Strong Phylogenetic Relationship Research Articles

Elucidating the physiological and molecular characteristics of bacterial blight incitant Xanthomonas auxonopodis pv. punicae; a life threatening phytopathogen of pomegranate (Punica granatum. L) and assessment of H2O2 accumulation during host-pathogen interaction

Bacterial blight of pomegranate caused by Xanthomonas auxonopodis pv.punicae (Xap) threaten the existence of a group of farmers for the past few decades who rely on pomegranate cultivation for their livelihood since it will cause huge yield loss. The primary focus of this study was to conduct a thorough analysis of the characterization of this blight incitant Xap. Physiological, biochemical, and molecular characteristics of six phytopathogenic strains of Xap, designated as PBF1 (PBF: Pomegranate Blight Fruit), PBF2, PBF3, PBF4, PBF5, and PBF6, isolated from the infected fruits were examined. Bacterial colonies were featured as gram-negative, yellow-pigmented circular with a glistening appearance. An attempt to determine the best culture medium, favouring bacterial proliferation was successfully done with four distinct medium, Nutrient Glucose Agar (NGA), Nutrient sucrose Agar (NSA), Yeast Dextrose Calcium Carbonate Agar (YDCA) and Yeast Glucose Calcium Carbonate Agar (YGCA) and comparatively, significant growth was found in NGA (66.66%) followed by YDCA (33%). According to the antibiotic susceptibility results, both ampicillin and streptomycin were determined as potentially effective drugs in preventing the proliferation of Xap (P 0.05). The reactive oxygen species-mediated plant immune response during host-pathogen interaction was confirmed by accessing the presence of H2O2 accumulation in infected leaves via 3,3 - diaminobenzidine (DAB) -staining technique. Bacterial isolates from this study were confirmed by two universal constitutive genes such as gyrB and 16S rRNA. From the BLAST analysis, the isolates were identified as Xap with base pair lengths of 1408bp, 1180bp, and 1159bp, which correspond to PBF1, PBF2, and PBF3, respectively. A neighbor-joining phylogenetic tree study explaining a strong phylogenetic relationship between the query sequence and closely related bacterial species.

Limited cross-species virus transmission in a spatially restricted coral reef fish community.

The Great Barrier Reef (GBR)-the largest coral reef ecosystem in the world-supports over 1,200 fish species with some of the highest population densities and diversities observed in vertebrates, offering a high potential for virus transmission among species. As such, the GBR represents an exceptional natural ecosystem to determine the impact of host community diversity on virus evolution and emergence. In recent decades, the GBR has also experienced significant threats of extinction, making it one of the most vulnerable ecosystems on the planet. Despite the global importance of the GBR, our understanding of virus diversity and connectivity in tropical reef fishes remains poor. Here, we employed metatranscriptomic sequencing to reveal the viromes of sixty-one reef fish species. This identified transcripts representing 132 putative viral sequences, 38 of which exhibited strong phylogenetic relationships with known vertebrate-associated viral genera, including a novel Santee-Cooper ranavirus (Iridoviridae). We found little evidence for virus transmission between fish species living within a very restricted geographical space-a 100-m2 coral reef ecosystem-suggesting that there might be important host barriers to successful cross-species transmission despite regular exposure. We also identified differences in virome composition among reef fish families, such that cryptobenthic reef fishes-characterized by small body sizes and short life spans-exhibited greater virome richness compared to large reef fishes. This study suggests that there are important barriers to cross-species virus transmission and that successful emergence in a reef fish community likely requires active host adaptation, even among closely related host species.

Unveiling Mycoviromes Using Fungal Transcriptomes.

