SV40-transformed Cells Research Articles

Reduced Levels of α1(XI) Procollagen mRNA in SV40-Transformed Cells

We have used mRNA differential display to search for cellular genes whose expression is modulated in SV40-transformed cells. We identified a gene, the α1 subunit of type XI procollagen (α1(XI)), whose mRNA level is reduced in most F111 rat cell lines that express either wild-type SV40 T antigen or an amino-terminal fragment of T antigen (T147D). α1(XI) mRNA expression is also reduced in rat embryo fibroblasts transformed by SV40. This phenomenon is not unique to rat cells, because α1(XI) mRNA expression is repressed in C3H10T1/2 mouse cells transformed by either T147D or wild-type SV40. Interestingly, α1(XI) mRNA levels are not reduced in F111 cells that express only the polyomavirus large T antigen, but are reduced in F111 cells transformed by polyoma virus (which expresses all three polyomavirus T antigens) and in F111 cells that express the adenovirus E1A proteins. Thus, repression of α1(XI) mRNA expression may be a common feature of transformation by DNA tumor viruses.

Regulation of matrix metalloproteinases following cellular transformation

During progression towards malignancy, many tumor cells display changes in their repertoire of matrix metalloproteinases (MMPs) and tissue inhibitors of matrix metalloproteinases (TIMPs). The recent finding that many members of the MMPs are regulated by protooncogenes may explain the frequent observation of changes in MMP gene expression during progression of many tumor types. While studies involving enzymatic assays of MMPs are usually confined to one or a few MMPs, reverse transcription-PCR (RT-PCR) permitted the analysis of seven members of the MMP family and two members of the TIMP family in several normal and transformed cell lines. RT-PCR permitted us to confirm the observation that MMP-9 is activated following transformation and also to observe the previously unreported activation of MMP-7 in SV40-transformed cells. It has previously been found that MMP-1, -2, -3, -8, and -9 are upregulated by phorbol esters; we have found that MMP-10 is also upregulated by phorbol esters. The phorbol ester upregulation of MMP-1, -3, and -10 was found to be abolished in cells transformed by SV40 virus. Several studies have shown that MMP-1 is upregulated by an integrin-mediated signal transduction pathway. This study demonstrates that MMP-3 and MMP-10 are also regulated by integrin-mediated signal transduction and that upregulation by this pathway is abolished following SV40 transformation. In summary, the more global view of MMP expression afforded by RT-PCR indicates that MMP-1, -3, and -10 are regulated by both integrin-mediated signal transduction and phorbol esters. While fibroblasts and transformed bone cells express several members of the MMP gene family, several other cell types do not express MMPs.

Distribution and dynamics of mitochondrial nucleoids in animal cells in culture

Mitochondrial (mt) nucleoids were visualized in living cells in culture by staining with the fluorochrome picoGreen. The cell types included a line derived from Xenopus heart endothelial cells (XTH-2), 3T3 cells, SV40-transformed 3T3 cells and primary cultures of Xenopus tadpole epidermis cells. In the permanent cell lines 6-60% of the mitochondria were found to be devoid of DNA. The peaks of the frequency distribution of mtDNA content, as revealed by microfluorometry, were not very distinct, indicating the presence of a high amount of aneuploid mt nucleoids. The maximum size of nucleoids (as derived from fluorescence intensity) was 10-12 times that of the minimum peak value in proliferating cell cultures. A linear ratio was found between the volume of the nucleoids and their DNA content, which is interpreted as a uniform package density. In terminally differentiating tadpole epidermis cells mitochondria form large bodies containing giant nucleoids, while in mitotic cells the mt nucleoids are small and of uniform size. Fusion and fission of the nucleoids were observed to occur either for no visible reason or in connection with fusion and fission events of the mitochondria.

Filensin and phakinin form a novel type of beaded intermediate filaments and coassemble de novo in cultured cells.

