Stem Canker Disease Research Articles

Increase of coffee tree susceptibility to stem canker disease mediated by glyphosate application

Stem canker is a major disease of coffee in Indonesia, caused by Fusarium solani. Previous studies showed a correlation between stem canker incidence and glyphosate application. The study aimed to determine the effect of glyphosate application on coffee stem canker and the underlying physiological mechanisms. The research used glyphosate treatments with the concentrations of 0, 4, 8, and 16 ml.L−1. In vitro experiments were carried out by measuring the growth of F. solani colony after glyphosate treatment. In planta, tests were conducted by artificial inoculation on glyphosate-treated coffee seedlings. The severity of stem canker was assessed. In a separate test, coffee seedlings were treated with glyphosate without pathogen inoculation. In the second experiment, physiological change was determined by measuring photosynthetic pigments, gas-exchange properties, lipid peroxidation, and activity of ascorbate peroxidase (APX) and catalase (CAT) enzymes. In vitro tests showed that glyphosate had antifungal activity against F. solani. In planta, the test showed that glyphosate treatment caused higher susceptibility to stem canker in coffee seedlings, indicated by the increase of canker wound depth. Glyphosate treatment on coffee decreased the chlorophyll, carotene contents, and reduced photosynthesis rate, caused oxidative stress depicted by higher lipid peroxidation and increased enzyme APX and CAT activity.

Metabolomic Patterns of Septoria Canker Resistant and Susceptible Populus trichocarpa Genotypes 24 Hours Postinoculation.

Sphaerulina musiva is an economically and ecologically important fungal pathogen that causes Septoria stem canker and leaf spot disease of Populus species. To bridge the gap between genetic markers and structural barriers previously found to be linked to Septoria canker disease resistance in poplar, we used hydrophilic interaction liquid chromatography and tandem mass spectrometry to identify and quantify metabolites involved with signaling and cell wall remodeling. Fluctuations in signaling molecules, organic acids, amino acids, sterols, phenolics, and saccharides in resistant and susceptible P. trichocarpa inoculated with S. musiva were observed. The patterns of 222 metabolites in the resistant host implicate systemic acquired resistance (SAR), cell wall apposition, and lignin deposition as modes of resistance to this hemibiotrophic pathogen. This pattern is consistent with the expected response to the biotrophic phase of S. musiva colonization during the first 24 h postinoculation. The fungal pathogen metabolized key regulatory signals of SAR, other phenolics, and precursors of lignin biosynthesis that were depleted in the susceptible host. This is the first study to characterize metabolites associated with the response to initial colonization by S. musiva between resistant and susceptible hosts.

Evaluation of streptomycete actinobacterial isolates as biocontrol agents against royal poinciana stem canker disease caused by the fungal pathogen Neoscytalidium dimidiatum

In this study, 47 actinobacterial isolates were obtained from rhizosphere soils of royal poinciana in the United Arab Emirates (UAE). Three Streptomyces strains exhibited powerful in vitro antifungal activity against Neoscytalidium dimidiatum (the causal agent of stem canker disease of royal poinciana). The antifungal action of Streptomyces rochei UAE2 and Streptomyces coelicoflavus UAE1 was mainly correlated with antibiosis and cell-wall-degrading enzymes production, respectively. Streptomyces antibioticus UAE1 was, however, associated with both mode of actions. These isolates suppressed lesion development on fruits inoculated with N. dimidiatum in the apple fruit bioassay. Under greenhouse conditions, individual biocontrol agents (BCAs) showed greater efficacies against stem canker when applied before N. dimidiatum than after the pathogen. The curative effects of Cidely® Top (a chemical fungicide) and S. antibioticus UAE1 on disease symptoms were comparable on royal poinciana. Prior to pathogen inoculation, S. antibioticus UAE1 was capable to suppress disease symptoms and prevent the pathogen spread, suggesting a relative superiority of S. antibioticus UAE1 over all other tested treatments. This was evident in the significant (P < 0.05) reduction in the number of defoliated leaves and conidia counts ofN. dimidiatum in S. antibioticus UAE1-treated seedlings compared to the other two BCA or chemical treatments. In conclusion, the multiple mode of actions in S. antibioticus UAE1 can be particularly effective to produce synergistic actions against the fungus. This study is the first to explore the potential to use both biocontrol and fungicides to further develop integrated disease management against stem canker in royal poinciana.

Effectiveness of Augmentative Biological Control of Streptomyces griseorubens UAE2 Depends on 1-Aminocyclopropane-1-Carboxylic Acid Deaminase Activity against Neoscytalidium dimidiatum.