Viruses infecting fungi are referred to as mycoviruses. Here, we carried out in silico mycovirome studies using public fungal transcriptomes mostly derived from mRNA libraries. We identified 468 virus-associated contigs assigned to 5 orders, 21 families, 26 genera, and 88 species. We assembled 120 viral genomes with diverse RNA and DNA genomes. The phylogenetic tree and genome organization unveiled the possible host origin of mycovirus species and diversity of their genome structures. Most identified mycoviruses originated from fungi; however, some mycoviruses had strong phylogenetic relationships with those from insects and plants. The viral abundance and mutation frequency of mycoviruses were very low; however, the compositions and populations of mycoviruses were very complex. Although coinfection of diverse mycoviruses in the fungi was common in our study, most mycoviromes had a dominant virus species. The compositions and populations of mycoviruses were more complex than we expected. Viromes of Monilinia species revealed that there were strong deviations in the composition of viruses and viral abundance among samples. Viromes of Gigaspora species showed that the chemical strigolactone might promote virus replication and mutations, while symbiosis with endobacteria might suppress virus replication and mutations. This study revealed the diversity and host distribution of mycoviruses.

Rickettsia spp. in ticks (Acari: Ixodidae) from wild birds: First detection of Candidatus Rickettsia vini in Hesse, Germany

Tick-borne diseases are recognized as a growing public health concern and cause significant issues in humans and animals by serving as dispersal agents of ticks and their associated pathogens. Birds contribute to the spread of ticks and tick-borne diseases, with migratory birds playing a role in regional dispersal. Only a few studies have been carried out in Germany so far to investigate tick fauna on birds and the pathogens they harbour. In 2017 and 2018, we collected ticks from a total of 358 birds in the northern region of the Federal State of Hesse, Germany. Most ticks were Ixodes ricinus larvae and nymphs (95.4%). However, two ornithophilic species were also collected: Ixodes frontalis (larvae, nymphs and females) and Ixodes arboricola (larvae and nymphs). Ticks were tested individually or in pools, depending on the tick life stage and species for each bird host, in order to detect tick-borne encephalitis (TBE) virus and Rickettsia spp. All samples tested negative for TBE virus. Of 684 investigated tick pools, 162 tested positive for Rickettsia spp. by screening PCR. Of these, 117 carried Rickettsia helvetica detected by specific real-time PCR. The samples which were negative in the R. helvetica PCR were further investigated using five targets (gltA, 16S, ompA IV, ompB, 23S-5S intergenic spacer region) using multi locus sequence typing and phylogenetic analysis. The obtained sequences showed strong phylogenetic relationship to Candidatus Rickettsia vini, which is most closely related to R. japonica and R. heilongjiangensis, and occur in I. arboricola. Three more sequences were determined as R. helvetica in I. ricinus and I. frontalis. This is the first detection of Ca. R. vini in Germany and the first 23S-5S data published for Ca. R. vini, a useful target for Rickettsia species identification.

Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

Integrative omics analysis of the termite gut system adaptation to Miscanthus diet identifies lignocellulose degradation enzymes

Miscanthus sp. biomass could satisfy future biorefinery value chains. However, its use is largely untapped due to high recalcitrance. The termite and its gut microbiome are considered the most efficient lignocellulose degrading system in nature. Here, we investigate at holobiont level the dynamic adaptation of Cortaritermes sp. to imposed Miscanthus diet, with a long-term objective of overcoming lignocellulose recalcitrance. We use an integrative omics approach combined with enzymatic characterisation of carbohydrate active enzymes from termite gut Fibrobacteres and Spirochaetae. Modified gene expression profiles of gut bacteria suggest a shift towards utilisation of cellulose and arabinoxylan, two main components of Miscanthus lignocellulose. Low identity of reconstructed microbial genomes to closely related species supports the hypothesis of a strong phylogenetic relationship between host and its gut microbiome. This study provides a framework for better understanding the complex lignocellulose degradation by the higher termite gut system and paves a road towards its future bioprospecting.

Characterization of Albanian water frog, Pelophylax shqipericus, sperm traits and morphology, by using phase contrast microscopy

