Serovar Strains Research Articles

Identification of Streptococcus ferus and the Distribution of Three Kinds of Mutants Streptococci from Pig Tooth Surface

Mutans streptococci has been implicated as a primary causative agent of dental caries in animal. Two kinds of mutans streptococci, Streptococcus orisuis serovar strains were identified previously. New gram-positive streptococcal mutans-like strains from the oral flora of pigs were characterized. The distribution of three kinds of the mutans streptococci was studied. A third strain was newly identified as Streptococcus ferus based on 16S rRNA gene sequencing, G+C content, DNA-DNA homology, and extensive biochemical testing, and serologically grouped into serotype c of mutans streptococci. The distribution of three strains revealed that S. ferus was the predominant species. S. orisuis serovar strains made up 4∼13% of all the streptococci in young pigs. These results suggest that the detection rate of these mutans streptococci corelates with feed containing sucrose and S. ferus is the outlived strain among the three mutans streptococci in pig oral cavity.

Identification and expression of GH-8 family chitosanases from severalBacillus thuringiensissubspecies

The Gram-positive spore-forming bacterium, Bacillus thuringiensis, a member of the Bacillus cereus group, produces chitosanases that catalyze the hydrolysis of chitosan to chitosan-oligosaccharides (COS). Although fungal and bacterial chitosanases belonging to other glycoside hydrolase (GH) families have been characterized in a variety of microorganisms, knowledge on the genetics and phylogeny of the GH-8 chitosanases remains limited. Nine genes encoding chitosanases were cloned from 29 different serovar strains of B. thuringiensis and they were expressed in Escherichia coli. The ORFs of the chitosanases contained 1,359 nucleotides and the protein products had high levels of sequence identity (>96%) to other Bacillus species GH-8 chitosanases. Thin-layer chromatography and HPLC analyses demonstrated that these enzymes hydrolyzed chitosan to a chitosan-trimer and a chitosan-tetramer as major products, and this could be useful in the production of COS. In addition, a simple plate assay was developed, involving a soluble chitosan, for high-throughput screening of chitosanases. This system allowed screening for mutant enzymes with higher enzyme activity generated by error-prone PCR, indicating that it can be used for directed chitosanase evolution.

Evaluation ofphoPandrpoSmutants ofSalmonella entericaserovar Typhi as attenuated typhoid vaccine candidates: virulence and protective immune responses in intranasally immunized mice

The attenuation and immunoenhancing effects of rpoS and phoP Salmonella enterica serovar strain Typhi (Salmonella typhi) mutants have not been compared. Here, three S. typhi deletion mutants (phoP, rpoS, and rpoS-phoP double mutant) are constructed and these mutants are characterized with respect to invasiveness, virulence, and protective immune response compared with wild-type Ty2. It was found that phoP and phoP-rpoS deletion mutants are less invasive to HT-29 cells than the wild-type Ty2 and the rpoS single-deleted strain. The LD(50) of immunized mice was higher for phoP than for rpoS mutants, and the highest for the phoP-rpoS double mutant. In addition, all S. typhi mutants showed an increase in the specific serum IgG levels and T-cell-mediated immunity, and showed equal protection abilities against a wild-type Ty2 challenge after two rounds of immunization in BALB/c mice. It is concluded that phoP genes appear to play a more important role than rpoS genes in both cellular invasion and virulence of S. typhi, but not in immunogenicity in mice. Furthermore, the data indicate that the phoP-rpoS double mutant may show promise as a candidate for an attenuated typhoid vaccine.

Epidemiological Analysis of Erysipelothrix Isolates from Various Animals by Acriflavine Resistance and RAPD Typing

The epidemiological analysis of Erysipelothrix isolates recovered from pigs, cattle and chickens was studied by the analysis of acriflavine resistance and the PCR-based DNA fingerprinting method using random amplified polymorphic DNA (RAPD). Thirty-two Erysipelothrix field isolates, 7 Erysipelothrix reference strains and 13 random primers were tested. Among the tested primers, the primers NK6 (CCCGCGCCCC) and D9355 (CCGGATCCGTGATGCGGTGCG) produced noticeable results. The primer NK6 revealed 5 RAPD patterns (a∼e) while primer D9355 revealed 8 RAPD patterns (A∼H) that were not serovar specific. Namely, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of Erysipelothrix species but the RAPD data demonstrated that the some serovar 1a E. rhusiopathiae strains including strain Koganei 65-0.15 for the production of live vaccine were closely related each other genetically, irrespective of their acriflavine resistance. Based on these results, we concluded that the RAPD method with primer D9355 is a rapid and reliable method to differentiate Erysipelothrix isolates from various animals ; and might be a useful tool for the epidemiological analysis of the Erysipelothrix species.

