Occurrence of the Iflavirus-like Tomato Matilda Virus in Solanum Species in South Africa.

Abstract

Tomato matilda virus (TMaV) is an iflavirus-like virus that was first reported by Saqib et al. (2015) in symptomless tomato plants in Australia. Those authors demonstrated using phylogenetic analysis that TMaV was an iflavirus, and that it replicated in plants and was transmitted between plants. However, infection was symptomless in tomato and aubergine, and induced mild symptoms in chilli plants. This was the first report of a plant-infecting iflavirus, a genus of insect viruses, suggesting a potential evolutionary transition of iflaviruses into plant hosts. Here we report the detection of TMaV in wild Solanum chenopodioides and Solanum sisymbriifolium in South Africa. In a survey for viruses of wild Solanum species, leaf tissues from S. chenopodioides and S. sisymbriifolium displaying rugosity and chlorotic mottling were collected from roadsides and potato and tomato farms in five provinces (Free State, Gauteng, KwaZulu Natal, Limpopo and Mpumalanga) in South Africa. Total RNA extracted from 10 plants for each species was pooled (500 ng/sample). Ribosomal RNA removal, cDNA library construction and high throughput sequencing (HTS) using the Illumina HiSeq PE150 were conducted by Novogene Co. Ltd (Beijing, China). From S. chenopodioides and S. sisymbriifolium, 44 052 441 and 47 515 569 total clean reads were obtained, respectively. Using Trinity and SPAdes within the VirFind pipeline (Ho and Tzanetakis, 2014), 68711 and 21125 contigs were assembled. BLASTn search of the contigs revealed the presence of TMaV as well as cowpea tombusvirid 1 (Tombusviridae), pepper veinal mottle virus, African eggplant mosaic, potato virus Y (Potyviridae), cucumber mosaic virus, tomato necrotic spot virus (Bromoviridae), tobacco vein clearing virus and cauliflower mosaic virus (Caulimoviridae) in S. chenopodioides and S. sisymbriifolium. The TMaV contigs from S. chenopodioides (n = 33) and S. sisymbriifolium (n = 88) were mapped to the TMaV genome (HQ260868) reported by Saqib et al. (2015). The assembled draft TMaV genomes from S. chenopodioides (7547 bp, MW717924) and S. sisymbriifolium (7553 bp, MW717925) covered 98.5% of that reference genome with 98.0 and 97.8% sequence identity, respectively, and 98.5 and 98.3% sequence identity to a TMaV isolate (MK517476) from Italy. The two draft genomes displayed 99.5% sequence identity to each other. BLASTn analysis of these draft genomes only retrieved hits for TMaV and blackberry iflavirus A (BVA), another plant-infecting iflavirus (Khadgi, 2015). No insect iflavirus hits were obtained, thereby potentially excluding contamination by insect viruses. The two TMaV sequences displayed 81.9-89.9% identity to the partial sequences of BVA. The presence of TMaV in S. chenopodioides and S. sisymbriifolium was confirmed by RT-PCR of the pooled RNA and sequencing using primer sets reported by Saqib et al. (2015), Matil_F1 (ACGGCAGCCACGCTAAGAAA)/Matil_R1 (TCATTATGGCGCCTGTATGG) covering TMaV genome locations 1008-1821 (includes rhv-like 1 and partially rhv-like 2 structural protein genes) and Matil_F9 (TTTACCTTGTGCTGTTGCAG)/ Matil_R9 (ACCTGCAGACGTTGTTAATT) spanning positions 6485-7214 (sequence region encoding partial cystein protease, nucleotide binding site and partial RNA dependent RNA polymerase). The sequences obtained from the amplicons (accessions MW717926 - MW717929) displayed 97.2 - 98.4% sequence identity to those of the Saqib et al. (2015) genome, and were fully identical to the TMaV sequences generated initially using HTS. The detection of TMaV in these Solanum spp. further supports the concept of plant-infecting iflaviruses. Saqib et al. (2015) proposed the genus Tomavirus within Iflaviridae to accommodate TMaV. This is possibly similar to Tospoviridae, the only plant-infecting family of the order Bunyavirales, which is composed of viruses of arthropods and vertebrates (Ullman et al. 2005). Further studies are needed to understand TMaV infection of different plant hosts, especially crops of economic importance.