Mature spermatozoa traits and morphology of endangered Albanian water frog, Pelophylax shqipericus, have been characterized for the first time through phase contrast microscopy, as part of successful implementation of in vitro fertilization technique for this species. The basic morphology of P. shqipericus spermatozoa consists of an elongated, thick, smooth-edged, and solid-staining head, continuing with a thin and long tail which usually extends 2.48 times the head length. The acrosome was not clearly discernible so the measurements were done on the head as a whole, while the middle section was better visible. Average length of head, including the acrosome and midsection was estimated to be 11.78 μm ± 0.32, while the tail length resulted 29.24 ± 1.75 μm. The average thickness of the head was shown to be 3.45 μm. The total sperm length resulted to be 41.02 ± 1.83 μm. The average sperm concentration was estimated of 25.5 × 106 /ml. Sperm amount, survival rate and motility were also measured. The sperm survival rate was maximal immediately after preparation of the suspension and tended to decrease over time of storage, reaching 50% after 72 hr. Decreased sperm motility seemed to follow the same trend as sperm viability. Sperm traits resulted to be very similar both in size and in shape with those of "Lessonae" frog group, one of the lineages of Western Palearctic species complex, suggesting a strong phylogenetic relationship among these species.

COMPARATION OF DENDROGRAM AND CLADOGRAM TOPOLOGY OF Gyrinops versteegii AND OTHERS GYRINOPS MEMBER FOR POLYPHASIC TAXONOMY

The purpose of this research is to compare topology of dendrogram and cladogram of G. versteegii and others Gyrinops members for polyphasic taxonomy approach. Character of leaf, stem, flower and fruit of Gyrinops member were used for numeric phenetic analysis. On the other hands, trnL-trnF interspacer of chloroplast gene sequence were used for phylogenetic analysis. MVSP 3.1A were used for dendrogram construction using Simple Matching Coefficient and Jaccard’s Coefficient as clustering method. Co-stat cohor 6 were used for cophenetic correlation analysis. Multiple sequence alignment of trnL – trnF was carried by ClustalX 2.1 program. MEGA program was used for reconstruction of cladogram. This cladogram uses two different approach algorithms including: Neighbor Joining and Maximum Likelihood with 1000 bootstrap replication. Sequences similarity matrix analysis were carried by Phydit program with cut off value 99% for each Gyrinops members. Based on result, simple matching dendrogram has the same topology as Jaccard’s dendrogram. Cophenetic correlation analysis also confirm that there is no distortion on clustering analysis of these two dendrograms. On the other hand, Neighbor Joining cladogram has different topology from Maximum Likelihood cladogram. Similarity analysis of trnL-trnF sequence shows that each member of Gyrinops has strong phylogenetic relationship. Comparation of dendrogram and cladogram of G. versteegii with other Gyrinops members confirm that this species has different clustering group on dendrogram and cladogram. It could be concluded that G. versteegii has unique phylogenetic relationship and similarity relationship with others Gyrinops members.

Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

Withania somnifera (family Solanaceae), known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS) region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

Molecular and biochemical characterization of Paragonimus westermani tyrosinase.

Trematode tyrosinases (TYRs) play a major role in the tanning process during eggshell formation. We investigated the molecular and biochemical features of Paragonimus westermani TYR (PwTYR). The PwTYR cDNA was composed of 1568-bp encompassing a 1422-bp-long open reading frame (474-amino acid polypeptide). A strong phylogenetic relationship with Platyhelminthes and Deuterostomian orthologues was evident. The recombinant PwTYR expressed in prokaryotic cells promptly oxidized diphenol substrates, with a preferential affinity toward ortho-positioned hydroxyl groups. It demonstrated fairly weak activity for monophenol compounds. Diphenol oxidase activity was augmented with an increase of pH from 5.0 to 8.0, while monophenol oxidase activity was highest at an acidic pH and gradually decreased as pH increased. Transcription profile of PwTYR was temporally upregulated along with worm development. PwTYR was specifically localized in vitellocytes and eggs. The results suggested that conversion of tyrosine to L-dihydroxyphenylalanine by PwTYR monophenol oxidase activity might be rate-limiting step during the sclerotization process of P. westermani eggs. The pH-dependent pattern of monophenol and diphenol oxidase activity further proposes that the initial hydroxylation might slowly but steadily progress in acidic secreted vesicles of vitellocytes and the second oxidation process might be rapidly accelerated by neural or weak alkaline pH environments within the ootype.

Genomic characterisation of an endometrial pathogenic Escherichia coli strain reveals the acquisition of genetic elements associated with extra-intestinal pathogenicity.