Isolation of Actinobacillus pleuropneumoniae Serovar 15-Like Strain from a Field Case of Porcine Pleuropneumonia in Japan

An Actinobacillus pleuropneumoniae strain isolated from a field case of porcine pleuropneumonia in Japan, was closely related to a reference strain of serovar 15, which is a newly proposed serovar according to an analysis of field isolates originating from Australia. The isolate had biological and biochemical properties consistent with A. pleuropneumoniae biovar 1, and reacted strongly to a rabbit antiserum raised against a reference strain of serovar 15 in an agar gel precipitation test. The nucleotide sequence of a hyper variable region in the 16S RNA gene of the isolate was identical to that of the reference strain of serovar 15. The isolate possessed A. pleuropneumoniae-RTX toxin (Apx) II, III, and IV genes, consistent with serovar 15. Its virulence in mice was lower than that of ApxI-bearing strains but higher than that of other ApxIII-bearing strains. This is the first report describing the isolation of A. pleuropneumoniae serovar 15-like strain from a country or region other than Australia.

An evaluation of the apxIVA based PCR-REA method for differentiation of Actinobacillus pleuropneumoniae

A restriction analysis of PCR (PCR-REA) amplified apxIVA gene has been suggested as an alternative method for serotyping of Actinobacillus pleuropneumoniae by Jaglic et al. [Jaglic, Z., Svastova, P., Rychlik, I., Nedbalcova, K., Kucerova, Z., Pavlik, I., Bartos, M., 2004. Differentiation of Actinobacillus pleuropneumoniae by PCR-REA based on sequence variability of the apxIVA gene and by ribotyping. Vet. Microbiol. 103, 63–69]. The current study investigated whether this alternative method could distinguish between the reference strains of serovars 13–15 and the value of the method when applied to 47 field isolates representing serovars 1–3, 5, 7–9, 12 and 15 as well as non-typable isolates. The reference strains of serovars 13 and 14 had the same sized product after the apxIVA PCR, while the product for serovar 15 was of different size compared to all the other serovar reference strains. The CfoI digest profiles of the reference serovars 13 and 14 strains were different from each other and from all other serovars. The HpaII digest profiles of these two serovars were very similar to each other, but both were distinctively different from the other serovar profiles. The CfoI digest profile of serovar 15 strain was very similar to the serovars 3 and 12 strains except for two faint extra bands for serovar 15. The HpaII digest profiles of serovars 12 and 15 reference strains were identical. The PCR-REA method correctly recognized the serovar of 21 of 43 field isolates. It was concluded that the method was a useful additional tool to support, but could not replace, conventional serotyping.

Class 1 and class 2 integrons in non-prevalent serovars of Salmonella enterica: structure and association with transposons and plasmids

To characterize class 1 and class 2 integrons which were simultaneously detected in non-typhoid Salmonella enterica strains of non-prevalent serovars, and to investigate their possible association with transposons and/or plasmids. Eight multidrug-resistant S. enterica strains belonging to serovars Virchow (4), Panama (2), Grumpensis (1) and Worthington (1), each containing a class 1 and a class 2 integron, were analysed. Nested PCR amplification was used to determine the gene-cassette configuration of the integrons. Overlapping PCR amplifications were applied in integron-transposon linkage experiments. Conjugation and hybridization experiments were used to localize integrons and transposons in the bacterial genome (plasmid and chromosome associated). One of two different class 1 integrons (with variable regions of 1000 bp/aadA1 and 2300 bp/sat-smr-aadA1) inserted into Tn21-like transposons, were found to coexist with the class 2 integron (2300 bp/dfrA1-sat1-aadA1) of Tn7 in the analysed strains. Class 1 integrons were always found in large conjugative plasmids whereas apparently intact or defective copies of the Tn7 integron could be located on the same plasmid and/or the bacterial chromosome. This report describes different associations between mobile genetic elements that play a crucial role in the capture and spread of antimicrobial drug resistance. As far as we are aware, this is the first description of class 2 integrons in serovars Panama, Grumpensis and Worthington.