To manage stem canker disease on royal poinciana, actinobacterial isolates were used as biological control agents (BCAs) based on their strong in vitro inhibitory effects against Neoscytalidium dimidiatum. Streptomyces griseorubens UAE2 and Streptomyces wuyuanensis UAE1 had the ability to produce antifungal compounds and cell-wall-degrading enzymes (CWDEs). Only S. griseorubens, however, restored the activity of 1-aminocyclopropane-1-carboxylate (ACC) deaminase (ACCD). In vivo apple fruit bioassay showed that lesion development was successfully constrained by either isolates on fruits inoculated with N. dimidiatum. In our greenhouse and container nursery experiments, S. griseorubens showed almost complete suppression of disease symptoms. This was evident when the preventive treatment of S. griseorubens significantly (p < 0.05) reduced the numbers of conidia of N. dimidiatum and defoliated leaves of royal poinciana seedlings to lesser levels than when S. wuyuanensis was applied, but comparable to control treatments (no pathogen). The disease management of stem canker was also associated with significant (p < 0.05) decreases in ACC levels in royal poinciana stems when S. griseorubens was applied compared to the non-ACCD-producing S. wuyuanensis. This study is the first to report the superiority of antagonistic actinobacteria to enhance their effectiveness as BCAs not only for producing antifungal metabolites and CWDEs but also for secreting ACCD.

First Report of Phomopsis longicolla Causing Stem Canker of Eggplant in Fujian Province, China.

Eggplant (Solanum melongena L.) is one of the most popular vegetable in China. In July 2019, a serious stem canker disease of eggplant cv. Hangqieyiha has been found in commercial fields in Pingnan County, Fujian Province. The disease incidence ranged from 38% to 72%. The symptoms were found on stems but not on fruits. At first the lesions are small, more or less circular, later becoming elongated, blackish-brown lesions, eventually containing pycnidia. When stem girdling occurs, the shoot above the infected area wilts and dries up. The teleomorph of the fungus has not been encountered in sympotomatic stem. Single-conidial isolate has been obtained by using routine fungal-isolation methods and single-spore purification technique. The fungus was cultivated on potato dextrose agar (PDA), incubated under 12h/12h cycles of light and darkness until sporulation to determine. The fungus initially produced white fluffy aerial hyphae, forming relatively dense concentric pattern colony, which subsequently exhibited yellow-green pigmentation. Pycnidias had globose locules and prominent beaks, which immersed in medium, black, solitary, discoid or irregular. Conidiophores were colorless, separated, branched, 10.0 to 20.0 × 1.0 to 2.5 μm. Alpha-conidia were single-celled, ellipsoidal to fusiform, guttulate, 5.4 to 8.7 × 1.5 to 3.2 μm. Beta-conidia were found occasionally in older stock cultures, hyaline, filiform, hamate, and 17.0 to 26.9 × 0.86 to 1.23 μm. Based on these morphological characters, the fungus was identified as Phomopsis longicolla (Hobbs et al., 1985). The rDNA－ITS of the isolate FAFU01 was amplified with primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al., 1990)，and A 578 bp sequence obtained (GenBank Accession No. MW380387 ) was 96% to 98.3% identical to the known sequence of P. longicolla or Diaporthe longicolla in GenBank. For further confirmation, P. longicolla specific primers Phom.I /Phom.II (GAGCTCGCCACTAGATTTCAGGG/GGCGGCCAACCAAACTCTTGT) (Zhang et al., 1997) were used and a 337-bp amplification product was obtained which was previously reported only forP. longicolla, whereas no product was amplified from control. Based on these morphological and molecular characters, the fungus was identified as P. longicolla. In greenhouse tests, each of 35-day-old plants of eggplant cv. Hangqieyihao was maintained in 30-cm-diameter pot. Healthy stem on the plants was wounded by pinpricking. Both wounded and non-wounded stems were inoculated respectively with mycelial plugs (4 mm in diameter) from a 7-day-old PDA culture or PDA medium plugs as controls, with six replicates. The plants were covered with plastic bags to maintain high relative humidity for two days. Four days after inoculation, the plugs were washed from the stems. Thirty-five days after inoculation, canker lesions and small, black pycnidias, which were similar to those in the field, were observed on the surface of non-wounded and wounded healthy stems inoculated with pathogen, whereas all the control stems remained healthy. The fungi was re-isolated from the infected stems of plants and was further confirmed with the species-specific primers. These results confirmed the fungus's pathogenicity. This is the first report of P. longicolla causing stem canker in eggplant in Fujian Province, China.