BackgroundStrains of Escherichia coli cause a wide variety of intestinal and extra-intestinal diseases in both humans and animals, and are also often found in healthy individuals or the environment. Broadly, a strong phylogenetic relationship exists that distinguishes most E. coli causing intestinal disease from those that cause extra-intestinal disease, however, isolates within a recently described subclass of Extra-Intestinal Pathogenic E. coli (ExPEC), termed endometrial pathogenic E. coli, tend to be phylogenetically distant from the vast majority of characterised ExPECs, and more closely related to human intestinal pathogens. In this work, we investigate the genetic basis for ExPEC infection in the prototypic endometrial pathogenic E. coli strain MS499.ResultsBy investigating the genome of MS499 in comparison with a range of other E. coli sequences, we have discovered that this bacterium has acquired substantial lengths of DNA which encode factors more usually associated with ExPECs and less frequently found in the phylogroup relatives of MS499. Many of these acquired factors, including several iron acquisition systems and a virulence plasmid similar to that found in several ExPECs such as APEC O1 and the neonatal meningitis E. coli S88, play characterised roles in a variety of typical ExPEC infections and appear to have been acquired recently by the evolutionary lineage leading to MS499.ConclusionsTaking advantage of the phylogenetic relationship we describe between MS499 and several other closely related E. coli isolates from across the globe, we propose a step-wise evolution of a novel clade of sequence type 453 ExPECs within phylogroup B1, involving the recruitment of ExPEC virulence factors into the genome of an ancestrally non-extraintestinal E. coli, which has repurposed this lineage with the capacity to cause extraintestinal disease. These data reveal the genetic components which may be involved in this phenotype switching, and argue that horizontal gene exchange may be a key factor in the emergence of novel lineages of ExPECs.Electronic supplementary materialThe online version of this article (doi:10.1186/1471-2164-15-1075) contains supplementary material, which is available to authorized users.

Characterization of a novel orthoreovirus isolated from fruit bat, China.

BackgroundIn recent years novel human respiratory disease agents have been described for Southeast Asia and Australia. The causative pathogens were classified as pteropine orthoreoviruses with a strong phylogenetic relationship to orthoreoviruses of bat origin.ResultsIn this report, we isolated a novel Melaka-like reovirus (named “Cangyuan virus”) from intestinal content samples of one fruit bat residing in China’s Yunnan province. Phylogenetic analysis of the whole Cangyuan virus genome sequences of segments L, M and S demonstrated the genetic diversity of the Cangyuan virus. In contrast to the L and M segments, the phylogenetic trees for the S segments of Cangyuan virus demonstrated a greater degree of heterogeneity.ConclusionsPhylogenetic analysis indicated that the Cangyuan virus was a novel orthoreovirus and substantially different from currently known members of Pteropine orthoreovirus (PRV) species group.Electronic supplementary materialThe online version of this article (doi:10.1186/s12866-014-0293-4) contains supplementary material, which is available to authorized users.

Leaf out times of temperate woody plants are related to phylogeny, deciduousness, growth habit and wood anatomy.

Leaf out phenology affects a wide variety of ecosystem processes and ecological interactions and will take on added significance as leaf out times increasingly shift in response to warming temperatures associated with climate change. There is, however, relatively little information available on the factors affecting species differences in leaf out phenology. An international team of researchers from eight Northern Hemisphere temperate botanical gardens recorded leaf out dates of c. 1600 woody species in 2011 and 2012. Leaf out dates in woody species differed by as much as 3months at a single site and exhibited strong phylogenetic and anatomical relationships. On average, angiosperms leafed out earlier than gymnosperms, deciduous species earlier than evergreen species, shrubs earlier than trees, diffuse and semi-ring porous species earlier than ring porous species, and species with smaller diameter xylem vessels earlier than species with larger diameter vessels. The order of species leaf out was generally consistent between years and among sites. As species distribution and abundance shift due to climate change, interspecific differences in leaf out phenology may affect ecosystem processes such as carbon, water, and nutrient cycling. Our open access leaf out data provide a critical framework for monitoring and modelling such changes going forward.