The fiber cells of the eye lens possess a unique cytoskeletal system known as the "beaded-chain filaments" (BFs). BFs consist of filensin and phakinin, two recently characterized intermediate filament (IF) proteins. To examine the organization and the assembly of these heteropolymeric IFs, we have performed a series of in vitro polymerization studies and transfection experiments. Filaments assembled from purified filensin and phakinin exhibit the characteristic 19-21-nm periodicity seen in many types of IFs upon low angle rotary shadowing. However, quantitative mass-per-length (MPL) measurements indicate that filensin/phakinin filaments comprise two distinct and dissociable components: a core filament and a peripheral filament moiety. Consistent with a nonuniform organization, visualization of unfixed and unstained specimens by scanning transmission electron microscopy (STEM) reveals the the existence of a central filament which is decorated by regularly spaced 12-15-nm-diam beads. Our data suggest that the filamentous core is composed of phakinin, which exhibits a tendency to self-assemble into filament bundles, whereas the beads contain filensin/phakinin hetero-oligomers. Filensin and phakinin copolymerize and form filamentous structures when expressed transiently in cultured cells. Experiments in IF-free SW13 cells reveal that coassembly of the lens-specific proteins in vivo does not require a preexisting IF system. In epithelial MCF-7 cells de novo forming filaments appear to grow from distinct foci and organize as thick, fibrous laminae which line the plasma membrane and the nuclear envelope. However, filament assembly in CHO and SV40-transformed lens-epithelial cells (both of which are fibroblast-like) yields radial networks which codistribute with the endogenous vimentin IFs. These observations document that the filaments formed by lens-specific IF proteins are structurally distinct from ordinary cytoplasmic IFs. Furthermore, the results suggest that the spatial arrangement of filensin/phakinin filaments in vivo is subject to regulation by host-specific factors. These factors may involve cytoskeletal networks (e.g., vimentin IFs) and/or specific sites associated with the cellular membranes.

High Frequency and Error-prone DNA Recombination in Ataxia Telangiectasia Cell Lines

The only specific DNA repair defect found in ataxia telangiectasia (A-T) cells is mis-repair of cleaved DNA. In this report we measured DNA recombination, given its role in DNA repair and genetic instability. Using plasmids containing selectable reporter genes, we found a higher frequency of both chromosomal recombination (>100 times) and extra-chromosomal recombination (27 times) in SV40-transformed A-T cell lines compared with in an SV40-transformed normal fibroblast cell line. Southern analysis of single A-T colonies exhibiting post-integration recombination revealed that 24/27 had undergone aberrant rearrangements; recombination in normal fibroblast colonies was achieved by gene conversion in 8/11 clones and 10/11 clones showed unchanged copies of the plasmid. Using co-transfection of two integrating plasmids, each containing a separate deletion in the xgprt reporter gene, the 27 times difference in extra-chromosomal recombination was found when the plasmids were cleaved at a distance from the reporter gene. When the plasmids were cleaved within the reporter gene, the co-transfection frequency was reduced in A-T, but was increased in normal cells. We conclude that A-T cell lines have not only a high frequency chromosomal and extra-chromosomal recombination, but also exhibit error-prone recombination of cleaved DNA.

Simian virus 40-, but not human papillomavirus-, transformation of prostatic epithelial cells results in loss of growth-inhibition by 1,25-dihydroxyvitamin D-3

In addition to its well known calcemic actions, 1,25-dihydroxyvitamin D-3 [1,25(OH)(2)D] exhibits differentiating and antiproliferative effects in several types of cancer cells. 1,25(OH)(2)D receptors (VDR) as well as 1,25(OH)(2)D-mediated growth-inhibition have been demonstrated in human prostate cancer cell lines. In order to further develop model systems for the study of 1,25(OH)(2)D action and to elucidate the mechanism of growth-inhibition, we studied several human prostate cell lines immortalized with either simian virus 40 (SV40) or human papillomavirus type 18 (HPV). The SV40-transformed cell lines P69SV40-T and P153SV40-T were not growth-inhibited by 1,25(OH)(2)D at concentrations as high as 100 nM, whereas the HPV-transformed cells PZ-HPV-7 and CA-HPV-10 were growth-inhibited. All cell lines expressed VDR, and VDR mRNA was demonstrated by Northern blot analysis. All cells exhibited induction of 24-hydroxylase mRNA, a 1,25(OH)(2)D responsive gene, after 1,25(OH)(2)D treatment. In an attempt to understand the apparent dissociation of 1,25(OH)(2)D actions in the SV40-transformed cells, we turned to the human prostate cancer cell line DU 145. These cells, like the SV40-transformed cells, are not growth-inhibited but demonstrate induction of 24-hydroxylase mRNA after 1,25(OH)(2)D treatment. DU 145 cells contain a mutated retinoblastoma gene (Rb) which contributes to their uncontrolled growth, analogous to the disruption of Rb by SV40 and HPV. We compared DU,145 cells to DU 145 cells transfected with normal Rb (DU 145/Rb). Similar to DU 145, DU 145/Rb cells were not growth-inhibited by 1,25(OH)(2)D, while 24-hydroxylase mRNA was induced. These results suggest that divergent pathways mediate the growth-inhibitory effect of 1,25(OH)(2)D and its induction of 24-hydroxylase. It also appears that the antiproliferative effect of 1,25(OH)(2)D is mediated by an Rb-independent mechanism.

