is a major disease of strawberry that seriously impacts the strawberry industry. To prevent the spread of anthracnose through symptomless plants, it is important to detect pathogenic Colletotrichum spp. at the latent infection stage in the nursery. Previous PCR-based methods developed for the diagnosis or detection of Colletotrichum acutatum and Colletotrichum gloeosporioides have used primers targeting the internal transcribed spacer region of ribosomal DNA, β-tubulin gene, or mating type gene. In this study, to specifically detect Colletotrichum siamense and Colletotrichum fructicola, the most predominant and virulent Colletotrichum species causing strawberry anthracnose in Taiwan, we conducted a comparative genomics analysis of 29 Colletotrichum spp. and identified a non-conserved 1157-bp intergenic region suitable for designing specific primers for a nested PCR assay. In silico analysis and actual tests suggested that the new nested PCR assay could detect pathogenic C. siamense and C. fructicola, but not other strawberry pathogens (Botrytis sp., Fusarium spp., Neopestalotiopsis rosae, and Phytophthora sp.) or ubiquitous saprophytes (Fusarium spp. and Trichoderma spp.). The inner to outer primer ratio was optimized to 1:10 to eliminate unexpected bands and enhance the signal. The assay could detect as little as 1 pg of C. siamense genomic DNA, which corresponds to ~15 cells. Application of the new detection assay on 747 leaf samples collected from 18 strawberry nurseries in 2019 and 2020 showed that an average of 20% of strawberry mother plants in Taiwan were latently infected by C. siamense or C. fructicola. The newly developed assay is being applied to facilitate the production of healthy strawberry runner plants in Taiwan.

Occurrence of the Iflavirus-like Tomato Matilda Virus in Solanum Species in South Africa.

Tomato matilda virus (TMaV) is an iflavirus-like virus that was first reported by Saqib et al. (2015) in symptomless tomato plants in Australia. Those authors demonstrated using phylogenetic analysis that TMaV was an iflavirus, and that it replicated in plants and was transmitted between plants. However, infection was symptomless in tomato and aubergine, and induced mild symptoms in chilli plants. This was the first report of a plant-infecting iflavirus, a genus of insect viruses, suggesting a potential evolutionary transition of iflaviruses into plant hosts. Here we report the detection of TMaV in wild Solanum chenopodioides and Solanum sisymbriifolium in South Africa. In a survey for viruses of wild Solanum species, leaf tissues from S. chenopodioides and S. sisymbriifolium displaying rugosity and chlorotic mottling were collected from roadsides and potato and tomato farms in five provinces (Free State, Gauteng, KwaZulu Natal, Limpopo and Mpumalanga) in South Africa. Total RNA extracted from 10 plants for each species was pooled (500 ng/sample). Ribosomal RNA removal, cDNA library construction and high throughput sequencing (HTS) using the Illumina HiSeq PE150 were conducted by Novogene Co. Ltd (Beijing, China). From S. chenopodioides and S. sisymbriifolium, 44 052 441 and 47 515 569 total clean reads were obtained, respectively. Using Trinity and SPAdes within the VirFind pipeline (Ho and Tzanetakis, 2014), 68711 and 21125 contigs were assembled. BLASTn search of the contigs revealed the presence of TMaV as well as cowpea tombusvirid 1 (Tombusviridae), pepper veinal mottle virus, African eggplant mosaic, potato virus Y (Potyviridae), cucumber mosaic virus, tomato necrotic spot virus (Bromoviridae), tobacco vein clearing virus and cauliflower mosaic virus (Caulimoviridae) in S. chenopodioides and S. sisymbriifolium. The TMaV contigs from S. chenopodioides (n = 33) and S. sisymbriifolium (n = 88) were mapped to the TMaV genome (HQ260868) reported by Saqib et al. (2015). The assembled draft TMaV genomes from S. chenopodioides (7547 bp, MW717924) and S. sisymbriifolium (7553 bp, MW717925) covered 98.5% of that reference genome with 98.0 and 97.8% sequence identity, respectively, and 98.5 and 98.3% sequence identity to a TMaV isolate (MK517476) from Italy. The two draft genomes displayed 99.5% sequence identity to each other. BLASTn analysis of these draft genomes only retrieved hits for TMaV and blackberry iflavirus A (BVA), another plant-infecting iflavirus (Khadgi, 2015). No insect iflavirus hits were obtained, thereby potentially excluding contamination by insect viruses. The two TMaV sequences displayed 81.9-89.9% identity to the partial sequences of BVA. The presence of TMaV in S. chenopodioides and S. sisymbriifolium was confirmed by RT-PCR of the pooled RNA and sequencing using primer sets reported by Saqib et al. (2015), Matil_F1 (ACGGCAGCCACGCTAAGAAA)/Matil_R1 (TCATTATGGCGCCTGTATGG) covering TMaV genome locations 1008-1821 (includes rhv-like 1 and partially rhv-like 2 structural protein genes) and Matil_F9 (TTTACCTTGTGCTGTTGCAG)/ Matil_R9 (ACCTGCAGACGTTGTTAATT) spanning positions 6485-7214 (sequence region encoding partial cystein protease, nucleotide binding site and partial RNA dependent RNA polymerase). The sequences obtained from the amplicons (accessions MW717926 - MW717929) displayed 97.2 - 98.4% sequence identity to those of the Saqib et al. (2015) genome, and were fully identical to the TMaV sequences generated initially using HTS. The detection of TMaV in these Solanum spp. further supports the concept of plant-infecting iflaviruses. Saqib et al. (2015) proposed the genus Tomavirus within Iflaviridae to accommodate TMaV. This is possibly similar to Tospoviridae, the only plant-infecting family of the order Bunyavirales, which is composed of viruses of arthropods and vertebrates (Ullman et al. 2005). Further studies are needed to understand TMaV infection of different plant hosts, especially crops of economic importance.