Microbial control of the cotton leafworm Spodoptera littoralis (Boisd.) by Egyptian Bacillus thuringiensis isolates

Four local Bacillus thuringiensis (Bt) isolates that had been serologically identified as Bt var. kurstaki (Btk2, Btk3, and Btk66) and Bt var. mexicanensis (Btm27), in addition to two reference strains (4D20 and 4AC1), were laboratory assayed as microbial control agents against the Egyptian cotton leafworm Spodoptera littoralis (Boisd.). Polymerase chain reaction (PCR) amplification analysis revealed that each of the six experimental strains carries, at least, a cry1 type gene which expresses a protein toxin active against lepidopterous insects. Additionally, PCR amplification results demonstrated that 4D20 and Btk66 contain the Lepidoptera- and Diptera-active cry2 type gene and that Btk66 contains Coleoptera-active cry7 and cry8 genes. Among the six strains, Btk66 and Btm27 were the most promising microbial control agents against S. littoralis. The present findings were the first to report that Btm27 (classified as B. thuringiensis var. mexicanensis) is a very potent microbial control agent against S. littoralis-tested larvae. For more characterization of these two isolates, the sspO gene was investigated as a molecular chronometer. The DNA sequencing results proved that Btk66 and Btm27 carry sspO open reading frames with identical nucleotide sequences, suggesting a strong phylogenetic relationship between the two strains.

Isolation and Characterization of Three Mammalian Orthoreoviruses from European Bats

In recent years novel human respiratory disease agents have been described in South East Asia and Australia. The causative pathogens were classified as pteropine orthoreoviruses with strong phylogenetic relationship to orthoreoviruses of flying foxes inhabiting these regions. Subsequently, a zoonotic bat-to-human transmission has been assumed. We report the isolation of three novel mammalian orthoreoviruses (MRVs) from European bats, comprising bat-borne orthoreovirus outside of South East Asia and Australia and moreover detected in insectivorous bats (Microchiroptera). MRVs are well known to infect a broad range of mammals including man. Although they are associated with rather mild and clinically unapparent infections in their hosts, there is growing evidence of their ability to also induce more severe illness in dogs and man. In this study, eight out of 120 vespertilionid bats proved to be infected with one out of three novel MRV isolates, with a distinct organ tropism for the intestine. One isolate was analyzed by 454 genome sequencing. The obtained strain T3/Bat/Germany/342/08 had closest phylogenetic relationship to MRV strain T3D/04, isolated from a dog. These novel reoviruses provide a rare chance of gaining insight into possible transmission events and of tracing the evolution of bat viruses.

Unusual combinatorial involvement of poly-A/T tracts in organizing genes and chromatin in Dictyostelium

Dictyostelium discoideum is an amoebozoa that exists in both a free-living unicellular and a multicellular form. It is situated in a deep branch in the evolutionary tree and is particularly noteworthy in having a very A/T-rich genome. Dictyostelium provides an ideal system to examine the extreme to which nucleotide bias may be employed in organizing promoters, genes, and nucleosomes across a genome. We find that Dictyostelium genes are demarcated precisely at their 5′ ends by poly-T tracts and precisely at their 3′ ends by poly-A tracts. These tracts are also associated with nucleosome-free regions and are embedded with precisely positioned TATA boxes. Homo- and heteropolymeric tracts of A and T demarcate nucleosome border regions. Together, these findings reveal the presence of a variety of functionally distinct polymeric A/T elements. Strikingly, Dictyostelium chromatin may be organized in di-nucleosome units but is otherwise organized as in animals. This includes a +1 nucleosome in a position that predicts the presence of a paused RNA polymerase II. Indeed, we find a strong phylogenetic relationship between the presence of the NELF pausing factor and positioning of the +1 nucleosome. Pausing and +1 nucleosome positioning may have coevolved in animals.