Phosphorylation of T antigen and p53 in carcinogen-treated SV40-transformed Chinese hamster cells.

SV40-transformed Chinese hamster C0631 cells pretreated with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) display SV40 DNA amplification. This study shows that following MNNG treatment elevated T antigen synthesis and a 4.5-fold reduction in the extent of its phosphorylation occurred in both pulse-labeled and steady-state-labeled cells. The decrease in phosphorylation was found to be inversely related to carcinogen concentration, i.e. an augmented carcinogen concentration brought about a gradual reduction in T antigen phosphorylation and elevated SV40 DNA amplification. Although the majority of phosphorylation sites on T antigen derived from carcinogen-treated cells were underexpressed, as demonstrated by two-dimensional phosphopeptide mapping, peptide 12 bearing phosphoThrl24, which is known to be essential for DNA replication, was overexpressed. Carcinogen-treated cells showed no changes in p53 synthesis, but it was phosphorylated to a lesser degree. Two-dimensional mapping revealed that the predicted N-terminal major phosphopeptide of p53 extracted from C0631 cells exhibited a lower chromatographic mobility than p53 phosphopeptides from SV40-infected monkey BSC-1 cells. In treated C0631 cells the Rf value of this phosphopeptide was higher than that of control p53. This finding could be ascribed to the failure to phosphorylate the corresponding amino acid residue in this peptide. Moreover, treatment did not affect the halflife of either T antigen or p53 proteins, but caused a dramatic rise in the expression of small t antigen, presumably due to amplification of SV40 DNA.

Manganese superoxide dismutase in human pleural mesothelioma cell lines

Mesothelioma is a malignant pleural or intraperitoneal tumor attributable to asbestos exposure in more than 80% of the cases. Manganese superoxide dismutase (MnSOD), a mitochondrial superoxide radical scavenging enzyme, is low in most tumors but is known to be induced by asbestos fibers and certain cytokines. Induction of MnSOD may be associated in asbestos-related pulmonary diseases in vivo. We investigated here MnSOD specific activity and MnSOD mRNA level using healthy human lung tissue, SV40-transformed human pleural mesothelial cells (Met5A), and six human malignant mesothelioma cell line cells. Total SOD (CuZnSOD + MnSOD) and MnSOD activities were 20.0 ± 4.8 U/mg protein and 3.2 ± 1.2 μ/mg protein in healthy human lung tissue, and 25.6 ± 10.7 U/mg and 3.8 ± 1.0 U/mg in Met5A cells, respectively. In four mesothelioma cell lines MnSOD activity was significantly elevated, the highest activity (30.1 ± 8.2 U/mg) was almost 10-fold compared to the activity in Met5A cells. The steady state mRNA level of MnSOD was low in Met5A cells and markedly higher in all mesothelioma cell lines roughly in proportion with enzyme activities. Cytotoxicity experiments, which were conducted in four cell lines, indicated that cells containing high MnSOD mRNA level and activity were resistant to the mitochondrial superoxide-producing agent menadione. In conclusion, our results suggest that human mesothelioma may express high levels of MnSOD, which is associated with high oxidant resistance of these cells.

Cytokine production by SV40-transformed adherent synovial cells from rheumatoid arthritis patients

We examined the mRNA levels for various cytokines, including IL-1α, IL-1β, TNFα, TGF-β 1, GM-CSF, IL-6, IL-8, bFGF, PDGF-A, PDGF-B and IL-1ra, and IL-1β converting enzyme, and the protein levels of some of these cytokines in 19 SV40-transformed synovial cell clones. Among those tested, the mRNA levels for IL-6, bFGF and PDGF-A in rheumatoid arthritis (RA) cell clones were greater than those in non-RA cell clones. Moreover, except for one osteoarthritis (OA) cell clone, the mRNA levels for IL-8 in RA cell clones were also greater than those in non-RA cell clones. Although the protein levels were not always correlated with the mRNA levels, the exception being the same OA cell clone, the protein levels of cytokines, such as IL-1α, IL-1β, IL-6 and IL-8, in RA cell clones were greater than those in non-RA cell clones. TNF-a was not detected in any cells tested at either the mRNA or the protein level. TNF-α upregulated the expression of GM-CSF mRNA in both RA cell clones and one OA cell clone, but not in the other OA cell clone or the normal cell clone. Taken together, these SV-40 transformed synovial cell clones retained many of the original characteristics in terms of cytokine production.

