Strawberry Latent Ringspot Virus Research Articles

Tokat İli Asma Alanında Bazı Asma Virüslerinin Moleküler Olarak Belirlenmesi ve Grapevine Virus A'nın Filogenetik Analizi

Grapevine (Vitis spp.) is one of the major fruit crop with high socioeconomic importance for Turkey. In vineyards, many harmful organism, especially virus infections, weaken the plant and lead to decreases in yield and quality, so it takes the lead in quarantine and certification. This study was carried out to determine some viral agents that cause yield loss in vines produced in Tokat, where viticulture is very important. Samples were collected from young leaves and one-year-old shoots of grapevines showing virus symptoms from some vineyard areas in Tokat Center and its districts. Collected 189 grapevine samples were subjected to the RT-PCR test, which is a molecular method using virus-specific primers, to detect the presence of Grapevine pinot gris virus (GPGV), Grapevine virus A (GVA), Strawberry latent ringspot virus (SLRSV). Out of a total of 189 plant samples, 80 (42.32%) of GVA, 3 (1.58%) of GPGV were detected and SLRSV (0%) was not detected. More than one virus was found in 2 (1.05%) of 189 tested samples. It was determined that the most common virus was GVA, the least detected virus was GPGV in plant samples collected from Tokat Center and its districts. Bidirectional sequence analysis of RT-PCR products of GVA-infected isolates were performed and phylogenetic analyzes were done by comparing them with reference isolates after they were aligned with the MEGAX computer program. Based on phylogenetic analysis studies, GVA showed differential branching with isolates registered in GenBank and isolates obtained in the study. GVA-infected isolates showed similarity with reference isolates at rates of 92-94%. In this study, molecular analysis of Turkish GVA isolates was performed. This molecular information is important as it will shed light on future studies.

Genetic diversity and phylogenetic characteristics of viruses in lily plants in Beijing.

Lily (Lilium) is an important bulbous perennial herb that is frequently infected by one or more viruses. To investigate the diversity of lily viruses, lilies with virus-like symptoms in Beijing were collected to perform small RNA deep sequencing. Then, the 12 complete and six nearly full-length viral genomes, including six known viruses and two novel viruses were determined. Based on sequence and phylogenetic analyses, two novel viruses were considered to be members of the genera Alphaendornavirus (Endornaviridae) and Polerovirus (Solemoviridae). These two novel viruses were provisionally named lily-associated alphaendornavirus 1 (LaEV-1) and lily-associated polerovirus 1 (LaPV-1). Based on sequence, phylogenetic and recombination analyses, strawberry latent ringspot virus (SLRSV) in the genus Stralarivirus (Secoviridae) was identified for the first time in China, and shown to exhibit the highest nucleotide (nt) diversity among the available full-length SLRSV genome sequences, with the highest identities of 79.5% for RNA1 and 80.9% for RNA2. Interestingly, the protease cofactor region in RNA1 was 752 aa in length, whereas those of the other 27 characterized isolates ranged from 700-719 aa in length. The genome sequences of lily virus A (Potyvirus), lily virus X (Potexvirus), and plantago asiatica mosaic virus (Potexvirus) exhibited varying degrees of sequence diversity at the nucleotide level compared with their corresponding characterized isolates. In addition, plantago asiatica mosaic virus (PlAMV) tended to cluster on a host species-basis. One identified lily mottle virus (Potyvirus) isolate was detected as a recombinant, and which clustered in a different group with four other isolates. Seven identified lily symptomless virus (Carlavirus) isolates, including one recombinant, were clustered into three clades. Our results revealed the genetic diversity of lily-infecting viruses, and sequence insertion, host species and recombination are factors that likely contribute to this diversity. Collectively, our results provide useful information regarding the control of viral disease in lily.

