Abstract
Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.
Highlights
Myriostachya is monotypic genus in the Poaceae family, with Myriostachya wightiana (Nees ex Steud.) Hook. f. being the only species (1)
Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum
The PCR amplified M. wightiana chloroplast rbcL gene was successfully run by the 1.5% agarose gel electrophoresis
Summary
Myriostachya is monotypic genus in the Poaceae family, with Myriostachya wightiana (Nees ex Steud.) Hook. f. being the only species (1). The species is tropical with, its native range from the Indian Subcontinent to West Malesia. It is widely located in the intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra (2). M. wightiana is a large, densely clumped perennial grass growing up to 3 meters. It frequently occurs along with Acanthus ilicifolius L., Nypa fruticans Wurmb. The species grows well in saline water habitat rather than fresh water due to structural adaptations like the thick epidermis, sclerenchymatous vascular system, salt secretion glands, conspicuous metaxylem and broad phloem region in stem and leaf, dense cortex and lignified root exodermis (3)
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