A new avirulence gene of Leptosphaeria maculans, AvrLm14, identifies a resistance source in American broccoli (Brassica oleracea) genotypes.

In many cultivated crops, sources of resistance to diseases are sparse and rely on introgression from wild relatives. Agricultural crops often are allopolyploids resulting from interspecific crosses between related species, which are sources of diversity for resistance genes. This is the case for Brassica napus (oilseed rape, canola), an interspecific hybrid between Brassica rapa (turnip) and Brassica oleracea (cabbage). B. napus has a narrow genetic basis and few effective resistance genes against stem canker (blackleg) disease, caused by the fungus Leptosphaeria maculans, are currently available. B. rapa diversity has proven to be a valuable source of resistance (Rlm, LepR) genes, while B. oleracea genotypes were mostly considered susceptible. Here we identified a new resistance source in B. oleracea genotypes from America, potentially effective against French L. maculans isolates under both controlled and field conditions. Genetic analysis of fungal avirulence and subsequent cloning and validation identified a new avirulence gene termed AvrLm14 and suggested a typical gene‐for‐gene interaction between AvrLm14 and the postulated Rlm14 gene. AvrLm14 shares all the usual characteristics of L. maculans avirulence genes: it is hosted in a genomic region enriched in transposable elements and heterochromatin marks H3K9me3, its expression is repressed during vegetative growth but shows a strong overexpression 5–9 days following cotyledon infection, and it encodes a small secreted protein enriched in cysteine residues with few matches in databases. Similar to the previously cloned AvrLm10‐A, AvrLm14 contributes to reduce lesion size on susceptible cotyledons, pointing to a complex interplay between effectors promoting or reducing lesion development.

Isolation and Characterization of Bacillus velezensis EB14, an Endophytic Bacterial Strain Antagonistic to Poplar Stem Canker Pathogen Sphaerulina musiva and Its Interactions with the Endophytic Fungal Microbiome in Poplar

Species of the genus Populus (commonly known as poplar) are one of the most widely used groups of forest trees in North America and Europe, and play a significant ecological role as a pioneer species in boreal forests and as a dominant species in the riparian forests that serve as wildlife habitats and watersheds. Natural and artificial hybrids of poplar are being extensively used in commercial plantations. However, many hybrid poplar trees are susceptible to Sphaerulina musiva, the pathogenic fungus that causes leaf spots and stem cankers and limits the utility of hybrid poplar as a plantation tree. We isolated an endophytic bacterial strain, Bacillus velezensis EB14, from a Populus hybrid which showed a strong antifungal activity against S. musiva. Through mass spectrometric analyses of cocultured B. velezensis EB14 and S. musiva, we identified five cyclic lipopeptides produced by B. velezensis EB14: iturin A1, iturin A2, iturin A9, subtulene A, and fengycin. In addition, B. velezensis EB14 produced four major unidentified compounds in cocultivation with S. musiva. The cyclopeptide production by B. velezensis EB14 was more pronounced (20- to 1,000-fold) in the cocultured plates due to elicitation by S. musiva. We also discovered that the native endophytic B. velezensis EB14 strain exhibited different levels of interactions against the endophytic fungal microbiomes of Populus sp. Overall, our results indicate that B. velezensis EB14 strain as a promising biocontrol agent that could be used against stem canker and leaf spot diseases caused by S. musiva in poplar plantations. [Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Influence of Chrysoporthe deuterocubensis Canker Disease on the Physical and Mechanical Properties of Eucalyptus urograndis

Eucalyptus hybrid has been planted rigorously in wet tropical regions including Malaysia. Recently, there was a report on the occurrence of stem canker on these trees. However, the extent of the infections by this stem canker is unknown. The aim of this study was to evaluate the influence of stem canker disease, Chrysoporthe deuterocubensis, on the physical and mechanical properties of 11-year-old E. urophylla × E. grandis or also known as E. urograndis. The samples were taken from infected and healthy trees that were segregated into different classes based on the severity of the attack, i.e., healthy (class 1), moderately infected (class 2), severely infected (class 3) and very severely infected (class 4). A total of 1440 samples from four infection classes were used in this study. The physical and mechanical properties were determined according to the standard test procedures specified by the International Organization for Standardization (ISO) 13061:2014 (Parts 1 to 4, 13, 14 and 17) and British Standard (BS 373: 1957). From the result, a significant effect by the infection classes was observed on physical and mechanical properties of E. urograndis. All infected wood experienced less shrinkage compared to that of a healthy one, particularly the volumetric (Volsh) and radial shrinkage (Rsh). Wood from class 2 and class 3 was less affected by the infection while the majority of wood from class 4 had significantly lower density and poorer strength. Based on the strength data, wood from infection class 2 can be considered to be used for non-structural applications such as furniture, interior finishing, window frames and doors since reduction in mechanical properties was observed. Wood from class 3 would need further investigation to examine its suitability for structural applications.