A survey of rose viruses in England

Roses (Rosa spp.) are valuable ornamental shrubs grown worldwide. Despite the importance of their cultivation, the large contribution they make to the United Kingdom (UK) garden industry, and the global spread of rose viruses, they have not been studied in detail in the UK since the 1980s. In this study, a survey of rose viruses in England was performed using molecular and serological methods. The aims of the study include an update on the presence and incidence of rose viruses, analysis of symptoms and mixed infections, and identification of the viruses involved in rose mosaic disease, one of the most common diseases in roses worldwide. Previously reported viruses in the UK were found during this study, including strawberry latent ringspot virus (family Secoviridae), arabis mosaic virus (genus Nepovirus), and prunus necrotic ringspot virus (genus Ilarvirus), but also two commonly known viruses were found for the first time infecting roses in the UK (cucumber mosaic virus [genus Cucumovirus] and tomato spotted wilt virus [genus Orthotospovirus]). This work led to first records for the UK of two viruses, rose cryptic virus-1 (genus Alphapartitivirus – pending approval by the International Committee on the Taxonomy of Viruses), and rose spring dwarf-associated virus (genus Luteovirus). Here, the presence and distribution of each of these viruses are reported.

Cohombrillo-associated virus: a novel virus infecting Ecballium elaterium plants.

We determined the complete genome sequence of a new virus infecting Ecballium elaterium ('cohombrillo amargo') plants, a weed species common on the borders of cultivated fields in the Mediterranean region. The genome of this virus is composed of two molecules of monocistronic positive-sense RNA, 6,934 and 3,501 nucleotides in length, excluding their poly(A) tails. The highest amino acid sequence similarity (50% identity) in the Pro-Pol core region encoded by RNA 1 was observed in the corresponding protein of strawberry latent ringspot virus. Based on pairwise comparisons and phylogenetic analysis, this virus, tentatively named "cohombrillo-associated virus" (CoAV), appears to be a member of a new species in the genus Stralarivirus (family Secoviridae), for which the name "Stralarivirus elaterii" is proposed. This new virus has different putative cleavage patterns from members of other species belonging to this genus.

PM 4/17 (3) Certification scheme for olive trees and rootstocks

<scp>PM</scp> 4/17 (3) Certification scheme for olive trees and rootstocks

First report of Grapevine red globe virus in grapevine in the United Kingdom

In August 2019 a sample of grapevine (Vitis sp.) leaves was submitted to Fera Science Ltd. from a vineyard in the south of England. The sample was sent following the appearance of an unknown disease. Symptoms included red colouration and flecking (Figures 1, 2). The sample was tested by DAS-ELISA for the presence of Arabis mosaic virus (DSMZ, Germany), Raspberry ringspot virus (DSMZ, Germany), Strawberry latent ringspot virus, Tobacco ringspot virus (Agdia, USA), Tomato black ring virus (DSMZ, Germany and Bioreba, Switzerland), Tomato ringspot virus (Loewe, Germany), and plate trap ELISA for potyviruses using a generic potyvirus antisera (DSMZ, Germany). The sample gave negative results for all tests. The sample was then tested by high throughput sequencing (HTS) on a MiSeq Sequencer (Illumina, UK) (Fowkes et al., 2021). The total number of reads for the sample was 342,422 with 5 (0.001%) being mapped to the genome of Grapevine red globe virus (GRGV, genus Maculavirus). The sequence contig of 217 nt obtained by HTS was checked by nucleotide comparison through BLAST against publicly available sequences. The partial sequence of the replicase gene had 94% identity to a GRGV sequence (GenBank Accession No. MZ451066.1), a historical isolate sequenced from the Sidney live plant collection, country of origin unknown (Mike Rott, CFIA, Pers. Comm.). The genome fragment of GRGV was uploaded to GenBank (ON187032). Sequencing data has been submitted to the NCBI short read archive, BioProject (PRJNA817416). Other grapevine viruses were also inferred from the sequence data, namely Grapevine rupestris stem pitting-associated virus (genus Foveavirus, ON187034) and Grapevine fleck virus (genus Maculavirus, ON187033). In each case these have been previously reported from the UK (Silva et al., 2017). To further confirm infection by GRGV, the sample was tested by RT-PCR using primers specific for GRGV (Ruiz-Garcia et al., 2018). A product of 418 bp was obtained (ON187031). The product was analysed by Sanger sequencing (MWG GmbH, Germany) and checked by nucleotide sequence comparison against sequences publicly available through BLAST. The sequence had 95% identity to the sequence of a GRGV isolate from Washington State, USA (MT749359.1). GRGV was first reported in Italy (Sabanadzovic et al., 2000) and has since been found in China, Croatia, France, Germany, Greece, Iran, Slovenia, Spain and the USA (Nourinejhad Zarghani et al., 2021; EPPO Global database, 2022). No specific symptoms have been associated with GRGV (Ruiz-Garcia et al., 2018), and as the detection of GRGV was in co-infection with other viruses, no conclusion can be drawn on the cause of the observed symptoms. To our knowledge this is the first report of GRGV in the UK. This suggests a broader distribution than previously reported and indicates the need for further surveillance of grapevine to establish current distribution. This work was funded under the Defra-Fera Long Term Service Agreement.