Cannabinomimetic behavioral effects of and adenylate cyclase inhibition by two new endogenous anandamides

We have previously shown that the endogenous putative cannabinoid ligand arachidonylethanolamide (anandamide, 20:4, n − 6) induces in vivo and in vitro effects typical of a cannabinoid agonist. We now report that two other endogenous anandamides, docosatetraenylethanolamide (anandamide, 22:4, n − 6) and homo-γ-linolenylethanolamide (anandamide, 20:3, n − 6), have similar activities. The new anandamides bind to SV40-transformed African green monkey kidney cells transfected with the rat brain cannabinoid receptor cDNA and display K I values of 253.4 ± 41.1 and 244.8 ± 38.7, respectively. The value found for arachidonylethanolamide was 155.1 ± 13.8 nM. In addition, the new anandamides inhibit prostaglandin E 1-stimulated adenylate cyclase activity in Chinese hamster ovary-K 1 cells transfected with the cannabinoid receptor, as well as in N 18TG 2 mouse neuroblastoma cells that express the cannabinoid receptor naturally. The IC 50 values for the inhibition of adenylate cyclase in transfected Chinese hamster ovary-K 1 cells were 116.8 ± 8.7 and 109.3 ± 8.6 nM for docosatetraenylethanolamide and homo-γ-linolenylethanolamide, respectively. These values were similar to that obtained with arachidonylethanolamide (100.5 ± 7.7 nM), but were significantly higher than the IC 50 value observed with the plant cannabinoid Δ 9-tetrahydrocannabinol (9.2 ± 8.6 nM). The inhibitory effects of the anandamides on adenylate cyclase activity were blocked by pertussis toxin, indicating the involvement of pertussis toxin-sensitive GTP-binding protein(s). In a tetrad of behavioral assays for cannabinoid-like effects, the two new anandamides exerted similar behavioral effects to those observed with Δ 9-tetrahydrocannabinol and arachidonylethanolamide: inhibition of motor activity in an open field, hypothermia, catalepsy on a ring, and analgesia on a hot plate.

A tumor-associated glycosylation change in the glucose transporter GLUT1 controlled by tumor suppressor function in human cell hybrids.

Studies of human cell hybrids have provided evidence that the tumorigenicity of a cervical carcinoma (HeLa) is under the control of a putative tumor suppressor on chromosome 11. Using these human cell hybrids, we found a tumor-associated glycosylation change in the glucose transporter GLUT1, which is an N-linked glycoprotein at the plasma membrane. The non-tumorigenic HeLa x fibroblast cell hybrid CGL1 and the normal diploid fibroblast WI38 expressed the 50-55 kDa GLUT1, whereas in a tumorigenic segregant hybrid, CGL4, as well as in parental HeLa cells, GLUT1 glycosylation was altered and its molecular mass was about 70 kDa. However, the altered GLUT1 glycosylation was not observed in SV40-transformed WI38 cells, suggesting a correlation between this glycosylation change and a putative tumor suppressor function. Further investigations using glycosidases, glycosylation inhibitors and lectin-affinity chromatography demonstrated that the tumor-associated glycosylation change in GLUT1 was mainly due to the increase in N-acetyl-lactosamine repeats in the N-linked oligosaccharides. In accordance with the altered glycosylation, affinity for 2-deoxyglucose in the tumorigenic CGL4 cells increased 2-fold, but there was little change in the Vmax. These results suggest there may be a functional role for the modulation by glycosylation of GLUT1 in the tumorigenic behavior of CGL4 and HeLa cells.

A casein-kinase-2-related protein kinase is tightly associated with the large T antigen of simian virus 40.