First report of a ‘Candidatus Phytoplasma australasia’ (16SrII‐D) strain associated with witches’ broom and little leaf symptoms of Martynia annua in India

Martynia annua (Martyniaceae) is a small, herbaceous annual plant distributed across India. It is used for the treatment of epilepsy, tuberculosis, sore throats and wounds (Kaushik et al., 2021). In August 2021, symptoms of witches’ broom and little leaf were observed in M. annua in the Anantapur forest area, Andhra Pradesh. India. Leaves were collected from two diseased and two symptomless plants (Figures 1 and 2). Total DNA was extracted from 100 mg of leaf midribs using a modified CTAB DNA extraction method (Murray & Thompson, 1980). DNA extracts were analysed by direct and nested PCR with universal phytoplasma 16S rRNA primers, P1/P7 (Deng & Hiruki, 1991) and R16F2n/R16R2 (Gundersen & Lee, 1996), respectively. Amplicons of the expected size (c. 1.8 kb after direct PCR and c. 1.3 kb after nested PCR) were obtained from diseased samples but not symptomless plants. Nested PCR R16F2n/R16R2 products were directly sequenced (Eurofins Genomics India Pvt., Ltd., India) and the consensus sequence was deposited in GenBank (Accession No. OK135941). A BLASTn analysis revealed that the M. annua phytoplasma 16Sr DNA sequence shared 100% sequence identity with those of 16SrII group phytoplasmas, including ‘Candidatus Phytoplasma australasia’ (MN565885, MN565886) and ‘Ca. Phytoplasma aurantifolia’ (MK217101, MK421430). Phylogenetic analysis (Tamura et al., 2007) based on the R16F2n/R2 sequence and performed with the neighbour-joining method (MEGA software version 7.1) revealed that the Anantapur 16SrII phytoplasma had the closest relationship with 16SrII, subgroup D isolates, particularly with the strain ‘Ca. P. australasia’ (Y10096) (Figure 3). Virtual RFLP profiles using restriction enzyme AluI and the R16F2nR2 sequence were generated with iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi). The RFLP patterns of the Anantapur phytoplasma 16S rDNA F2nR2 sequence with AluI enzyme agreed with the phylogenetic grouping. The Anantapur phytoplasma was confirmed as a member of the 16Sr group II, subgroup D with a similarity coefficient of 1.00, compared with virtual RFLP profiles of the ‘Ca. P. australasia’ strain (Y10097). This is the first report of a ‘Ca. Phytoplasma australasia’ strain (16SrII-D) associated with witches’ broom and little leaf symptoms of M. annua in India. Since the 16SrII group has a wide host range and occurrence in India, and particularly the subgroup 16SrII-D in the south region, the present finding has a significant impact for future epidemiological studies. The authors would like to thank the support and encouragement from the Associate Director of the Research, Regional Agricultural Research Station, Tirupati.