Assessment of the virus infections occurrence in new established plum and sweet cherry orchards in Transylvania, Romania

Sixteen plum and eleven sweet cherry newly established commercial orchards in Transylvania, Romania, were the subject of the survey during the vegetative periods of 2020-2021 in order to assess the occurrence of different virus infections. Two blocks of 200 trees from each orchard were monitored by visual observation for virus-like symptoms, especially for Plum pox virus (PPV) in plum orchards. Twenty trees of each plum orchard were then sampled and tested for serological detection of PPV, Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV) and Myrobalan latent ringspot virus (MLRSV). Similarly, ten trees of each sweet cherry orchard were sampled and tested for the presence of PDV, PNRSV, ApMV, ACLSV, PPV, Arabis mosaic virus (ArMV), Cherry leaf roll virus (CLRV), Raspberry ringspot virus (RpRSV), Strawberry latent ringspot virus (SLRSV) and Tomato black ring virus (TBRV) by serologic assays. Additionally, a few sweet cherry trees suspected to be infected by Little cherry virus-1 (LChV-1) were tested by molecular assay. Unexpectedly, no plum orchards were found to be free of PPV. The average level of PPV infection was 32%. PNRSV occurred in 8.1% and PDV in 1.2% of sampled plum trees. Four out of ten viruses were detected in sweet cherry sampled: PDV (3.6%), ACLSV (0.9%), RpRSV (0.9%) and TBRV (0.9%). No infection with ACLSV, ApMV and MLRSV in plum and PPV, PNRSV, ApMV, ArMV, CLRV, SLRSV and LChV-1 in sweet cherry was detected. Mixed infections occurred at 4.8% in plum, and at 0.9% in sweet cherry trees sampled. The average occurrence of viruses in plum and sweet cherry orchards surveyed in Transylvania was determined at 41.3%, and 6.3% respectively. Overall results revealed a critical situation especially in regards to PPV infections making the success of fruit production in the most surveyed plum orchards quite problematic. Virus infections level in the younger sweet cherry orchards were significantly lower.

Production of Virus-Free Rose Plants using Meristem-Tip Culture and in vitro Thermotherapy.

&lt;b&gt;Background and Objective:&lt;/b&gt; Tissue culture and thermotherapy were proved to be suitable in eliminating viruses of many plants. This study was designed in an attempt to produce virus-free Al-Taif rose plants (&lt;i&gt;Rosa damascena&lt;/i&gt; Trigintipetala Dieck) through the practical application of the tissue culture approach and thermotherapy. &lt;b&gt;Materials and Methods:&lt;/b&gt; Double Antibody Sandwich-Enzyme-Linked Immunosorbent Assay ( DAS-ELISA) and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) techniques were used to detect the presence of &lt;i&gt;Apple mosaic virus&lt;/i&gt; (ApMV) and &lt;i&gt;Strawberry latent ringspot virus&lt;/i&gt; (SLRV) in rose plant materials collected from Taif, KSA. RT-PCR was more sensitive than DAS-ELISA in detecting the 2 viruses. &lt;b&gt;Results:&lt;/b&gt; Three different meristem-tip sterilization methods were compared and results revealed that treatment 3 (T&lt;sub&gt;3&lt;/sub&gt;: 70% Ethanol for 1.0 min and 15% Clorox (Sodium hypochlorite 5.25%) for 10 min) was the most suitable as 97.78% of cleaned meristem tips survived. Meristem tips with different lengths were thermotherapy-treated for different durations. It was indicated that meristem tips of 0.5 or 1.0 cm and heat-treated at 37&lt;sup&gt;o&lt;/sup&gt;C for four weeks gave the highest percentage of meristems that were able to differentiate into micro-shoots. &lt;b&gt;Conclusion:&lt;/b&gt; RT-PCR detection of ApMV and SLRV revealed that using thermotherapy-treatment, for 4 weeks, of 0.5 cm long meristem tips was successfully applied to eliminate the 2 viruses in 92 and 96% of regenerated plantlets, respectively.