The simian virus 40 (SV40) large T antigen is a multifunctional protein involved in SV40 cell transformation and lytic virus infection. Some of its activities are regulated by interaction with cellular proteins and/or by phosphorylation of T antigen by various protein kinases. In this study, we show that immuno-purified T antigen from SV40-transformed cells and from baculovirus-infected insect cells is tightly associated with a protein kinase that phosphorylates T antigen in vitro. In the presence of heparin or a peptide resembling a protein kinase CK2 recognition site, the phosphorylation of T antigen by the associated kinase is reduced whereas a p34cdc2-kinase-specific peptide has no influence. In addition, the T-antigen-associated protein kinase can use GTP and ATP as phosphate donors. These properties together with the observation that immunopurified T antigen can be phosphorylated by the addition of protein kinase CK2 suggest that at least one of the T-antigen-associated protein kinases is CK2 or a protein-kinase-CK2-related enzyme. The association of recombinant CK2 with T antigen was strongly confirmed by in vitro binding studies. Experiments with temperature-sensitive SV40-transformed cells provide evidence for a close correlation between cell transformation and phosphorylation of T antigen by the associated protein kinase.

Failure to confirm presence of SV40 sequences in human tumours

THE MONKEY polyomavirus, simian virus 40 (SV40), is a potent tumour-inducing virus in laboratory animals. Although SV40 has not been associated with human disease [l, 21, DNA sequences similar to those of SV40 have been found recently in ependymomas and choroid plexus tumours of chidren using a polymerase chain reaction (PCR) technique [3]. Our interest in the possibility that these sequences may be involved in the oncogenesis of other malignancies prompted us to reproduce and further investigate these data. DNA from ependymomas was provided by H. Budka (Institute of Neuropathology) and an SV40-transformed rat fibroblast cell line by Ch. Czerni (Institute for Cancer Research). DNA was isolated from paraffin-embedded tissue and cell homogenates using standard methods. As DNA in paraffinembedded tissue can be degraded, isolation of intact DNA was proven by amplification of [{-globin sequences. To achieve high sensitivity for the amplification of SV40 DNA, we used a nested PCR protocol with outer primers: SVO for S’TGATGAATGGGAGCAGTGGTGGAA 3’; SVO.rev 5’ CCCACCTGGCAAACTTTCCTCAAT 3’, amplifying a 490 bp fragment, followed by a second PCR withinner primers SV.for3 and SV.rev, as used by Bergsagel and associates [3]. The products were analysed on agarose gels and stained with ethidium bromide. Figure 1 shows dilution experiments of DNA

Retinoic acid enhances plasminogen activation on the cell surface

The importance of cell-associated plasminogen activation in the extracellular matrix degradation processes is becoming increasingly evident. To elucidate the modulators of net plasminogen activation on the cell surface, we have recently established an assay system. Using this system, we examined the effects of several candidate modulators on cell surface plasminogen activator activity in the human fibrosarcoma cell line HT-1080 and the SV40-transformed human lung fibroblast cell line WI-38 VA 13 2RA. Although the majority of the candidates had no effect or a selective effect on either cell line, only retinoic acid markedly enhanced cell surface plasminogen activator activity in both HT-1080 and WI-38 VA13 2RA cells in a time-dependent manner. The effect of retinoic acid was neutralized by actinomycin D. The enhanced activity was inhibited by anti-uPA IgG and by pretreatment with phosphatidylinositol-specific phospholipase C. These findings suggest that retinoic acid increases the amount of receptor-bound uPA via de novo synthesis, and that it plays an important role in modulating cell-associated plasminogen activation.

Increased uptake of low density lipoprotein by SV40-transformed smooth muscle cells

We compared the metabolism of low density lipoprotein (LDL) in SV40-transformed smooth muscle cells (TSMCs) to that in nontransformed smooth muscle cells (SMCs). When SMCs were incubated in medium with 100 μg/ml LDL for 24 hours, they did not accumulate sudanophilic lipid droplets. On the other hand, when TSMCs were incubated in medium containing more than 100 μg/ml LDL, they accumulated a large amount of lipid droplets in their cytoplasm. When cells were incubated with 200 μg/ml LDL for 24 hours, cholesteryl ester levels significantly increased in TSMCs (18.3 ± 3.53 μg/mg protein), as compared with SMCs (2.40 ± 0.85 μg/mg protein). However, there was no difference in the cellular level of free cholesterol between the TSMCs and SMCs. Although the TSMCs and SMCs had a similar number of binding sites for LDL, the TSMCs demonstrated a markedly higher uptake of LDL labeled with 1,1′-dioctadecyl-3,3,3′,3′-tetramethyl indocarbocyanine perchlorate (Dil-LDL), compared with the SMCs. SMCs that had been pretreated with 100 μg/ml of unlabeled LDL for 24 hours showed a decreased uptake of Dil-LDL. In contrast, TSMCs incorporated Dil-LDL independently of the preincubation with 100 μg/ml LDL. The presence of brefeldin A, which may block the transport of glycoproteins from the ER to Golgi apparatus, had less of an effect on the uptake of LDL in the TSMCs than in the SMCs. These results suggest that SV40-transformed smooth muscle cells show an increased uptake of LDL independent of the cellular cholesterol level, which may induce the accumulation of lipid droplets in their cytoplasm. A LDL receptor-independent pathway may be related to the increased uptake of LDL in SV40-transformed smooth muscle cells.