First Report of Gentian Kobu-sho-Associated Virus Infecting Peony in the United States and the Netherlands.

Lemoine's disease of peonies (LDP) is associated with root galls that could lead to stunted growth and reduced flowering. In the quest to identify the causal agent(s) of LDP, two symptomatic plants (cv. Alice Crousse [AC] and Alice Harding [AH]) were sampled in Arkansas in 2019 and sequenced as described (Shaffer et al., 2019). Gentian Kobu-sho-associated virus (GKaV) was present in both plants. The contigs from AH were mapped to the reference sequence of GKaV (AB698918; Kobayashi et al. 2013) yielding 87% of the ~23kb genome, which was completed by Sanger sequencing (Genbank accession no. MW646307) as per Thekke-Veetil et al. (2013). Sample AC was co-infected with cycas necrotic stunt virus (CNSV) and AH with CNSV, citrus leaf blotch virus and lychnis mottle virus. Gentiana triflora -Pall. and G. scabra Bunge plants with Kobu-sho disease symptoms that include galls/tumors on all parts of gentian were also positive for GKaV (Iwadate et al. 2006; Kodama et al. 2004). The striking similarity between symptoms of the two diseases led to the development of a GKaV screening protocol to determine its presence in LPD-affected material. Primers GKaVF 5'-TTAGTGATGAGTGCCTTTTCC-3' and GKaVR 5'-CTGCCAGTCTTCTTGTGAACC-3' which amplify a 574 nt region of the virus were used to screen 144 peony leaf samples from the University of Michigan's Nichols Arboretum collection. Thirty-two (32) plants were stunted whereas 112 displayed normal growth. Nineteen (59%) of the stunted plants tested positive for GKaV compared to eight (6.5%) of the symptomless plants. Partial GKaV genome sequences of three isolates from stunted Michigan plants were deposited in GenBank (MW646310-12) along with three GKaV isolates from Arkansas collected at the same location and time as AC and AH (MW646308-9, MW646313); two had LDP symptoms and the status of the third was unknown. In 2020 four peony root samples from the Netherlands were sequenced as described in Hammond et al. (2021) to identify the causal agent of root galls in three samples. GKaV was present in two: cv. Paul M. Wild and #40391499 and the nearly complete genome sequences were deposited in GenBank (MW916234-5). 'Paul M. Wild' was co-infected with cucumber mosaic virus and tobacco rattle virus and #40391499 with a novel amalgavirid. The third symptomatic cv. Many Happy Returns was infected with CNSV while the fourth symptomless cv. Itoh was infected with CNSV and amazon lily mild mottle virus (Shaffer et al., 2021). Percent pairwise identities between sequences were calculated using the SDT Version 1.2 (Muhire et al. 2014). The six partial GKaV sequences from Michigan and Arkansas share 92-100% nt (98-100% aa) identity. Analysis of the three near full length GKaV genomes presented in this communication and the type isolate (NC020252) showed 87-91% nt (93-97% aa) identity. This report provides evidence that GKaV infects peony and is present in Europe and North America. The association of GKaV with LDP is not established, but the virus has been detected in 59% of the plants showing disease symptoms and in ˂7% of asymptomatic plants. We hypothesize that as in the case of Gentian, GKaV has an extended incubation period in peony (Kobayashi et al., 2013) and its titer may fluctuate between seasons as it has been well established for other crops (Villamor et al., 202x). The industry does not perform virus clean-up routinely; propagation material should be tested for GKaV to minimize its spread since the virus may be associated with LDP in at least some cultivars.

The Endosphere Microbiome of Ginseng.