Morpho-molecular characterization of causative agents of wilting, leaf spot, fruit blight and stem canker of okra (Abelmoschus esculentus L.)

This study aimed at identification and characterisation of the wilting, leaf spot, stem canker and fruit-blight diseases of okra. Pathogen infected plant samples were sterilised with 2% sodium hychlorite solution for 20 mins and then cultured at 28 °C for 15 days followed by microscopic examination. Combined microscopic, morphological and cultural characteristics analyses identified the four okra fungal isolates (OFI) such as OFI-1, OFI-2, OFI-3 and OFI-4 as Fusarium oxysporum, Curvularia lunata, Fusarium chlamydosporum and Choanephora cucurbitarum, respectively. The isolates OFI-1, OFI-2, OFI-4 showed highest radial growth rates at 25 °C, pH 5 and 20% lactose containing media while it was sucrose for OFI-3. BLASTN search using the sequence of ITS regions revealed that OFI-1, OFI-2, OFI-3 and OFI-4 isolates had 98, 100, 97 and 100% homology with F. oxysporum, C. lunata, F. chlamydosporum and C. cucurbitarum, respectively. Pathogenicity tests were also confirmed by reproducing the disease symptoms in okra plants.

A gene-for-gene interaction involving a 'late' effector contributes to quantitative resistance to the stem canker disease in Brassica napus.

Summary The control of stem canker disease of Brassica napus (rapeseed), caused by the fungus Leptosphaeria maculans is based largely on plant genetic resistance: single‐gene specific resistance (Rlm genes) or quantitative, polygenic, adult‐stage resistance. Our working hypothesis was that quantitative resistance partly obeys the gene‐for‐gene model, with resistance genes ‘recognizing’ fungal effectors expressed during late systemic colonization.Five LmSTEE (stem‐expressed effector) genes were selected and placed under the control of the AvrLm4‐7 promoter, an effector gene highly expressed at the cotyledon stage of infection, for miniaturized cotyledon inoculation test screening of a gene pool of 204 rapeseed genotypes.We identified a rapeseed genotype, ‘Yudal’, expressing hypersensitive response to LmSTEE98. The LmSTEE98–RlmSTEE98 interaction was further validated by inactivation of the LmSTEE98 gene with a CRISPR‐Cas9 approach. Isolates with mutated versions of LmSTEE98 induced more severe stem symptoms than the wild‐type isolate in ‘Yudal’. This single‐gene resistance was mapped in a 0.6 cM interval of the ‘Darmor_bzh’ × ‘Yudal’ genetic map.One typical gene‐for‐gene interaction contributes partly to quantitative resistance when L. maculans colonizes the stems of rapeseed. With numerous other effectors specific to stem colonization, our study provides a new route for resistance gene discovery, elucidation of quantitative resistance mechanisms and selection for durable resistance.

First Report of Stem Canker of Almond Trees Caused by Fusarium solani in Greece.