Strawberry latent ringspot virus (latent ring spot of strawberry)

This datasheet on Strawberry latent ringspot virus covers Identity, Overview, Distribution, Hosts/Species Affected, Vectors &amp; Intermediate Hosts, Diagnosis, Biology &amp; Ecology, Impacts, Prevention/Control, Further Information.

Features of the strawberry field repository formation

For the successful functioning of a breeding and nursery center of scientific and practical work with fruit and small fruit crops, an important task is to create repositories, including thosein the field. A field repository is a plant gene bank based in accordance with international standards on planting material that is free from dangerous pathogens, including viruses, representing tested for productivity typical plants.For the purpose of a comparative study of promising varieties, hybrids and clones-candidates for original plants, a field repository and mother plantation of strawberries clones and varieties have been created on the territory of the Federal Horticultural Research Center for Breeding, Agrotechnology and Nursery.As a result of research in 2015-2020, 386 high-yielding strawberry plants were selected and tested for the main harmful viruses using diagnostic kits from “Loewe” firm (Germany). The prevalence of harmful Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Tomato black ring virus (TBRV), Strawberry latent ringspot virus (SLRSV), Cucumber mosaic virus (CMV) in strawberry plantations depended on the area cultivation, varietal composition of plantings and ranged from 31 to 69 %. The prevalence of viruses RpRSV (up to 36 %), TBRV (up to 31 %) and CMV (up to 22 %) was established. The high efficiency of dry-air thermotherapy for the recovery of strawberries with the number of virus-free intact plants of 56 % has been shown.A genebank of "candidates for original plants" has been formed from 234 strawberry plants of 39 varieties and hybrids, which, after confirming their status by PCR, will be transferred to the category of "original plants".

Detection and phylogeny of viruses in native Albanian olive varieties

Forty samples representing 14 native Albanian and two foreign olive varieties were collected from an olive varietal collection plot in the Valias region (Tirana, Albania). The samples were assayed by RT-PCR for presence of olive-infecting viruses, including arabis mosaic virus (ArMV), cherry leaf roll virus (CLRV), cucumber mosaic virus (CMV), olive latent ringspot virus (OLRSV), olive latent virus 1 (OLV-1), olive leaf yellowing-associated virus (OLYaV), strawberry latent ringspot virus (SLRSV) and by PCR for the bacterium Xylella fastidiosa (Xf). Ninety-eight percent of the samples were infected with at least one virus. OLYaV was the most prevalent (85% of samples), followed by OLV-1 (50%), OLRSV (48%), CMV (28%), SLRSV (3%) and CLRV (5%), whereas ArMV and Xf were absent. Fifty-five percent of the samples were infected with one virus, 13% with two viruses, 20% with three, and 5% with four. Analyses of the nucleotide sequences of the Albanian virus isolates generally showed low genetic variability, and that most were phylogenetically related to Mediterranean isolates, in particular to those from Greece and Italy. Five olive trees, representing three native cultivars (‘Managiel’, ‘Kalinjot’ and ‘Kushan-Preze’) and one foreign (‘Leccino’), were found to be plants of the Conformitas Agraria Communitatis (“CAC”) category i.e. free of ArMV, CLRV, SLRSV and OLYaV. Only one tree of the native cultivar ‘Ulliri i kuq’ was free of all tested viruses, so this is plant material of the “Virus-tested” category. Olives derived from both categories could be used for propagation of standard quality plant materiel in a future certification programme for olive in Albania. This is the first report of CLRV, OLRSV, CMV and OLV-1 in Albania. The study also reveals the precarious health status of native olive varieties in the Valias varietal collection plot. However, the discovery of six plants representing two certifiable categories is a first step in a future olive tree certification program in the country.

