Substrate Utilization Patterns Research Articles

Abstract 17989: C-Myc Regulates Substrate Oxidation Patterns During Early Pressure-Overload Hypertrophy

Background: Cardiac hypertrophy alters substrate metabolism towards an increased reliance on glucose utilization. Inactivation of the transcription factor c-Myc (Myc) in the adult myocardium attenuated hypertrophic growth and decreased expression of glycolytic genes in response to aortic constriction. Accordingly, we hypothesize that Myc is an important regulator of substrate utilization for the citric acid cycle during pressure overload hypertrophy. Methods: We subjected FVB mice with cardiac specific, inducible Myc inactivation (MycKO) and non-transgenic littermates (Myc-intact) to transverse aortic constriction (n=7/group). After two weeks, function was measured in isolated working hearts along with substrate fractional contributions to the citric acid cycle by using perfusate with 13 C labeled mixed fatty acids, lactate, ketones and unlabeled glucose and insulin. Results: Cardiac function was similar between the groups although dP/dT, -dP/dt and developed pressure trended towards improvement in the MycKO mice. MycKO had reduced fractional contribution of fatty acids to the citric acid cycle versus Myc-intact (28%±3 vs 37%±2, p<0.05) along with ketones (19%±1 vs 25%±1, p<0.05). Unlabeled, presumably glucose, contribution increased in MycKO (33%±4 vs 19%±2, p<0.05). While MVO2 was similar between the groups, fatty acid and ketone oxidative flux was decreased in MycKO. Conclusion: Myc regulates substrate oxidation preferences during pressure overload cardiac hypertrophy. Further, our data indicates that the change in substrate utilization pattern during hypertrophy is not necessary to maintain cardiac function during this hemodynamic stress.

Tritirachium candoliense sp. nov., a novel basidiomycetous fungus isolated from the anoxic zone of the Arabian Sea

A fungal culture (FCAS11) was isolated from coastal sediments of the Arabian Sea during the anoxic season. Multigene phylogenetic analyses confidentially place the organism as a novel species within the recently defined class Tritirachiomycetes, subphylum Pucciniomycotina, phylum Basidiomycota. We named the new species Tritirachium candoliense and provide the first description of a member of this class from a marine environment. DNA sequences and morphological characters distinguish T. candoliense from previously described Tritirachium species. Its growth characteristics, morphology, and ultrastructural features showed that under anoxic conditions the species grows slowly and produces mainly hyphae with only few blastoconidia. Electron microscopy revealed differences when the culture was exposed to anoxic stress. Notable ultrastructural changes occur for example in mitochondrial cristae, irregularly shaped fat globules and the presence of intracellular membrane invaginations. We assume that the growth characteristics and substrate utilization patterns are an adaptation to its source location, the seasonally anoxic environment of the Arabian Sea.

Assessment of Changes in Community Level Physiological Profile and Molecular Diversity of Bacterial Communities in Different Stages of Jute Retting

Retting of jute is essentially microbiological and biochemical in nature. Community Level Physiological Profiles (CLPP) as well as genomic diversity of bacterial communities were assessed in water samples collected during pre-retting, after 1st and 2nd charges of retting. The water samples were collected from two widely cultivated jute growing locations, Sonatikari (22 degrees 41'27"N; 88 degrees 35'44"E) and Baduria (22 degrees 44'24"N; 88 degrees 47'24"E), West Bengal, India. The CLPP, expressed as net area under substrate utilization curve, was studied by carbon source utilization patterns in BIOLOG Ecoplates. Molecular diversity was studied by polymerase chain reaction followed by denaturing gradient gel electrophoresis (PCR-DGGE) of total DNA from water samples. Both between locations and stages of retting, substrate utilizations pattern were carbohydrates > carboxylic acids > polymers > amino acids > amines/amides > phenolic compounds. Differential substrate utilization pattern as well as variation in banding pattern in DGGE profiles was observed between the two locations and at different stages of retting. The variations in CLPP in different stages of retting were due to the change in bacterial communities.