The endosphere of ginseng contains a variety of fungal, bacterial, archaeal and viral endophytes. Bacterial endophytes are primarily members of the Proteobacteria, Actinobacteria, Firmicutes and Bacteroidetes, and fungal endophytes are primarily members of the Ascomycota, Zygomycota and Basidiomycota. Although archaea and viruses have been detected in symptomless ginseng plants, little is known about them. Many but not all studies have shown roots having the highest abundance and diversity of bacterial and fungal endophytes, with some endophytes showing specificity to above or belowground tissues. Abundance often increases with root age, although diversity can decrease, possibly related to increases in potential latent fungal pathogen infections. The descriptions of many endophytes that can metabolize ginsenosides indicate an adaptation of the microbes to the unique combination of secondary metabolites found in ginseng tissues. Most research on the benefits provided by bacterial and fungal endophytes has concentrated on improved plant nutrition, growth promotion and increased disease resistance, but little on their ability to increase abiotic stress resistance. Some other areas where more research is needed is field trials with endophyte-treated plants grown in various environments, genomic/metagenomic analysis of endophytes, and the effects of endophytes on induced disease resistance and abiotic stress tolerance.

GmGSTU13 Is Related to the Development of Mosaic Symptoms in Soybean Plants Infected with Soybean Mosaic Virus.

The leaves of soybean cultivar ZheA8901 show various symptoms (necrosis, mosaic, and symptomless) when infected with different strains of soybean mosaic virus (SMV). Based on a proteomic analysis performed with tandem mass tags (TMT), 736 proteins were differentially expressed from soybean samples that showed asymptomatic, mosaic, and necrosis symptoms induced by SMV strains SC3, SC7, and SC15, respectively. Among these, GmGSTU13 and ascorbate peroxidase (APX) were only upregulated in mosaic and symptomless leaves, respectively. The protein level of GmGSTU13 determined by western blot analysis was consistent with TMT analysis, and quantitative reverse transcriptase PCR analysis showed that GmGSTU13 mRNA levels in mosaic plants were 5.26- and 3.75-fold higher than those in necrotic and symptomless plants, respectively. Additionally, the expression of the viral coat protein (CP) gene was increased, and serious mosaic symptoms were observed in GmGSTU13-overexpressing plants inoculated with all three SMV strains. These results showed that GmGSTU13 is associated with the development of SMV-induced mosaic symptoms in soybean and that APX is upregulated in symptomless leaves at both the transcriptional and protein levels. In APX gene-silenced soybean plants, the relative expression of the viral CP gene was 1.50, 7.59, and 1.30 times higher than in positive control plants inoculated with the three SMV strains, suggesting that the upregulation of APX may be associated with lack of symptoms in soybean infected with SMV. This work provides a useful dataset for identifying key proteins responsible for symptom development in soybean infected with different SMV strains.

Occurrence of Phytoplasma Belonging to 16SrII Group Associated with Witches'-broom Symptoms in Emilia sonchifolia in Hainan Island of China.

Emilia sonchifolia is a medical plant belonging to the family of Asteraceae, mainly used as a traditional Chinese medicine with the function of anti-inflammatory, analgesic, antibacterial and so on. During October to November 2020, the plants showing abnormal symptoms including witches'-broom, internode shortening, leaf chlorosis and leaflet were found in Hainan province, a tropical island of China. The total DNA of the plant samples were extracted using 0.10 g fresh plant leaves using CTAB method. PCR reactions were performed using primers R16mF2/R16mR1 and secAfor1/secArev3 specific for phytoplasma 16S rRNA and secA gene fragments. The target productions of the two gene fragments of phytoplasma were detected in the DNA from three symptomatic plant samples whereas not in the DNA from the symptomless plant samples. The two gene fragments of the DNA extracted from the symptomatic plant samples were all identical, with the length of 1324 bp 16S rRNA and 760 bp secA gene sequence fragments, putatively encoding 253 (secA) amino acids sequence. The phytoplasma strain was named as Emilia sonchifolia witches'-broom (EsWB) phytoplasma, EsWB-hnda strain. To our knowledge, this was the first report that Emilia sonchifolia witches'-broom disease was caused by the phytoplasma belonging to16SrII-V subgroup in Hainan island of China, with close relationship to 16SrII peanut witches'-broom group phytoplasma strains infecting the plants like peanut, Desmodium ovalifolium and cleome from the same island of China and cassava from Viet Nam.

Coniochaeta elegans sp. nov., Coniochaeta montana sp. nov. and Coniochaeta nivea sp. nov., three new species of endophytes with distinctive morphology and functional traits.