First report of Tobacco ringspot virus in highbush blueberry in Washington State.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Fundamental and practical bases for creating a blackcurrant field repository in Russia

Creating a virus-free repository of blackcurrant will allow an assessment of productivity, other qualitative characteristics and the use of pollen from healthy plants for breeding. The aim of the research was to reveal the most promising varieties and hybrids of blackcurrant, test plants for viruses and obtain nuclear stock plants for laying the repository. The studies were carried out in 2018-2020 using generally accepted methods of variety study, virus diagnosis and plants reproduction. Valuable blackcurrant varieties and hybrids of the All-Russian Horticultural Institute for Breeding, Agrotechnology and Nursery breeding were studied; the most productive clones were selected and tested by ELISA and PCR. The species composition of harmful viruses in the fruiting stands of blackcurrant under ex situ conditions is diverse. The total prevalence of Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Strawberry latent ringspot virus (SLRSV), Tomato black ring virus (TBRV) on blackcurrant plants was 31.5 %. The prevalence of SLRSV and RpRSV was about 15 %, TBRV – 14 %, ArMV – 7 %. Blackcurrant reversion virus (BRV) was absent. As a result of the monitoring carried out in 2018, blackcurrant plants of 8 varieties free from harmful viruses were identified and, after PCR, will be used to establish the repository and base mother nursery.

Diagnosis of viral diseases and revealing of candidates in nuclear plants of strawberry ex situ

Currently, about 20 viral diseases are known on strawberry in the world that can reduce the yield and its quality. According to the results of previous studies in the Moscow region, the prevalence of viruses on strawberries was: Arabis mosaic virus (ArMV) – 14 %, Raspberry ringspot virus (RpRSV) and Strawberry latent ringspot virus (SLRSV) – 16 %, Tomato black ring virus (TBRV) – 25 %. Viruses mainly spread in agrocenosis with infected planting material, with tools, with pollen and seeds, nematodes - longidorids (Xiphinema diversicaudatum – ArMV and SLRSV vector, Longidorus elongatus – RpRSV and TBRV vector). According to published data, the harmfulness of viruses on plants of strawberries was to reduce the number of repens by 6-40 %, outlets by 10-40 %, and ovaries by 30 %. The aim of the study was to study the species composition of viruses on strawberries to identify candidates for the nuclear plants. In serological tests, a sandwich ELISA was used according to the method “Diagnosis of pome and stone crops viruses by ELISA and PCR” (2008), for analysis, diagnostic kits from ‘Loewe’ (Germany) were used. Leaves were taken as samples. The analysis results were recorded on a ‘Stat Fax 2100’ tablet photometer at a wavelength of 405 and 630 nm. The species composition of viruses was studied on strawberry varieties and hybrids under ex situ conditions. The total prevalence of viruses was 29 %. 188 candidates for nuclear stock plants of 17 varieties and 2 hybrids of strawberry were revealed. No viruses were detected on varieties Barynya, Induka and promising hybrids 34-34-5 and 3-372-1, which may be associated with a low percentage of transmission of nepoviruses with seeds. After confirming the virus-free status of strawberry plants by PCR, they will receive the category of “nuclear stock plant”.

Prevalence of viral diseases and isolation of candidates in nuclear stock plants of raspberry ex situ