Characterization of bacterial isolates from water reclamation systems on the basis of substrate utilization patterns and regrowth potential in reclaimed water

Microbial regrowth causes problems during water reuse. Comprehensive understanding of the microorganisms that can regrow in reclaimed water and their substrate requirements are necessary. In this study, potential regrowth organisms were isolated from seven water reclamation plants in Japan. Based on 16S rDNA analysis, the isolates were grouped into 34 operational taxonomic units, belonging to Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Actinobacteria, Bacteroidetes, and Firmicutes. Substrate utilization profiling using Biolog microplate™ classified the isolates into four groups. Bacteria in Cluster 1 (e.g., Methylobacterium sp. and Acinetobacter sp.) mainly utilized polymers, esters, amides, and alcohol. Isolates in Cluster 2 (e.g., Flavobacterium sp. and Microbacterium sp.) preferred to utilize polymers, carbohydrates, and esters. Isolates in Cluster 3 (e.g., Pseudomonas sp. and Acidovorax sp.) mainly utilized esters, carboxylic acids, and amino acids. Isolates in Cluster 4 (e.g., Enterobacter sp. and Rhodococcus sp.) utilized carbohydrates, esters, and amino acids. All isolates grew in reclaimed water treated by sand filtration, whereas some isolates could not grow in reclaimed water treated by coagulation and ozonation. Most bacteria in the same Biolog clusters exhibited similar growth characteristics in water samples. The potential of bacteria to regrow in reclaimed water likely depended on substrate requirement.

Application of indigenous microbial consortia in bioremediation of oil-contaminated soils

Bioremediation of oil spillage in soils using consortia of microbes beckons much exploration. The present study involves bioremediation of oil-contaminated soils from north Chennai, India, using indigenous microbial consortia. Totally, 32 positive oil degrading isolates were obtained from 3 different locations, i.e., petrol filling stations, automobile workshops and oil refineries. Substrate utilization patterns of individual isolates and the consortial sets were observed. Mixture of three common hydrocarbons (petrol, diesel and engine oil) was used for studies. The substrate oil utilized by consortia was taken for thin-layer and column chromatography which perfectly resulted in varied fractions of oil compared to the unused oil as control. The best consortia were used directly for bioremediation experiment. Three different oil-contaminated soils were used and bioremediation patterns were observed. The rate of bioremediation differed within soils, nevertheless all soils were almost 100 % reclaimed within 30 days. Bioremediation kinetics showed that the process corresponds to first-order kinetics and kinetic constants for the different soils ranged from 0.051 to 0.077/day. Assessment of detoxification of acute phytotoxicity owing to the pollutant oil was done, and results observed were significant. An increase of 25, 300 and 212 % in germination index, average growth index and sustenance index, respectively, of Trigonella foenum-graecum Linn. in treated soils was observed, compared to untreated soils. Thus, this study confirmed that microbes in ‘Consortial Union’ serve as better treating agents in bioremediation of oil-contaminated soils than individual microorganisms.

Influence of Metal Oxide Particles on Soil Enzyme Activity and Bioaccumulation of Two Plants

Particle size and metal species are important to both soil microbial toxicity and phytotoxicity in the soil ecosystem. The effects of CuO and ZnO nanoparticles (NPs) and microparticles (MPs) on soil microbial toxicity, phytotoxicity, and bioaccumulation in two crops (Cucumis sativus and Zea mays) were estimated in a soil microcosm. In the microcosm system, soil was artificially contaminated with 1,000 mg/kg CuO and ZnO NPs and MPs. After 15 days, we compared the microbial toxicity and phytotoxicity by particle size. In addition, C. sativus and Z. mays were cultivated in soils treated with CuO NPs and ZnO NPs, after which the treatment effects on bioaccumulation were evaluated. NPs were more toxic than MPs to microbes and plants in the soil ecosystem. We found that the soil enzyme activity and plant biomass were inhibited to the greatest extent by CuO NPs. However, in a Biolog test, substrate utilization patterns were more dependent upon metal type than particle size. Another finding indicated that the metal NP uptake amounts of plants depend on the plant species. In the comparison between C. sativus and Z. mays, the accumulation of Cu and Zn by C. sativus was noticeably higher. These findings show that metal oxide NPs may negatively impact soil bacteria and plants. In addition, the accumulation patterns of NPs depend on the plant species.