A growing interest in fungi that occur within symptom-less plants and lichens (endophytes) has uncovered previously uncharacterized species in diverse biomes worldwide. In many temperate and boreal forests, endophytic Coniochaeta (Sacc.) Cooke (Coniochaetaceae, Coniochaetales, Sordariomycetes, Ascomycota) are commonly isolated on standard media, but rarely are characterized. We examined 26 isolates of Coniochaeta housed at the Gilbertson Mycological Herbarium. The isolates were collected from healthy photosynthetic tissues of conifers, angiosperms, mosses and lichens in Canada, Sweden and the United States. Their barcode sequences (nuclear ribosomal internal transcribed spacer and 5.8S; ITS rDNA) were ≤97% similar to any documented species available through GenBank. Phylogenetic analyses based on two loci (ITS rDNA and translation elongation factor 1-alpha) indicated that two isolates represented Coniochaeta cymbiformispora, broadening the ecological niche and geographic range of a species known previously from burned soil in Japan. The remaining 24 endophytes represented three previously undescribed species that we characterize here: Coniochaeta elegans sp. nov., Coniochaeta montana sp. nov. and Coniochaeta nivea sp. nov. Each has a wide host range, including lichens, bryophytes and vascular plants. C. elegans sp. nov. and C. nivea sp. nov. have wide geographic ranges. C. montana sp. nov. occurs in the Madrean biome of Arizona (USA), where it is sympatric with the other species described here. All three species display protease, chitinase and cellulase activity in vitro. Overall, this study provides insight into the ecological and evolutionary diversity of Coniochaeta and suggests that these strains may be amenable for studies of traits relevant to a horizontally transmitted, symbiotic lifestyle.

First report of a 'Candidatus Phytoplasma aurantifolia'-related strain (16SrII-V) associated with phyllody, virescence, and shoot proliferation of sweet William (Dianthus barbatus) in Taiwan.

The sweet William (Dianthus barbatus) is an ornamental belonging to the Caryophyllaceae family; the species produces clusters of flowers that comes in various colors and is grown commonly as garden plants (Lim 2014). In February 2021, sweet Williams showing symptoms typical of phytoplasma diseases were found in a garden located in Wufeng District, Taichung, Taiwan (24°04'37.6"N 120°43'20.4"E). Infected plants exhibited virescence and phyllody symptoms and produced an abnormal number of new shoots from the base of the flowers/flower-like structures (Figure S1) as well as the base of the plants. Among the fifteen plants grown in the area, two exhibited such symptoms. The two symptomatic plants, along with five symptomless plants were sampled. Two flower-like structures were collected from each of the symptomatic plants, and two flower samples were collected for each symptomless plant (Figure S2). Total DNA were extracted from each sample using the Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics) and subjected to diagnostic PCR using primers P1/P7 (Schneider et al. 1995). All four symptomatic samples produced a 1.8-kb amplicon and the ten symptomless samples did not. The amplification products were diluted fifty-fold and used in a second round of PCR using primers R16F2n/R16R2 (Gundersen and Lee 1996). Again, only the symptomatic samples produced an expected 1.25-kb amplicon. A sample was selected for each plant and the PCR products from the first round of PCR were cloned using the pGEM-T Easy Vector System (Promega Inc.) and sequenced (three clones per sample). Fragments of the 16S rRNA gene (1,248 bp; GenBank accession: MW788688) were analyzed using iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgi-bin/resource/iphyclassifier.cgi). Sequences obtained from the two infected plants were identical, and were classified to the 16SrII-V subgroup with similarity coefficients of 1.0; they also shared 98.6% similarity with the sequence of a 'Candidatus Phytoplasma aurantifolia' reference strain (accession: U15442). BLASTn results indicated that the 16S rRNA gene sequences detected were identical to those of 16SrII-V phytoplasmas affecting mungbean (accession: MW319764), lilac tasselflower (accession: MT420682), peanut (accession: JX403944) and green manure soybean (accession: MW393690) found in Taiwan. To corroborate the above results, 16SrII group-specific primers were used to conduct nested and semi-nested PCR targeting the pathogen's 16S rRNA gene (outer primers: rpF1C/rp(I)R1A; inner primers: rp(II)F1/rp(II)R1; Martini et al. 2007) and immunodominant membrane protein gene (imp; outer primers: IMP-II-F1/IMP-II-R1; inner primers: IMP-II-F2/IMP-II-R1; Al-Subhi et al. 2017). In both assays, the symptomatic samples produced the expected amplicons and the symptomless samples did not. The coding sequence of the imp gene (519 bp; accession: MW755353) was the same among all symptomatic samples, and shared 100% identity with that of the peanut witches'-broom phytoplasma (16SrII; accession: GU214176). To our knowledge, this is the first report of a 16SrII-V phytoplasma infecting sweet Williams in Taiwan. Since 16SrII-V phytoplasmas have also been found infecting mungbeans and peanuts in Taiwan (Liu et al. 2015), the findings here suggest that by serving as a natural host in the field, the sweet William may potentially contribute to the spread of 16SrII-V phytoplasmas to food crops.