Acquired homotypic and heterotypic immunity against oculogenital Chlamydia trachomatis serovars following female genital tract infection in mice

BackgroundChlamydia trachomatis is the most common sexually transmitted bacterial pathogen causing female genital tract infection throughout the world. Reinfection with the same serovar, as well as multiple infections with different serovars, occurs in humans. Using a murine model of female C. trachomatis genital tract infection, we determined if homotypic and/or heterotypic protection against reinfection was induced following infection with human oculogenital strains of C. trachomatis belonging to two serovars (D and H) that have been shown to vary significantly in the course of infection in the murine model.MethodsGroups of outbred CF-1 mice were reinfected intravaginally with a strain of either serovar D or H, two months after initial infection with these strains. Cellular immune and serologic status, both quantitative and qualitative, was assessed following initial infection, and the course of infection was monitored by culturing vaginal samples collected every 2–7 days following reinfection.ResultsSerovar D was both more virulent (longer duration of infection) and immunogenic (higher level of circulating and vaginal IgG and higher incidence of IgA in vaginal secretions) in the mouse genital tract. Although both serovars induced cross-reacting antibodies during the course of primary infection, prior infection with serovar H resulted in only a slight reduction in the median duration of infection against homotypic reinfection (p ~ 0.10), while prior infection with serovar D resulted in significant reduction in the median duration of infection against both homotypic (p < 0.01) and heterotypic reinfection (p < 0.01) when compared to primary infection in age and conditions matched controls.ConclusionSerovar D infection resulted in significant homotypic and heterotypic protection against reinfection, while primary infection with serovar H resulted in only slight homotypic protection. In addition to being the first demonstration of acquired heterotypic immunity between human oculogenital serovars, the differences in the level and extent of this immunity could in part explain the stable difference in serovar prevalence among human isolates.

Phylogenetic relatedness among leptospiral strains belonging to same serovar recovered from patients with different clinical syndromes

Leptospirosis is an emerging zoonotic disease with widespread distribution. The disease, caused by a large number of pathogenic serovars of leptospires, varies in severity from mild flu like illness to severe and fatal forms. It has often been observed that the strains of the same serovar are associated with different clinical syndromes. In this study the isolates recovered from patients with mild and severe form of leptospirosis and those isolated from rodents trapped in the same areas were analyzed by using random amplified polymorphic DNA (RAPD) fingerprinting method using the primers PB1, M16, B11 and B12. RAPD fingerprinting patterns of these strains consistently showed five different genetic clusters. Strains belonging to serovar Ratnapura that caused hepato-renal involvement in patients in South India were genetically dissimilar to strains of the same serovar isolated from patients in Andamans who had pulmonary complications. Strains of other serovars causing mild and sever illness could also be discriminated. However, isolates obtained from human patients and rodents in the same geographical areas showed identical fingerprint patterns indicating that strains circulating in different geographical regions, though belonging to same serovar, are unique to each region.

Several Salmonella enterica subsp. enterica Serotype 4,5,12:i:− Phage Types Isolated from Swine Samples Originate from Serotype Typhimurium DT U302

Pulsed-field gel electrophoresis, plasmid profiling, and phage typing were used to characterize and determine possible genetic relationships between 48 Salmonella enterica subsp. enterica isolates of pig origin collected in Catalonia, Spain, from 1998 to 2000. The strains were grouped into 23 multidrug-resistant fljB-lacking S. enterica serovar 4,5,12:i:- isolates, 24 S. enterica serovar Typhimurium isolates, and 1 S. enterica serovar 4,5,12:-:- isolate. After combining the XbaI and BlnI macrorestriction profiles (XB profile), we observed 29 distinct subtypes which were grouped into seven main patterns. All 23 of the 4,5,12:i:- serovar strains and 10 serovar Typhimurium isolates were found to have pattern AR, and similarities of >78% were detected among the subtypes. Three of the serovar Typhimurium DT U302 strains (strains T3, T4, and T8) were included in the same 4,5,12:i:- serovar cluster and shared a plasmid profile (profile I) and a pattern of multidrug resistance (resistance to ampicillin, chloramphenicol, streptomycin, sulfonamide, tetracycline, gentamicin, and trimethoprim-sulfamethoxazole) commonly found in monophasic isolates. This led us to the conclusion that strains of the S. enterica 4,5,12:i:- serovar might have originated from an S. enterica serovar Typhimurium DT U302 strain.