Spatiotemporal Variability in Dissolved Organic Matter Composition is More Strongly Related to Bacterioplankton Community Composition than to Metabolic Capability in a Blackwater Estuarine System

The composition and metabolic capability of bacterioplankton communities were examined over seasonal and spatial gradients and related to the source, composition, and quantity of dissolved organic matter (DOM) in the blackwater estuary Winyah Bay, Georgetown County, SC, USA and its tributary rivers. Bacterial community composition (BCC) was measured by terminal restriction fragment length polymorphism, and bacterial metabolic capability (BMC) was measured by defined substrate utilization patterns (Biolog GN2 plates). Spatial patterns were not important, despite the anticipated watershed effects and the well-documented influence of salinity gradients on estuarine bacterioplankton, but DOM, BCC, and BMC all showed varying degrees of temporal patterns; DOM-based groupings differentiated BCC samples better than spatiotemporal categories, but not BMC. BCC was closely related to properties describing DOM composition, particularly those related to DOM source (i.e., cypress swamps vs. in situ phytoplankton production, indicated by chlorophyll a, colored DOM spectral slope, α355/dissolved organic carbon (DOC), and DOC concentration), and to associated physicochemical variables, such as temperature, pH, and salinity. BMC was more strongly related to abiotic factors, such as temperature and dissolved nutrients, as well as to chlorophyll a and percent bioavailable DOC. In contrast with previous studies, BCC and BMC were significantly correlated in this highly heterotrophic estuary, suggesting that DOM source variability may select for specialist phylotypes above a background of generalists. This study, therefore, supports a causative pathway from DOM to BMC to BCC while suggesting that BCC and BMC may be simultaneously influenced by different suites of DOM characteristics and physicochemical parameters.

Rhizosphere bacterial communities associated with healthy and Heterodera glycines-infected soybean roots

Bacterial communities in rhizosphere soil of soybean plants that were healthy, infected with soybean cyst nematode (SCN, Heterodera glycines), and infected with SCN but treated with Purpureocillium lilacinus YES-2 were investigated with community-level physiological profile (Biolog) and 16S rDNA clone library analyses. Biolog data indicated significant differences in substrate utilization patterns of the rhizosphere bacterial communities associated with healthy, SCN-infected, and SCN-infected plus P. lilacinus-treated plants; among the three treatments, substrate richness and catabolic diversity were lowest in the rhizosphere of healthy soybeans. Analysis of 16S rDNA profiles placed the soybean rhizosphere bacteria into seven groups: Proteobacteria, Actinobacteria, Acidobacteria, Firmicutes, Bacteroidetes, Chloroflexi, and an unclassified bacterial clade. The percentages of Rhizobiales and Actinobacteria clones were greater in the rhizosphere of healthy plants than SCN-infected plants, while the opposite was true for the proportions of Bacteroidetes and Firmicutes clones. Addition of P. lilacinus did significantly affect the rhizosphere bacterial community of SCN-infected plants. These results suggest that rhizosphere bacterial community may play an important role in the changes of soybean rhizosphere biological conditions during the infection process. Further studies will identify more specific changes in the rhizosphere bacterial community during the establishment and progression of SCN disease, and relate these changes to potential effects on disease management, soybean health, and soybean productivity.

A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA.

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose-CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3'), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s.