Identification of a New Acute Phase Protein

We have previously reported mouse SIP24 protein as a secreted inducible protein produced by quiescent Balb/c 3T3 cells. SIP24 can be produced in response to many factors, including serum, basic fibroblast growth factor, prostaglandin F2 alpha, phorbol ester, and dexamethasone. Here we present evidence to show that SIP24 is the product of mouse 24P3 mRNA. The 24P3 cDNA was originally cloned from an SV40-transformed quiescent mouse primary kidney cell culture, and it has been classified as a new member of the lipocalin protein family. We show that the SIP24/24P3 protein and mRNA increase dramatically in mouse serum and liver during the acute phase response induced by turpentine injection. Injection of mice with dexamethasone caused a modest increase of SIP24/24P3 mRNA in the liver. Tissue distribution studies revealed that SIP24/24P3 is mainly expressed in liver during the acute phase response. SIP24/24P3 was also detected in the brain and the uterus. In mouse BNL (Balb/c normal liver) cells, the production of SIP24/24P3 is stimulated by tumor necrosis factor alpha, which is a major regulator of the expression of other acute phase proteins. From its pattern of regulation, we conclude that SIP24/24P3 is a new type 1 acute phase protein.

Construction of 110 Cosmid Markers and a 4.5-Mb YAC Contig on Human Chromosome 8p12-q11

Microcell hybrids containing various regions of human chromosome 8 were formed by microcell-mediated transfer of neo-tagged chromosome 8 into the cells derived from severe combined immunodeficiency (SCID) mouse. Thus, 110 cosmid markers were isolated from SV40-transformed SCID fibroblast cell line (SCVA) containing a p12-q11.1 region of human chromosome 8 and were assigned to eight regions in 8p12-q11.1, using a microcell-hybrid panel. For positional cloning of a human gene that restores the DNA-repair defect in a mouse with SCID on 8p11.1-q11.1 (SCID region), we constructed a yeast artificial chromosome (YAC) contig of about 4.5 Mb. Overlapping YACs were further aligned by restriction mapping, using rare-cutting restriction endonucleases. The cosmids and YAC contig should facilitate isolation of the SCID gene and other genes, such as the Werner syndrome-responsible gene in or near this region.