Molecular characterization of Vibrio parahaemolyticus of similar serovars isolated from sewage and clinical cases of diarrhoea in Calcutta, India

Vibrio parahaemolyticus is a seafood-borne halophilic pathogen that causes acute gastroenteritis in humans. During the course of an investigation on the incidence of V. parahaemolyticus in sewage water samples of Calcutta, India, we isolated eight (26.7%) strains of V. parahaemolyticus from 30 samples. Among these strains, five (62.5%) carried the thermostable direct hemolysin (tdh) gene, a major virulence marker of V. parahaemolyticus. Two strains belonged to serovar O5:K3 and the remaining three to O5:KUT, which is common among clinical strains of V. parahaemolyticus isolated from hospitalized patients of Calcutta with acute diarrhoea. The tdh positive sewage strains of V. parahaemolyticus were compared by randomly amplified polymorphic DNA (RAPD)-PCR and pulsed-field gel electrophoresis (PFGE) with strains of similar serovars selected from our culture collection to determine the genetic relatedness. Our results showed that except for sharing the similar serovar, sewage and clinical strains of V. parahaemolyticus were genetically different. In addition, toxRS-targeted group-specific (GS) PCR and open reading frame 8 (ORF-8) PCR showed that the sewage strains did not belong to the pandemic genotype. Since the sewage in Calcutta is directly used for cultivation of vegetables and for pisciculture, the presence of tdh positive V. parahaemolyticus in the sewage highlights the need for constant monitoring of the environment.

Observations on experimental colonisation of mice by ureaplasmas of human origin.

Three serovars (5, 8 and 10) of Ureaplasma urealyticum were inoculated intravaginally into groups of oestradiol-treated young adult BALB/c strain mice. Hormone treatment was essential for vaginal colonisation. The proportion of mice colonised initially and the persistence of colonisation were different with the three serovars; half of those given serovar 8 were still colonised after 84 days. A strain of serovar 5 after a further 50 subcultures in vitro was a little less persistent than it was before such subculture, but not in a way to suggest that subculturing was the main reason for differences in the behaviour of the serovars. At autopsy of six mice that were still colonised vaginally 158 days after inoculation of serovar 8, spread to the upper genital tract was shown to have occurred in three of them and dissemination to the liver and kidney in one. Compared with immunocompetent mice of strain CB20, such dissemination was not a feature in genetically related mice with severe combined immunodeficiency. This is not in keeping with the situation in hypogammaglobulinaemic patients in whom ureaplasmas and other mycoplasmas are known to disseminate. However, differences in the proportion of immunocompetent mice colonised or in ureaplasmal persistence with different serovars may act as a marker for differences in human pathogenicity and is worthy of further study.

Isolation and genetic characterization of a novel filamentous bacteriophage, a deleted form of phage f237, from a pandemic Vibrio parahaemolyticus O4:K68 strain.

We isolated a filamentous bacteriophage, VfO4K68, from the pandemic Vibrio parahaemolyticus strain belonging to 04:K68 serovar. The VfO4K68 DNA lacked a 1,893-bp fragment present in that of the distinctive region of f237, a filamentous phage isolated from a pandemic 03:K6 strain (Nasu, H. et al., J. Clin. Microbiol., 38, 2156-2161, 2000). The deletion resulted in the formation of a novel open reading frame (ORF) that possesses homology to the ORF 27 of ETA phage and staphylococcal enterotoxin E (SEE) of Staphylococcus aureus. VfO4K68 was able to infect the recipient 03:K6 serovar strains. These results suggest that VfO4K68 might act as a genetic transmitter and play some roles in the pandemic V. parahaemolyticus infection.

Amplification Polymorphism Among Xanthomonas albilineans Strains, Using a Single Oligonucleotide Primer

A genomic library was produced by a subtractive hybridisation method using DNA from Xanthomonas albilineans serovar I and X. albilineans serovar II, originating from Mauritius. The cloned fragments were amplified and used as probes for Southern hybridisation. Probe F20 was selected on the basis of the RFLP pattern. Upon hybridisation of X. albilineans DNA with probe F20, strains of serovars I and II were differentiated by their banding profiles. This probe was sequenced and oligonucleotide primers were designed. Fragment number and length polymorphisms were obtained after PCR amplification of X. albilineans DNA using F20A as a single primer. The number and size of bands obtained with this primer was correlated to the serotypes of the strains and to the DNA grouping reported by Alvarez et al. (1996). The two serotypes I and II which exist in Mauritius were differentiated by the PCR using primer F20A. The probe and primer developed provide rapid and precise tools for the differentiation of genetic variants within the species X. albilineans.