Phenotypic and phylogenetic characterization of an abamectin-degrading bacterial strain isolated from a citrus orchard

Bacterial strain GB-01 was isolated from abamectin-contaminated soils by continuous enrichment culture. The preliminary identification of strain GB-01 as a Burkholderia species was based mainly on simple biochemical and substrate utilization tests; however, these tests alone cannot accurately differentiate all the species within the genus Burkholderia. The strain GB-01 was subjected to taxonomic analysis through a polyphasic approach, in which phenotypic, genotypic, and phylogenetic information was gathered to conclude the classification of this microbe. Phenotypic information comes from basic bacteriological tests and substrate utilization patterns using the Biolog GN2 MicroPlating system and automated miniature biochemical test kits, i.e. API 20 NE, ID 32 GN and API 50 CH, as well as analyzing the whole cell fatty acid profile. Genotypic information was gathered from whole genome DNA base composition (G+C mol%), and DNA-DNA hybridization with its closest species, while phylogenetic information was collected from the comparative analysis of 16S rRNA and recA gene sequences. The results of polyphasic analysis concluded that strain GB-01 is an atypical strain of the Burkholderia diffusa species.

Plant species influence microbial metabolic activity and butachlor biodegradation in a riparian soil from Chongming Island, China

Field sampling and incubation experiment were conducted to investigate differences in microbial metabolic activity and butachlor biodegradation in riparian soils from four different plant communities such as P. australis, A. calamus, and Z. aquatica communities, and a mixed community of P. australis and A. calamus in Chongming Island, China. The results suggested that differences in rhizosphere microbial carbon substrate utilization patterns and enzymatic activities among vegetation types were significant. Catalase activity and fluorescein diacetate (FDA) hydrolysis rate and soil basal respiration (SBR) in the rhizosphere of the mixture of P. australis and A. calamus were 45%, 76%, and 62% higher, respectively, than in the rhizosphere of the pure P. australis community. Community level physiological profiles (CLPPs) via BIOLOG Ecoplates™ indicated that the mixture community of P. australis and A. calamus had the highest sole-carbon-source utilization and functional diversity of microbial community in rhizosphere soil, followed by P. australis, A. calamus, and Z. aquatica. Compared with the rhizosphere soils of the three pure plant communities, the mixture of P. australis and A. calamus displayed a significantly greater butachlor biodegradation percentage in the rhizosphere soil. The half-life for the rhizosphere soil of the mixture community of P. australis and A. calamus were 33, 51 and 57% shorter, as compared to the three pure plant communities, respectively. Our data indicate that vegetation types can exert a great effect on the biodegradation of herbicide in the riparian soil.

The FungiResp method: An application of the MicroResp™ method to assess fungi in microbial communities as soil biological indicators

Soil ecosystem services need to monitor soil quality in terms of soil functions. This need in turn requires functional indicators. Microbial functional diversity offers a way to characterize soil quality and any changes to it. Among soil microbial communities, fungi play a critical role in organic matter decomposition and nutrient cycling in soil by decomposing complex substrates, but only a few studies have focused on the function of soil fungal communities. We have developed a protocol based on substrate-induced respiration using the MicroResp™ technique combined with a selective inhibition (SI) procedure to characterize the fungal biomass and catabolic profiles for soil microbial and fungal communities: the FungiResp method. After comparisons with oxytetracycline, we chose bronopol as a bactericide to extend the FungiResp protocol. An optimal bronopol concentration of 78μgg−1 soil was selected for the four soils tested to minimize the risk of inhibiting non-target communities (fungi). We used this convenient, miniaturized method to compare different soils and different perturbations (drought and heat). The FungiResp method gave further data on the fungal part of the microbial substrate-induced respiration in these different contexts. Also, the catabolic structure of microbial and fungal communities measured as pattern of substrate utilization (CLPPs) enabled us to contrast the functional contributions of the decomposer groups in the different soils studied and highlight the functional impacts of the different perturbations applied to them.

Metagenomic and Metabolic Profiling of Nonlithifying and Lithifying Stromatolitic Mats of Highborne Cay, The Bahamas