First report of Tomato black ring virus infecting raspberry and blackberry in Poland.

Raspberry (Rubus idaeus L.) and blackberry (Rubus fruticosus L.) are infected by at least 29 viruses, including the Tomato black ring virus (TBRV) (Martin et al. 2013). TBRV belongs to the genus Nepovirus (subgroup B) of the family Secoviridae and is listed as a plant pathogen in over 40 countries. TBRV infects a wide range of herbaceous and woody plants. In Poland, TBRV has been described on the plants of the following species: Tagetes patula, T. erecta, Cucumis sativus, Cucurbita pepo, Lactuca sativa, Solanum tuberosum, S. lycopersicum, Sambucus nigra, and Robinia pseudoacacia (Jończyk et al. 2004, Hasiów-Jaroszewska et al. 2015). To this date, there is no information on the incidence of TBRV in raspberry and blackberry in Poland. In the spring of 2019, 52 blackberry leaf samples and 408 raspberry leaf samples were collected from 4 plantations located in central Poland. None of the raspberry plants (cvs. Glen Ample, Polka, Sokolica), nor the blackberry plants (cvs. Thornfree, Polar, Gaj, Kotata) exhibited viral symptoms. Enzyme-linked immunosorbent assay (ELISA) was carried out for extracts from the 460 collected leaf samples to detect TBRV using commercial antisera (Loewe Biochemica GmbH, Germany). The results indicated that 9 samples (4 blackberry, 5 raspberry) were infected with TBRV. The isolates of the virus were transferred by sap inoculation and maintained in Nicotiana tabacum cv. Xanthi. Systemic ringspot, necrosis and patterned lines were observed on tobacco leaves. The presence of the virus in tobacco leaf samples was confirmed by reverse transcription PCR (RT-PCR). Total RNA was extracted from all 9 samples using the silica capture (SC) method described originally by Boom et al. (1990) and adapted to the detection of plant viruses by Malinowski (1997). Part of the CP gene was amplified with the CPF (5'-GCCTGTCTCTCTCGCAATG-3') and CPR (5'-AAGGAGCCAAACTGAAATGT-3') primer pair (Hasiów-Jaroszewska et al. 2015). Amplicons of the expected size (763 bp) were obtained for each sample. The amplified products were purified, sequenced in both directions, deposited in GenBank and assigned accession numbers: MT507387 to MT507390 and MT507394 for the isolates from Rubus idaeus and MT507391 to MT507393 and MN954654 for the isolates from Rubus fruticosus, respectively. The 9 newly obtained TBRV CP gene sequences, together with the 25 isolates deposited in GenBank, were aligned by ClustalW. The isolates obtained in this study showed a 99.0-100% nucleotides (nt) and a 98.7-100% amino acids (aa) identity in the part of the CP, respectively. Comparison of the part of the CP of the 4 blackberry and the 5 raspberry TBRV isolates with 25 TBRV isolates available in GenBank showed a 80.6-97.8% nt and a 87.9-99.5% aa identity, respectively. The results of the phylogenetic analysis have revealed that the TBRV isolates obtained in this study are closely related to 3 Polish isolates (AY157994, KR139941, KR139951) and 1 Bioreba ctrl Switzerland isolate (KT923164). These findings are of epidemiological significance due to the fact that TBRV was detected on symptomless Rubus plants, which therefore represent a reservoir of the virus and a threat in case of a symptomatic infection of sensitive cultivars. Accordingly, the results will assist in using appropriate strategies for reducing TBRV incidence in Rubus-growing areas. Moreover, this is, to the best of our knowledge, the first report of TBRV in raspberry and blackberry in Poland.