Pyrosequencing as a method for grouping of Listeria monocytogenes strains on the basis of single-nucleotide polymorphisms in the inlB gene.

By using pyrosequencing (i.e., sequencing by synthesis) 106 strains of different serovars of Listeria monocytogenes were rapidly grouped into four categories based on nucleotide variations at positions 1575 and 1578 of the inlB gene. Strains of serovars 1/2a and 1/2c constituted one group, and strains of serovars 1/2b and 3b constituted another group, whereas serovar 4b strains were separated into two groups.

Disruption of the genes for ClpXP protease in Salmonella enterica serovar Typhimurium results in persistent infection in mice, and development of persistence requires endogenous gamma interferon and tumor necrosis factor alpha.

The enteric pathogen Salmonella enterica serovar Typhimurium, similar to other facultative intracellular pathogens, has been shown to respond to the hostile conditions inside macrophages of the host organism by producing a set of stress proteins that are also induced by various environmental stresses. The stress-induced ClpXP protease is a member of the ATP-dependent proteases, which are known to be responsible for more than 90% of all proteolysis in Escherichia coli. To investigate the contribution of the ClpXP protease to the virulence of serovar Typhimurium we initially cloned the clpP and clpX operon from the pathogenic strain serovar Typhimurium chi3306 and then created insertional mutations in the clpP and/or clpX gene. The Delta clpP and Delta clpX mutants were used to inoculate BALB/c mice by either the intraperitoneal or the oral route and found to be limited in their ability to colonize organs of the lymphatic system and to cause systemic disease in the host. A variety of experiments were performed to determine the possible reasons for the loss of virulence. An oxygen-dependent killing assay using hydrogen peroxide and paraquat (a superoxide anion generator) and a serum killing assay using murine serum demonstrated that all of the serovar Typhimurium Delta clpP and Delta clpX mutants were as resistant to these killing mechanisms as the wild-type strain. On the other hand, the macrophage survival assay revealed that all these mutants were more sensitive to the intracellular environment than the wild-type strain and were unable to grow or survive within peritoneal macrophages of BALB/c mice. In addition, it was revealed that the serovar Typhimurium ClpXP-depleted mutant was not completely cleared but found to persist at low levels within spleens and livers of mice. Interferon gamma-deficient mice and tumor necrosis factor alpha-deficient mice failed to survive the attenuated serovar Typhimurium infections, suggesting that both endogenous cytokines are essential for regulation of persistent infection with serovar Typhimurium.

A cross-protection experiment in pigs vaccinated with Haemophilus parasuis serovars 2 and 5 bacterins, and evaluation of a bivalent vaccine under laboratory and field conditions.

Cross-protection between Haemophilus parasuis serovars 2 and 5 was examined in pigs using a bacterin based vaccine, and subsequently the safety and efficacy of a bivalent vaccine were evaluated. Upon intratracheal challenge of a serovar 2 or 5 strain, pigs immunized with a monovalent vaccine were protected against challenge with a homologous serovar strain, but not with a heterologous serovar strain. Immunization with a bivalent vaccine containing both serovars 2 and 5 bacterins conferred protection in pigs against lethal challenge with each of the serovar strains. A total of 86 pigs from two SPF herds were injected with the bivalent vaccine intramuscularly twice at a four-week interval. No adverse reactions following the vaccination were observed. On day 7 after the second vaccination, vaccinated and non-vaccinated control pigs from herd A were transferred to herd B, where Glasser's disease had broken out. Pigs in the control group developed clinical signs of the disease, and 6 of 8 (75%) pigs died until slaughter, in contrast with only 4 of 46 (9%) pigs in the vaccinated group. In herd C, where there was no outbreak of Glasser's disease, complement fixation antibody titer was raised only in the vaccinated group. A challenge experiment on days 20 and 79 after the second vaccination showed that only the vaccinated pigs were protected. From these findings, the safety and efficacy of the bivalent vaccine were confirmed under laboratory and field conditions.

