Failure to confirm presence of SV40 sequences in human tumours

Abstract

THE MONKEY polyomavirus, simian virus 40 (SV40), is a potent tumour-inducing virus in laboratory animals. Although SV40 has not been associated with human disease [l, 21, DNA sequences similar to those of SV40 have been found recently in ependymomas and choroid plexus tumours of chidren using a polymerase chain reaction (PCR) technique [3]. Our interest in the possibility that these sequences may be involved in the oncogenesis of other malignancies prompted us to reproduce and further investigate these data. DNA from ependymomas was provided by H. Budka (Institute of Neuropathology) and an SV40-transformed rat fibroblast cell line by Ch. Czerni (Institute for Cancer Research). DNA was isolated from paraffin-embedded tissue and cell homogenates using standard methods. As DNA in paraffinembedded tissue can be degraded, isolation of intact DNA was proven by amplification of [{-globin sequences. To achieve high sensitivity for the amplification of SV40 DNA, we used a nested PCR protocol with outer primers: SVO for S’TGATGAATGGGAGCAGTGGTGGAA 3’; SVO.rev 5’ CCCACCTGGCAAACTTTCCTCAAT 3’, amplifying a 490 bp fragment, followed by a second PCR withinner primers SV.for3 and SV.rev, as used by Bergsagel and associates [3]. The products were analysed on agarose gels and stained with ethidium bromide. Figure 1 shows dilution experiments of DNA