Early detection of onion neck rot disease in Manitoba

Neck rot caused by the fungus Botrytis allii Munn. is one of the most devastating diseases of onions (Allium cepa L.), resulting in significant yield losses. This disease is latent in nature developing symptomless onion plants in the field with bulbs typically showing symptoms 1–2 months after harvest in the storage. Molecular studies were conducted to detect latent infections of Botrytis neck rot in the onion fields of Manitoba, Canada. Plant samples of onion cultivars ‘Redwing’ and ‘Pocono’ were collected every 10 days throughout the growing season, starting from planting until bulb harvesting during 2018, 2019, and 2020 from a research farm in Brandon, Manitoba, and plant samples of ‘Redwing’ were collected during 2019 and 2020 from a commercial vegetable farm in Portage La Prairie, Manitoba. The amplified DNA fragment of onion leaves and the neck region of collected samples were subjected to polymerase chain reaction using the Botrytis-specific primer pair BA2f/BA1r. Botrytis allii was detected on onion samples collected from the commercial farm as early as the end of June 2019 and 2020 when plants were at the 5–7 leaf stage. The majority of onion samples collected from the research farm also started testing positive for the pathogen from June (2019, 2020) and July (2018) onwards. This knowledge about the timing of infection in the field will be useful in helping farmers to develop and evaluate management strategies in the field, and also predict the storability and availability of quality bulbs for sale.

Use of positive selection technique to manage yam viruses in seed yam production by Ghanaian farmers

Positive selection technique (PST) involves physical examination of plants at vegetative stage for viral disease symptoms and using tubers from apparently symptomless plants as planting materials in seed yam production. This study determined PST use among farmers in Atebubu-Amantin and Ejura-Sekyedumase Municipalities of Ghana. Viral diseases were observed on 63 PST and 63 non-PST farms within these Municipalities. PST farms (two in third season and two starters) were selected to assess the impact of continuous PST practice on plant establishment, disease incidence, severity and yield. Harvested seed yams from asymptomatic and symptomatic plants were sampled for virus detections using Double Antibody Sandwich-Enzyme Linked Immunosorbent Assay (DAS-ELISA). Viral disease incidence (35.70%) and severity (1.51) observed on PST farms were significantly lower than non-PST farms with 54.11% and 2.80, respectively (p< 0.05). PST farms in the third season had higher plant establishment (66 plants/30 m2) and yield (48.32 kg/30 m2) with lower disease incidence (28%) and severity (1.50) compared to PST starters which respectively were 60 plants/30 m2, 33.14 kg/30 m2, 52% and 2.3 (p< 0.05). DAS-ELISA showed that, 85% of harvested seed yams from symptomatic plants were infected with YMV, CMV, or YMMV as against 35% seed yams from asymptomatic plants. YMV was highly accumulated in seed yams from symptomatic plants (0.344) than those from asymptomatic plants (0.269). The current findings show that PST if practised by farmers could minimise viral diseases in seed yams. However, poor observation of viral symptoms by farmers and latent viral infection of plants could be limitations which need to be considered in further studies. Key words: Double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA), latent viral infection, virus accumulation, yam viruses.

First report of a 16SrII‐C phytoplasma associated with Artemisia sieberi witches’‐broom disease in Iran