Isolation of provisional serovars of Shigella in diarrheal cases of tourists

Twenty-four Shigella strains of provisional serovars were isolated from travellers with diarrhea during 1993-2000 at Osaka Airport- and Kansai Airport-Quarantine Station. The outline of these cases were as follows. 1) The provisional serovars of these strains (number of cases) were S. dysenteriae 93-119 (2), S. dysenteriae 204/96 (4), S. dysenteriae I9809-73 (4), S. flexneri 88-893 (9), and S. boydii E16553 (5). 2) Symptoms of these cases were diarrhea, abdominal pain, fever, and vomiting. The ratios of each symptom were 100%, 50%, 50%, and 29.2%, respectively. Typical dysentery symptoms (mucous and bloody stool) were observed in three cases. 3) In six cases (25.0%), plural kinds of entero-pathogenic bacteria were isolated, and in four cases, two kinds of Shigella serovar (known and unknown type) were isolated. 4) The major regions where these travellers were infected was South-west Asia (79.2%). 5) Twenty-three of the Shigella strains (95.8%) of the provisional serovars were resistant to two or more drugs tested (SM, CP, TC, KM, ABPC, NA, and OFLX). The most predominant drug resistance pattern was SM. CP. TC. ABPC.

Randomly amplified polymorphic DNA analysis of Erysipelothrix spp.

The usefulness of randomly amplified polymorphic DNA method (RAPD) to identify each species of genus Erysipelothrix and for epidemiological analysis of this genus was studied. Eighty-one strains and 18 random primers were tested. Among the tested primers, the primers NK51 (GGTGGTGGTATC) and NK6 (CCCGCGCCCC) produced noticeable results. The primer NK51 revealed four species-specific RAPD patterns. Of the 66 strains of E. rhusiopathiae, 64 had the same unique band of 884 bp. Of the 12 strains of E. tonsillarum, 11 produced a 1,265-bp band. In addition, two strains, previously thought to be E. rhusiopathiae, produced the 1,265-bp band, suggesting that they had been misclassified. One strain of E. tonsillarum produced the 884-bp band, suggesting that it too was E. rhusiopathiae. The E. rhusiopathiae strain of serovar 13 produced a 650-bp band, and the strain of serovar 18 produced a clear 420-bp band as well as three weak bands of 1,265, 918, and 444 bp. The primer NK6 revealed 14 RAPD patterns that were not serovar specific. However, different patterns were produced among strains of the same serovar showing that the RAPD method is able to identify the genetic variations of strains of this genus and can rapidly and easily differentiate strains of the same serovar. Based on these results, we concluded that the RAPD method with primers NK51 and NK6 is a rapid and reliable method to identify the species of this genus; we also concluded that this method might be a useful tool for the epidemiological analysis of the Erysipelothrix species.

Natural antibiotic susceptibility of Salmonella enterica strains

The susceptibility of 100 Salmonella enterica strains belonging to S. enterica subsp. enterica ( n=90) and S. enterica subsp. arizonae ( n=10) was examined to 71 antibiotics. Within S. enterica subsp. enterica, strains of different serovars ( typhimurium ( n=17), enteritidis ( n=17), dublin ( n=10), typhi ( n=16), paratyphi A ( n=6), others ( n=24)) were studied. MICs were determined using a microdilution procedure and apart from fosfomycin there were no significant differences in susceptibility between the subspecies and serovars of S. enterica. All salmonellae were sensitive or intermediately resistant to tetracyclines, aminoglycosides, most β-lactam antibiotics, quinolones, co-trimoxazole group antibiotics, chloramphenicol, nitrofurantoin and azithromycin. S. enterica strains were intrinsically resistant to benzylpenicillin, oxacillin, most macrolides, rifampicin, lincosamides, streptogramins, glycopeptides and fusidic acid. Apart from some slight differences in antibiotic susceptibility between strains of S. enterica subsp. enterica and S. enterica subsp. arizonae, only the susceptibility to fosfomycin varied among the taxa studied. Whereas ‘enteric’ salmonellae including S. enterica subsp. arizonae were sensitive to fosfomycin, ‘typhoid’ salmonellae were intrinsically resistant. A database of the antibiotic susceptibility of S. enterica was set up. It may be of use to validate antibiotic susceptibility test results of these bacteria.