BackgroundStromatolites are laminated carbonate build-ups formed by the metabolic activity of microbial mats and represent one of the oldest known ecosystems on Earth. In this study, we examined a living stromatolite located within the Exuma Sound, The Bahamas and profiled the metagenome and metabolic potential underlying these complex microbial communities.Methodology/Principal FindingsThe metagenomes of the two dominant stromatolitic mat types, a nonlithifying (Type 1) and lithifying (Type 3) microbial mat, were partially sequenced and compared. This deep-sequencing approach was complemented by profiling the substrate utilization patterns of the mats using metabolic microarrays. Taxonomic assessment of the protein-encoding genes confirmed previous SSU rRNA analyses that bacteria dominate the metagenome of both mat types. Eukaryotes comprised less than 13% of the metagenomes and were rich in sequences associated with nematodes and heterotrophic protists. Comparative genomic analyses of the functional genes revealed extensive similarities in most of the subsystems between the nonlithifying and lithifying mat types. The one exception was an increase in the relative abundance of certain genes associated with carbohydrate metabolism in the lithifying Type 3 mats. Specifically, genes associated with the degradation of carbohydrates commonly found in exopolymeric substances, such as hexoses, deoxy- and acidic sugars were found. The genetic differences in carbohydrate metabolisms between the two mat types were confirmed using metabolic microarrays. Lithifying mats had a significant increase in diversity and utilization of carbon, nitrogen, phosphorus and sulfur substrates.Conclusion/SignificanceThe two stromatolitic mat types retained similar microbial communities, functional diversity and many genetic components within their metagenomes. However, there were major differences detected in the activity and genetic pathways of organic carbon utilization. These differences provide a strong link between the metagenome and the physiology of the mats, as well as new insights into the biological processes associated with carbonate precipitation in modern marine stromatolites.

Isolation and Molecular Detection of Polycyclic Aromatic Hydrocarbon-Degrading <i>Mycobacterium</i> spp. from the Shenfu Wastewater Irrigation Area in China

Mycobacterium spp. with the ability to degrade polycyclic aromatic hydrocarbons (PAHs) have attracted great attention. This study aims to isolate pyrene-degrading Mycobacterium spp. through direct plating and selective enrichment from sediment and paddy soil from several sites in Shenfu Wastewater Irrigation Area, and the diversity, catabolic genes and substrate utilization patterns of these pyrene-degrading Mycobacterium isolates was investigated. The Mycobacterium community dynamics was monitored during enrichment cultures by Denaturing Gradient Gel Electrophoresis (DGGE) to determine whether the Mycobacterium sp. detected in DGGE gels was successfully recovered. The results showed that a total of 20 unique Mycobacterium isolates were collected including 3 strains from direct plating and 17 from enrichment cultures. In addition to pyrene, most of the isolates could also degrade phenanthrene and fluoranthene and contained nidA and nidA3 genes, and only half of isolated strains were found to possess the pdoA2 gene. DGGE results showed that the Mycobacterium community had a shift in diversity during enrichment process. phylogenetic analysis based on 16SrDNA sequences from bands excised from DGGE gels and from these isolates revealed that isolated Mycobacterium spp. were represented of bands excised from DGGE gels in a small proportion. This collection of isolates will be valuable in bioremediation of PAH-contaminated sites.

Influence of the plant development on microbial diversity of vertical-flow constructed wetlands

Abstract Seasonal shifts in microbial diversity of the rhizosphere in constructed wetlands were investigated to test the influence of the developmental stages of Lythrum salicaria. A 240-day study of microbial rhizosphere communities was undertaken under different total organic carbon levels in the influent water, while the influences of plant growth on microbial diversity were monitored in planted and unplanted wetlands. The community-level physiological profile (CLPP) was assessed using substrate utilization patterns that were gathered using Biolog Eco Plates™. The microorganism community structure and diversity at different season under different influent conditions demonstrated that the developmental stages of plant and water quality determined their own functional rhizosphere communities. Marked seasonal shifts in three diversity indices and relative activity were observed in microbial communities in the unplanted wetlands. While in the planted wetlands, the CLPP at different developmental stages were significantly different between the young plant and maturing plant at low or high TOC level. This detailed study suggested that wetland plant determined specialized microbial communities that change in response to plant growth.