Artemisia sieberi (Asteraceae) is an important perennial plant that is common in the pastures, mountains and deserts of Iran. In 2019, A. sieberi showing little leaf, yellowing, internode shortening and witches’-broom symptoms (Fig. 1) were observed around Abarkooh (Yazd province, Iran). The disease incidence was up to 5%. Total DNA was extracted from 0.2 g of fresh midrib tissue from 10 diseased and five symptomless plants and was tested for the presence of phytoplasma DNA by direct PCR using the P1/P7 primers and nested PCR using the P1/P7 and the R16F2n/R16R2 primers (Lee et al., 1998). Expected amplicons of 1.8 and 1.25 kb were obtained from all symptomatic but not from asymptomatic plants. R16F2n/R16R2 amplicons yielded the same RFLP patterns as those obtained from the 16SrII-C subgroup (Lee et al., 1998) after restriction with AluI, HhaI, HinfI, HpaII, MseI and RsaI enzymes. Three nested PCR products were cloned and sequenced. The sequences were identical and a consensus sequence was deposited in GenBank (Accession No. MZ151480). Sequence comparison by BLAST analysis showed the highest identity with members of ‘Candidatus Phytoplasma aurantifolia’ species (e.g. MH363612 and KJ442846). Phylogenetic analysis using the neighbour-joining method (MEGA software version 6.0) confirmed that the A. sieberi witches’-broom phytoplasma clustered within the 16SrII phytoplasma group clade, closest to strains affiliated to the 16SrII-C subgroup (Fig. 2). Computer-simulated analysis with 17 restriction endonucleases using iPhyClassifier (https://plantpathology.ba.ars.usda.gov/cgibin/resource/iphyclassifier.cgi) showed that the RFLP pattern derived from the A. sieberi witches’-broom phytoplasma 16S rRNA gene resembled the reference pattern of the 16Sr group II, subgroup C (AJ293216), with a pattern similarity coefficient of 0.99. The occurrence of 16SrII-C phytoplasma strains was previously reported from Iran on Daucus carota, Medicago sativa, Prunus dulcis, Vicia faba (Siampour et al., 2019), Alhagi maurorum (Esmaeilzadeh-Hosseini & Salehi, 2021), P. armeniaca (Rasoulpour et al., 2019) and P. persica (Salehi et al., 2020). Previous studies in Iran have shown that Circulifer haematoceps can transmit 16SrII group phytoplasmas; this leafhopper is polyphagous and could feed on A. sieberi, which may act as a reservoir host for 16SrII-C phytoplasma strains. Association of a 16SrII-D phytoplasma strain with A. sieberi has been previously reported from the Hormozgan province, Iran (Hemmati & Nekoohi, 2019). To our knowledge this is the first report of A. sieberi as a new host of the 16SrII-C phytoplasma subgroup in Iran. This paper is part of the results of project no. 100-11-81-108 approved and supported by Agricultural Research, Education and Extension Organization (AREEO), Ministry of Agriculture, Iran.

Validation and use of a qPCR protocol to quantify the spread of Ralstonia solanacearum in susceptible and resistant eucalypt plants

AbstractBacterial wilt caused by Ralstonia solanacearum is a serious disease of eucalypt in humid and high temperature areas worldwide. Spreading of the bacterium in the field or to other nurseries occurs mainly by symptomless infected plant material. The use of pathogen‐free propagating material as well as planting of resistant genotypes are currently the only strategies used for disease control. Therefore, a reliable and sensitive method for detection of low titres of R. solanacearum in infected plant tissue is essential for the success of management programmes. In this work, we adapted an efficient intercalating dye‐based real‐time PCR protocol to detect the bacterium in symptomless eucalypt plants as well as to investigate its movement in eucalypt clones CLR172 and CLR371, which exhibit resistant and susceptible phenotypes, respectively. We found that the bacterium translocates acropetally and basipetally in inoculated but symptomless cuttings of the resistant clone, as in cuttings of the susceptible clone displaying symptoms. Nevertheless, a smaller concentration of bacterial DNA was detected in tissues of the resistant clone. Mature biofilms occluding the xylem vessels were present in the susceptible clone whereas only single cells or small aggregates were observed in the resistant clone. This work contributes to improve our knowledge of the colonization process of R. solanacearum in eucalypt clones with different levels of susceptibility and to understand how the defence mechanisms against bacterial wilt in Eucalyptus work. Our findings could aid in the selection of the most resistant eucalypt clones to be used in wilt disease management programmes.

Phytoplasma-induced biochemical and genetic variations in Crassula argentea

Phytoplasma is a plant pathogenic bacteria that causes several morphological abnormalities.This study reports on biochemical and genetic variability between the phytoplasma infected (PI) and symptomless Crassula argentea plants using RAPD markers. Chemical composition of normal plants was higher of all elements. However, change in ferrous (Fe) content was not significant between normal and abnormal plants. Infected plants had potassium content higher than normal plant. Also, chlorophyll contents were decreased by phytoplasma infection. Water content was higher in infected plant than normal plant The electrophoresis revealed a high level of polymorphism among the studied plants. A total number of 67 amplified bands were generated across the PI and symptomless plants with polymorphism percentage of 32.8. The primers OPC10, OPK05 and OPU05 yielded different polymorphic banding patterns that were unique to each primer and distinguishable over the PI and symptomless plants. RAPD molecular marker analysis revealed epigenetic variations between normal and phytoplsma infected plants, and itcould be utilized for the identification of Crassula genotypes.