Eukaryotic genomes may exhibit up to 10 generic classes of gene promoters

BackgroundThe main function of gene promoters appears to be the integration of different gene products in their biological pathways in order to maintain homeostasis. Generally, promoters have been classified in two major classes, namely TATA and CpG. Nevertheless, many genes using the same combinatorial formation of transcription factors have different gene expression patterns. Accordingly, we tried to ask ourselves some fundamental questions: Why certain genes have an overall predisposition for higher gene expression levels than others? What causes such a predisposition? Is there a structural relationship of these sequences in different tissues? Is there a strong phylogenetic relationship between promoters of closely related species?ResultsIn order to gain valuable insights into different promoter regions, we obtained a series of image-based patterns which allowed us to identify 10 generic classes of promoters. A comprehensive analysis was undertaken for promoter sequences from Arabidopsis thaliana, Drosophila melanogaster, Homo sapiens and Oryza sativa, and a more extensive analysis of tissue-specific promoters in humans. We observed a clear preference for these species to use certain classes of promoters for specific biological processes. Moreover, in humans, we found that different tissues use distinct classes of promoters, reflecting an emerging promoter network. Depending on the tissue type, comparisons made between these classes of promoters reveal a complementarity between their patterns whereas some other classes of promoters have been observed to occur in competition. Furthermore, we also noticed the existence of some transitional states between these classes of promoters that may explain certain evolutionary mechanisms, which suggest a possible predisposition for specific levels of gene expression and perhaps for a different number of factors responsible for triggering gene expression. Our conclusions are based on comprehensive data from three different databases and a new computer model whose core is using Kappa index of coincidence.ConclusionsTo fully understand the connections between gene promoters and gene expression, we analyzed thousands of promoter sequences using our Kappa Index of Coincidence method and a specialized Optical Character Recognition (OCR) neural network. Under our criteria, 10 classes of promoters were detected. In addition, the existence of “transitional” promoters suggests that there is an evolutionary weighted continuum between classes, depending perhaps upon changes in their gene products.

Genetic diversity of perch rhabdoviruses isolates based on the nucleoprotein and glycoprotein genes

Despite the increasing impact of rhabdoviruses in European percid farming, the diversity of the viral populations is still poorly investigated. To address this issue, we sequenced the partial nucleoprotein (N) and complete glycoprotein (G) genes of nine rhabdoviruses isolated from perch (Perca fluviatilis) between 1999 and 2010, mostly from France, and analyzed six of them by immunofluorescence antibody test (IFAT). Using two rabbit antisera raised against either the reference perch rhabdovirus (PRhV) isolated in 1980 or the perch isolate R6146, two serogroups were distinguished. Meanwhile, based on partial N and complete G gene analysis, perch rhabdoviruses were divided into four genogroups, A-B-D and E, with a maximum of 32.9% divergence (G gene) between isolates. A comparison of the G amino acid sequences of isolates from the two identified serogroups revealed several variable regions that might account for antigenic differences. Comparative analysis of perch isolates with other rhabdoviruses isolated from black bass, pike-perch and pike showed some strong phylogenetic relationships, suggesting cross-host transmission. Similarly, striking genetic similarities were shown between perch rhabdoviruses and isolates from other European countries and various ecological niches, most likely reflecting the circulation of viruses through fish trade as well as putative transfers from marine to freshwater fish. Phylogenetic relationships of the newly characterized viruses were also determined within the family Rhabdoviridae. The analysis revealed a genetic cluster containing only fish viruses, including all rhabdoviruses from perch, as well as siniperca chuatsi rhabdovirus (SCRV) and eel virus X (EVEX). This cluster was distinct from the one represented by spring viraemia of carp vesiculovirus (SVCV), pike fry rhabdovirus (PFRV) and mammalian vesiculoviruses. The new genetic data provided in the present study shed light on the diversity of rhabdoviruses infecting perch in France and support the hypothesis of circulation of these viruses between other hosts and regions within Europe.