On raspberries, currently about 30 viral diseases are known in the world that can reduce the yield and its quality. According to the results of previous studies in the Moscow region, the prevalence of viruses on raspberries was: Arabis mosaic virus(ArMV) – 14 %, Raspberry ringspot virus(RpRSV) – 30 %, Strawberry latent ringspot virus(SLRSV) – 16 %, Tomato black ring virus (TBRV ) – 18 %, Raspberry bushy dwarf virus (RBDV) – 39 %. Viruses spread in agrocenosis with infected planting material, with tools, with pollen and seeds, nematodes – longidorids (Xiphinema diversicaudatum – ArMV and SLRSVvector, Longidorus elongatus – RpRSV and TBRVvector). The harmfulness of viruses on raspberry plants consisted inreducingthe productivity by 21 %, fruit masse– by 26 % compared with virus-free plants. The aim of the study was to study the species composition of viruses on raspberries to identify candidates for the nuclear stock plants. In serological tests, the ELISA sandwich version was used according, for analysis, diagnostic kits from Loewe (Germany) were used. Leaves were taken as samples. The results of analyzes were recorded on a Stat Fax 2100 hotometer at a wavelength of 405 and 630 nm. RBDV virus RNA was isolated using the CytoSorb kit, followed by RT-PCR. The species composition of viruses on raspberry varieties was studied under ex situ conditions. The total prevalence of viruses was 29 % with the predominance of the RBDV virus (19 %). 102 candidates for nuclearstockplants of 22 varieties of raspberries were identified. After confirming the virus-free status of raspberry plants by PCR, they will receive the category “nuclearstock plant”.

The Detection of viruses in olive cultivars in Greece, using a rapid and effective RNA extraction method, for certification of virus-tested propagation material

Although Greece is the world’s third largest olive production country, information about the presence of olive viruses is limited. A survey for the presence of virus infections in the ten most important Greek cultivars was conducted in a germplasm collection olive grove located in Chania, Crete. Samples were RT-PCR assayed for the presence of Arabis mosaic virus (ArMV), Cherry leafroll virus (CLRV), Strawberry latent ring spot virus (SLRSV), and Olive leaf yellowing-associated virus (OLYaV), amplifying part of the capsid protein (ArMV), the 3΄UTR (CLSRV, SLRSV) or the HSP70h (OLYaV) gene. Total RNAs were purified using the Trizol method, yielding good quality and purity, thereby confirming application of the method as a rapid economic extraction protocol for detection of olive viruses. SLRSV was the most predominant virus, with an infection rate of 55%, followed by CLRV and OLYaV in 5% of the tested samples. ArMV was detected only in one sample. Mixed virus infections were also commonly detected. The DNA amplicons of the obtained viruses from the infected samples were sequenced. The partial sequences of ArMV, CLRV and SLRSV from olives, which are reported for the first time, showed 74-100% nucleotide similarity with available homologous sequences from other crops, whereas OLYaV isolates showed high sequence variability of 25%. The phylogenetic analysis based on olive-OLYaV HSP70h partial-nucleotide sequences grouped the olive isolate sequences according to the geographical origins of the host germplasm collection. This is the first official report of the occurrence of olive viruses in Greece, emphasizing the need to implement a certification programme for production and distribution of high-quality (virus-free) olive propagation material, in Greece and more generally in the Mediterranean basin.

Creation of a new genus in the family Secoviridae substantiated by sequence variation of newly identified strawberry latent ringspot virus isolates

To obtain insight into the sequence diversity of strawberry latent ringspot virus (SLRSV), isolates from collections and diagnostic samples were sequenced by high-throughput sequencing. For five SLRSV isolates, the complete genome sequences were determined, and for 18 other isolates nearly complete genome sequences were determined. The sequence data were analysed in relation to sequences of SLRSV and related virus isolates available in the NCBI GenBank database. The genome sequences were annotated, and sequences of the protease-polymerase (Pro-Pol) region and coat proteins (CPs) (large and small CP together) were used for phylogenetic analysis. The amino acid sequences of the Pro-Pol region were very similar, whereas the nucleotide sequences of this region were more variable. The amino acid sequences of the CPs were less similar, which was corroborated by the results of a serological comparison performed using antisera raised against different isolates of SLRSV. Based on these results, we propose that SLRSV and related unassigned viruses be assigned to a new genus within the family Secoviridae, named “Stralarivirus”. Based on the phylogenetic analysis, this genus should include at least three viruses, i.e., SLRSV-A, SLRSV-B and lychnis mottle virus. The newly generated sequence data provide a basis for designing molecular tests to screen for SLRSV.