ALTERED GROWTH-REGULATION OF PROSTATIC EPITHELIAL-CELLS BY HUMAN PAPILLOMAVIRUS-INDUCED TRANSFORMATION

Six lines of human papillomavirus (HPV)-transformed prostatic epithelial cells, clonally-derived from transfection of three different parental cell strains, were analyzed for their ability to respond to stimulatory and inhibitory factors known to regulate prostatic cell growth. The cell lines were tested in a serum-free medium that was developed specifically for analysis of low-density growth of prostatic cells in order to mitigate any effects of autocrine factors. This medium has been used previously to characterize the growth regulatory pathways of primary cultures of prostatic epithelial cells derived from normal, benign prostatic hyperplasia (BPH), or adenocarcinoma tissues, as well as an SV40-transformed cell line (pRNS-1-1) that was derived from the same parental cell strain as four of the HPV-transformed lines used in the present study. The responses of the HPV-transformed cell lines to three essential mitogens in the medium - epidermal growth factor (EGF), bovine pituitary extract (BPE) and insulin-like growth factor (IGF) - were similar to those of primary cultures and pRNS-1-1, except that two of the HPV-transformed cell lines were IGF-independent for growth. The presence or absence of cholera toxin (CT), which acts synergistically with peptide growth factors, only mildly affected the proliferation of HPV-transformed cells, which is also true for primary cultures and pRNS-1-1. However, while hydrocortisone (HC) also has only minimal effect on the growth of primary cultures and pRNS-1-1, four of the HPV-transformed lines were very dependent on HC for growth. With regard to growth-inhibitory factors, all of the cell lines (HPV- or SV40- transformed) were insensitive to tumor necrosis factor-alpha (TNFalpha), which is a common feature of transformed cells. However, the cell lines remained sensitive to the growth-inhibitory properties of retinoic acid (RA) and transforming growth factor-beta (TGF(beta)). The HPV-transformed cell lines were also inhibited by 1,25(OH)(2) vitamin D-3 [1,25(OH)(2)D-3], although pRNS-1-1 cells were not. Perhaps the most unexpected finding in our study was the apparent loss of responsiveness of all of the transformed lines to fibroblast growth factor (FGF). Alterations in FGF pathways have been described for prostatic cancer cell lines and changes in expression of FGF or receptors may be involved in prostatic carcinogenesis. Our study demonstrates that the availability of primary cultures, SV40- and HPV- transformed cell lines and a well-defined culture system will provide an opportunity to characterize the processes involved in malignant transformation of prostatic cells.

Dissociation of Mitogenesis and Transforming Activity by C-Terminal Truncation of the Insulin-like Growth Factor-I Receptor

We have investigated the mitogenic and transforming ability of an IGF-I receptor with a 108-amino-acid C-terminal truncation in R cells, which are 3T3-like cells derived from mouse embryos in which the IGF-I receptor genes have been disrupted by targeted homologous recombination. R cells stably transfected with expression plasmids encoding either a wild-type or a truncated human IGF-I receptor were capable growing in serum-free medium supplemented solely with IGF-I. This response was observed over a wide range of receptor levels. R cells overexpressing the wild-type IGF-I receptor also formed colonies in soft agar, and colony formation was augmented by coexpression of the SV40 large T antigen. However, all the examined clones of R -cells expressing the truncated IGF-I receptor exhibited a dramatically impaired ability to grow in soft agar, even in the presence of the T antigen. The inability to Form colonies in soft agar was not due to a quantitative impairment of signal transduction, because: (1) SV40-transformed cells with a physiological level of the wild-type IGF-I receptor did not respond to IGF-I with cell proliferation, but grew in soft agar; (2) R - cells stably transfected with both a truncated receptor and T antigen, on the contrary, responded with mitogenesis to IGF-I but could not form colonies in soft agar; (3) some clones with the truncated receptor expressed levels of receptor roughly 100-fold the level of wild-type cells; and (4) several parameters of IGF-I receptor signal transduction were not impaired in cells stably transfected with a truncated receptor. Furthermore, overexpression of an activated ras in cells with the truncated IGF-IR did not restore their ability to proliferate under anchorage-independent conditions. We conclude that the last 108 amino acids of tile IGF-I receptor are not essential for a mitogenic response to IGF-I, but are required for transformation (as assessed by the ability to grow in soft agar), indicating that these two functions can be dissociated at an intramolecular level. Moreover, although ras (activated) certainly plays a role in transformation, the transforming activity of the IGF-IR also requires signaling elements that are ras-independent.

Quantitative cytofluorimetric determination of cell membrane‐associated large tumor antigen on SV40‐transformed cells

The aim of this study was to quantitate the number of cell membrane-located SV40 large tumor antigen (large T) molecules of SV40-transformed cell lines by cytofluorimetric analysis. Five different SV40-transformed cell lines were labelled by either a biotin- or a fluorescein-conjugated monoclonal antibody, PAb1605, which is specific for the large T carboxyterminus. The conjugated-antibody fluorescence signals of the stained large T molecules of transformed cells were measured via cytofluorimetry. Comparison of the fluorescence signals of calibrated beads bearing a known number of fluorescein molecules to the signals of conjugated PAb1605 antibodies bound on microbeads to a defined number of IgG binding sites made it possible to determine the number of antibody-accessible large T molecules per SV40-transformed cell. The numbers (x10(-4)) found per cell were 1.0 (ELONA, hamster), 3.0 (VLM, mouse), 3.5 (mKSA, mouse), 11 (C57SV, mouse), and 5.5 (SV80, human), respectively. Thus, the technique described allows a precise quantitation of surface-exposed, antibody-accessible viral antigen expression.