Resequencing, Haplotype Construction and Identification of Novel variants of CYP2D6 in Mexican Mestizos

The CYP2D6 enzyme participates in the metabolism of commonly prescribed drugs: antidepressants, antipsychotics and antihypertensives. The CYP2D6 gene shows a high degree of interindividual and interethnic variability that influences its expression and function. Mexican Mestizos are a recently admixed population resulting from the combination of Amerindian, European and, to a lesser extent, African populations. This study aimed to comprehensively characterize the CYP2D6 gene in Mexican Mestizos. We performed linkage disequilibrium and network analyses in resequencing data of 96 individuals from two regions within Mexico with a different history of admixture and particular population dynamics, the Northwestern state of Sonora and the Central-Pacific state of Guerrero. We identified 64 polymorphisms, including 14 novel variants: 13 SNPs and a CYP2D7 exon 2 conversion, that was assigned CYP2D6*82 by the Human Cytochrome P450 (CYP) Allele Nomenclature Committee. Three novel SNPs were predicted to have functional effects. For CYP2D6*82 we hypothesize an Amerindian origin that is supported by its identification in three Mexican Amerindian groups (Mayas, Tepehuanos and Mixtecos). Frequencies of CYP2D6*1, *2, *4, *5, *10, *29, *53, *82 and its duplications were 50.0, 25.5, 14.1, 2.0, 2.6, 1.0, 0.5, 2.1 and 3.6%, respectively. We found significant frequency differences in CYP2D6*1 and *2 between Mexican Mestizos and in CYP2D6*1, *2, *4, *5, *10 and *29 between Mexicans and at least one other population. We observed strong linkage disequilibrium and phylogenetic relationships between haplotypes. To our knowledge, this study is the first comprehensive resequencing analysis of CYP2D6 in Mexicans or any other Latin American population, providing information about genetic diversity relevant in the development of pharmacogenomics in this region.

Ecology and conservation needs of nymphalid butterflies in disturbed tropical forest of eastern Himalayan biodiversity hotspot, Assam, India

We examine the hypothesis, whether the diversity of Nymphalid butterflies in primary forest is related to vegetation structure and canopy openness and that this relationship differs between butterfly taxa in relation to phylogenetic differences in light and shade preferences. The study also examines whether the increasing diversity of butterflies in degraded tropical forest is associated with the loss of species with restricted geographical distribution. Present study has considered eight habitat parameters for habitat data collections and the t-test using equal variance, spearman rank correlation and multiple regressions were used for statistical analyses. Species diversity was analyzed using Margalef’s D indices that indicate both the species richness and abundance. Bootstrap method was used to compare the diversity among samples. PCA was carried out to examine the relationship between vegetation structure and species diversity in primary and degraded forest. The relationship between vegetation factor scores and species diversity at each sampling station in primary and degraded forest was analyzed using stepwise multiple regression. Results indicates that the butterflies species sampled in closed canopy forest had more restricted geographical distribution than those being sampled in disturbed forest. The species with greater light preference had significantly wider geographical distribution, whereas, the species with greater shade preferences had significantly narrower geographical distributions. The stepwise analysis of multiple regressions between the diversity indices of shade groups of butterflies and vegetation density (PRIN1) of closed forest shows a significant positive relationship, but the relationship was negative when similar analysis was performed between species diversity indices of light preferred Nymphalid groups and vegetation density. Results indicate that the greater numbers of closed canopy forest butterflies are sensitive to changes in moisture availability and humidity. Thus, changes in canopy cover and light penetration, through microclimatic effects on adult and larval survival, does have an impact on butterfly distributions. While, the species richness and diversity are higher in forest gaps, the conservation value of close canopy forest lies more in the presence of species with restricted ranges. Owing to loss of heterogeneous vegetation in degraded forest, the dense canopy cover and transparent ground cover has been reduced and thus declination of forest butterflies species. Study has clearly indicated the strong and significant relationship between the species of narrow range of geographical distribution and species shade preference. The restricted ranges species are affected due to forest degradation. Thus, clearly bringing into light, that increasing diversity in degraded forest is associated with the loss of species with restricted geographical distribution. Out of seven gap preferred shade group of butterflies, two have wide geographical distribution and the other five have medium range distribution. Thus, there is a strong phylogenetic relationship between the genera of light preferred shade loving group of butterflies and the butterflies of light loving group and the genera of shade preferred light loving group of butterflies and the butterflies of shade loving group. Key words: Ecology, closed canopy forests, conservation, degraded forests, endemic species, geographic distribution range, light and shade groups, nymphalid butterflies, phylogeny, tropical forests.