INCIDENCE OF VIRUSES ON AUTOCHTHONOUS AND INTRODUCED OLIVE VARIETIES IN CROATIAN ISTRIA DETECTED BY THREE DIAGNOSTIC TECHNIQUES

A survey on viruses infecting olive trees was performed in Croatian Istria. Major olive viruses were detected using molecular (RT-PCR), biological (bioassay on indicator plants) and serological (DAS-ELISA) diagnostic techniques. Specifically, fifteen olive varieties from a total of 62 olive trees have been tested for the presence of eight viruses. Cherry leaf roll virus (CLRV), Strawberry latent ring spot virus (SLRSV) and Olive latent virus-1 (OLV-1) were detected by one-step RT-PCR in ten autochthonous and five introduced olive varieties. The most frequent found was CLRV, detected in 11.3% of tested trees both in autochthonous and in introduced varieties, while OLV-1 and SLRSV were detected only in autochthonous varieties and in lower incidence. In order to confirm the results obtained by one-step RT-PCR, inocula prepared from the flowers were used for inoculation of herbaceous indicator plants. Symptoms on herbaceous hosts were monitored and CLRV and SLRSV were detected by DAS-ELISA, confirming the results of molecular test. The most successful mechanical transmission was on Chenopodium quinoa, while the most evident symptoms were observed on Cucumis sativus L. cv. Suncani potok plants.

Development of Simple and Rapid Diagnostic Method for Strawberry Latent Ring-spot Virus in Plants Using Loop-Mediated Isothermal Amplification Assay

Strawberry Latent Ring-spot Virus (SLRSV) is seed or nematodes-transmitted viruses, and causes quantitative and qualitative loss of various crops. SLRSV is a non-reported, potentially control able virus, which is managed at the national level. Currently, RT-PCR and nested PCR system are the standard methods of detecting SLRSV, but more effective methods are required. In this study, loop-mediated isothermal amplification (LAMP) assay was used for detection of SLRSV. As a result, the LAMP assay showed sensitivity similar to that of the currently used method, but is more rapid (approximately 8 hrs), simple and specific. In addition, results can be verified by restriction fragment length polymorphism (RFLP) using BfaI, or sequencing after the LAMP reaction. Therefore, we have shown that the LAMP assay developed in this study is a potential marker for the facilitation of rapid and simple screening of SLRSV in plants, which will ultimately be useful for the diagnosis of SLRSV infected plants and quarantine.

Molecular characterization of the coat protein gene of prunus necrotic ringspot virus infecting peach in Montenegro

In 2011 and 2012, two major peach-growing areas in Montenegro were surveyed for the occurrence of eleven peach viruses. Samples collected from 105 peach and nectarine trees were tested by Reverse transcription-polymerase chain reaction (RT-PCR) using sets of primers specific for the detection of Apple chlorotic leaf spot virus (ACLSV), Apple mosaic virus (ApMV), Cherry mottle leaf virus (CMLV), Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), Peach mosaic virus (PMV), Peach rosette mosaic virus (PRMV), Tobacco ringspot virus (TRSV) and Tomato ringspot virus (ToRSV). The occurrence of Strawberry latent ringspot virus (SLRSV) was examined using nested RT-PCR, while a Real-time quantitative RT-PCR method was applied for detection of Plum pox virus (PPV). PPV, PNRSV and PDV were detected in 42.9, 24.8 and 0.9 % of samples. Mixed viral infections were recorded in 6.7 % of samples, while results showed the absence of ACLSV, ApMV, PMV, CMLV, SLRSV, PRMV, TRSV and ToRSV from all assayed samples. In particular, the PCR products of complete coat protein (CP) gene was cloned and sequenced from fourteen PNRSV isolates. A high identity (87.5–100 %) was found between CP nucleotide sequences of Montenegrin isolates and other PNRSV isolates from different hosts and geographic regions retrieved from GenBank. CP nucleotide sequence comparison, as well as phylogenetic reconstruction confirmed the clustering of the isolates into three molecular groups (PV-96, PV-32 and PE-5), whereby Montenegrin isolates were separated into two phylogroups (PV-96 and PE-5). Comparative sequence and phylogenetic analysis showed that clustering of various isolates was not associated with geographic and host origin.