Contrasting trends in distribution of four major planktonic betaproteobacterial groups along a pH gradient of epilimnia of 72 freshwater habitats

The distribution and abundance of Betaproteobacteria and three of its genera - Limnohabitans (R-BT065 lineage), Polynucleobacter (including subclusters Polynucleobacter necessarius and Polynucleobacter acidiphobus/Polynucleobacter difficilis), and Methylophilus - across the epilimnia of 72 limnologically diverse freshwater habitats were investigated using fluorescence in situ hybridization. Moreover, seasonal development of Betaproteobacteria subgroups along the longitudinal axis of a reservoir was followed. Betaproteobacteria comprised on average 29.1%, Polynucleobacter 11.6%, P.necessarius 10.1%, P.acidiphobus/difficilis 0.5%, Limnohabitans 8.9%, and Methylophilus 0.9% of total bacterioplankton cells in the investigated habitats. Polynucleobacter necessarius and Limnohabitans coexisted in the majority of habitats but showed contrasting abundance patterns along the pH gradient of habitats (pH, 3.8-8.5). The observed distribution patterns could theoretically be explained by different preferences for substrate sources, that is, substances of humic origin in acidic waters and algal-derived substances in alkaline waters. However, substrate utilization patterns observed in laboratory experiments indicate no coherent group-specific differences in substrate preferences. Interestingly, similar distribution patterns were revealed for Limnohabitans and P.acidiphobus/difficilis, suggesting similar ecological adaptations of these distantly related taxa. Our findings further emphasize that at least two taxa of freshwater Betaproteobacteria represent ecologically diversified groups. Investigations at higher phylogenetic resolution are required for obtaining further insights into their ecology.

Resistance and resilience of microbial communities – temporal and spatial insurance against perturbations

Bacteria play fundamental roles for many ecosystem processes; however, little empirical evidence is available on how environmental perturbations affect their composition and function. We investigated how spatial and temporal refuges affect the resistance and resilience of a freshwater bacterioplankton community upon a salinity pulse perturbation in continuous cultures. Attachment to a surface avoided the flushing out of cells and enabled re-colonization of the liquid phase after the perturbation, hence serving as a temporal refuge. A spatial refuge was established by introduction of bacteria from an undisturbed reservoir upstream of the continuous culture vessel, acting analogous to a regional species pool in a metacommunity. The salinity pulse affected bacterial community composition and the rates of respiration and the pattern of potential substrate utilization as well as the correlation between composition and function. Compared with the no-refuge treatment, the temporal refuge shortened return to pre-perturbation conditions, indicating enhanced community resilience. Composition and function were less disturbed in the treatment providing a spatial refuge, suggesting higher resistance. Our results highlight that spatial and temporal dynamics in general and refuges in particular need to be considered for conceptual progress in how microbial metacommunities are shaped by perturbations.

Short-Term Responses of Nitrogen Mineralization and Microbial Community to Moisture Regimes in Greenhouse Vegetable Soils

Soil drying and wetting impose significant influences on soil nitrogen (N) dynamics and microbial communities. However, effects of drying-wetting cycles, while common in vegetable soils, especially under greenhouse conditions, have not been well studied. In this study, two greenhouse vegetable soils, which were collected from Xinji (XJ) and Hangzhou (HZ), China, were maintained at 30% and 75% water-holding capacity (WHC), or five cycles of 75% WHC followed by a 7-day dry-down to 30% WHC (DW). Soil inorganic N content increased during incubation. Net N mineralization (Nmin), microbial activity, and microbial biomass were significantly higher in the DW treatment than in the 30% and 75% WHC treatments. The higher water content (75% WHC) treatment had higher Nmin, microbial activity, and microbial biomass than the lower water content treatment (30% WHC). Multivariate analyses of community-level physiological profile (CLPP) and phospholipid fatty acid (PLFA) data indicated that soil moisture regime had a significant effect on soil microbial community substrate utilization pattern and microbial community composition. The significant positive correlation between Nmin and microbial substrate utilization or PLFAs suggested that soil N mineralization had a close relationship with microbial community.

Heat stress and N fertilization affect soil microbial and enzyme activities in the creeping bentgrass (Agrostis Stolonifera L.) rhizosphere

High summer temperatures often cause damage to bentgrass on putting greens in transition zone regions. One of the most damaging effects is a depression of rooting. Although heat stress effects on plant functions are considered as a main reason for the damage, heat stress also may be related to organic matter (OM) accumulation and poor gas exchange into the rhizosphere. The OM accumulation and the often-observed root dieback suggest that soil microbial processes play a role in summer bentgrass decline. In this study, the impact of high temperature on soil microbial properties and enzyme activities was examined using creeping bentgrass (Agrostis stolonifera) growing in a phytotron controlled environment chamber. The high temperature exposures (34/30°C versus 22/18°C for controls) lasted for four weeks and the bentgrass cultures received mineral N at two rates. Our working hypothesis was that not only did high temperatures stimulate overall soil microbial and enzyme activity but also selectively modified microbial catabolic functions. To test this hypothesis, we compared temperature sensitivities and Q10 values of microbial substrate utilization patterns using a Biolog plate approach and soil enzyme activities. The results indicated that soil enzyme activities had similar responses to assay temperatures and their Q10 values averaged ∼2 with changes of laboratory assay temperatures from 12 to 22°C and from 22 to 34°C. Such positive responses of microbial activity to high temperatures were supported by parallel increases in rates of microbial substrate utilization. Total substrate availability in Biolog plates also increased with laboratory assay temperatures. This enhancement could not be explained by the overall stimulation of high temperature on microbial activity, but instead by selective modification of microbial community functions. Nitrogen fertilization significantly changed soil biological activities. Phenol oxidase activity was reduced by the high rate of N fertilization, whereas β-glucosidase and β-glucosaminidase activities were increased. Interactions on soil enzyme activities between growth chamber temperatures and N fertilization rates also occurred. Soil peroxidase activity was ∼three-fold greater for bentgrass subjected to heat stress and the low rate of N fertilization. Our results indicated that summer heat stress and the associated increases in root and OM degradation in bentgrass systems are related with overall temperature stimulations on soil microbial and enzyme activities as well as with modifications in functional components of the microbial community.

Hedgehog-mediated regulation of PPARγ controls metabolic patterns in neural precursors and shh-driven medulloblastoma.

Sonic hedgehog (Shh) signaling is critical during development and its aberration is common across the spectrum of human malignancies. In the cerebellum, excessive activity of the Shh signaling pathway is associated with the devastating pediatric brain tumor medulloblastoma. We previously demonstrated that exaggerated de novo lipid synthesis is a hallmark of Shh-driven medulloblastoma and that hedgehog signaling inactivates the Rb/E2F tumor suppressor complex to promote lipogenesis. Indeed, such Shh-mediated metabolic reprogramming fuels tumor progression, in an E2F1- and FASN-dependent manner. Here, we show that the nutrient sensor PPARγ is a key component of the Shh metabolic network, particularly its regulation of glycolysis. Our data show that in primary cerebellar granule neural precursors (CGNPs), proposed medulloblastoma cells-of-origin, Shh stimulation elicits a marked induction of PPARγ alongside major glycolytic markers. This is also documented in the actively proliferating Shh-responsive CGNPs in the developing cerebellum, and PPARγ expression is strikingly elevated in Shh-driven medulloblastoma in vivo. Importantly, pharmacological blockade of PPARγ and/or Rb inactivation inhibits CGNP proliferation, drives medulloblastoma cell death and extends survival of medulloblastoma-bearing animals in vivo. This coupling of mitogenic Shh signaling to a major nutrient sensor and metabolic transcriptional regulator define a novel mechanism through which Shh signaling engages the nutrient sensing machinery in brain cancer, controls the cell cycle, and regulates the glycolytic index. This also reveals a dominant role of Shh in the etiology of glucose metabolism in medulloblastoma and underscores the function of the Shh → E2F1 → PPARγ axis in altering substrate utilization patterns in brain cancers in favor of tumor growth. These findings emphasize the value of PPARγ downstream of Shh as a global therapeutic target in hedgehog-dependent and/or Rb-inactivated tumors.Electronic supplementary materialThe online version of this article (doi:10.1007/s00401-012-0968-6) contains supplementary material, which is available to authorized users.