Almond (Prunus dulcis) is an important crop for Greece grown on 15.130 ha in 2019. In September 2019, a severe stem canker disease was observed in 6-year-old trees of cv Marta grafted on the rootstock 'F675C14', in a new almond grove of cvs Marta, Soleta, Antonela, Belona and Laurete, in Vlachiana, Heraklion, Crete, Greece. Only cv Marta trees were affected. Diseased trees exhibited cankers on trunks and branches with pale yellow to red-colored gum excreting from cankers, yellowing, leaf fall, twig and branch dieback, bark and wood tissue discoloration. Severely affected trees were killed. A Fusarium-like fungus was consistently isolated from symptomatic wood tissue previously surface-disinfested with 95% ethanol, on acidified potato dextrose agar (APDA). Emerging colonies were transferred to new PDA and the growth rate of the fungus was 7.86 mm/day at 24 °C in the dark. The abundant aerial mycelium was initially white, turning into pale orange in the centre after 7 days of growth on PDA. Microscopic observations revealed hyaline conidiophores measuring 26.74 ± 20.44 μm in length, developing microconidia 5.00 to 9.50 × 2.50 to 4.75 μm (average 6.64 × 3.50 μm) and macroconidia 10.00 to 23.25 × 3.75 to 5.50 μm (average 16.42 × 4.50 μm) in size. DNA from one representative single-spore isolate (code KOUB.AM.VR1) was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA and translation elongation factor 1-alpha (EF 1-a) genes were amplified using the primer pairs ITS1/ITS4 (White et al. 1990) and EF1-F/EF2-R (O'Donnell et al. 1998), respectively. The PCR products were sequenced and deposited in GenBank (accession Nos. MW547397 and MW554492). Based on morphological characteristics (Leslie and Summerell 2006) and a BLAST search with 100.00% and 99.38% identity to published F. solani ITS and EF 1-a sequences in GenBank (KX034335.1, DQ247636.1) the fungus was identified as F. solani. Eight 3-year-old almond trees of cv. Marta were artificially inoculated in March 2020 by making a 6.0-mm-diameter hole into the trunk, inserting a 6-mm-diameter mycelial disc taken from a 10-day-old PDA culture, sealing the hole with cellophane membrane and covering with adhesive paper tape. Another eight trees of the same cultivar were mock-inoculated with sterilized PDA discs and served as controls. Potted trees were kept under ambient conditions. One month post inoculation, yellow gum was evident excreting around the inoculation point in F. solani-treated trees but not in the controls. Seven months post inoculation, longitudinal and transverse sections of inoculated trunks revealed internal and external symptoms similar to those observed under natural infection conditions and F. solani was steadily re-isolated from symptomatic wood tissue and identified by colony morphology. Neither symptoms nor positive isolations were observed in control trunks. Pathogenicity tests were repeated twice. Fusarium solani has been reported as the causal agent of stem canker or wood decay diseases in several woody hosts including bitternut hickory, black walnut, mulberry and pistachio trees (Crespo et al. 2019; Markakis et al. 2017; Park and Juzwik 2012; Tisserat 1987). To the best of our knowledge, this is the first worldwide report of stem canker caused by F. solani on almond tree. This disease could potentially be an increasing problem in almond growing areas and result in severe crop losses. Hence, effective management practices should be investigated and applied.

Pathogenicity of Teratosphaeria species on Eucalyptus grandis and selected hybrids in Uganda

ABSTRACT Teratosphaeria stem canker is one of the most important diseases to have emerged on non-native plantation-grown Eucalyptus trees cultivated globally. The study assessed the pathogenicity of two Teratosphaeria species associated with Teratosphaeria stem canker and the susceptibility of Eucalyptus grandis and six commonly grown Eucalyptus hybrids to these fungal species in Uganda. The inoculation trials indicated that Eucalyptus species and hybrids were susceptible to fungal pathogens used. A comparison of Eucalyptus species and hybrids for each fungal species showed that GC 540 and GC 796/2 are the most susceptible hybrids to T. zuluensis and T. gauchensis respectively while hybrid clone GU 8 had a higher tolerance to both fungal species. GC 540 was also tolerant to T. gauchensis while F2 and GC 550 were tolerant to T. zuluensis. Eucalyptus grandis sourced from Australia (F2) showed a higher tolerance than Eucalyptus grandis from South Africa (F1). The results further revealed that both Teratosphaeria zuluensis and Teratosphaeria gauchensis are pathogenic to Eucalyptus species and hybrids. The generated information indicates that there is an opportunity to sustainably manage Teratosphaeria stem canker disease if tolerant species are grown in areas with high disease impact.

Mutations Found in the Asc1 Gene That Confer Susceptibility to the AAL-Toxin in Ancestral Tomatoes from Peru and Mexico.

Tomato susceptibility/resistance to stem canker disease caused by Alternaria alternata f. sp. lycopersici and its pathogenic factor AAL-toxin is determined by the presence of the Asc1 gene. Several cultivars of commercial tomato (Solanum lycopersicum var. lycopersicum, SLL) are reported to have a mutation in Asc1, resulting in their susceptibility to AAL-toxin. We evaluated 119 ancestral tomato accessions including S. pimpinellifolium (SP), S. lycopersicum var. cerasiforme (SLC) and S. lycopersicum var. lycopersicum “jitomate criollo” (SLJ) for AAL-toxin susceptibility. Three accessions, SP PER018805, SLC PER018894, and SLJ M5-3, were susceptible to AAL-toxin. SLC PER018894 and SLJ M5-3 had a two-nucleotide deletion (nt 854_855del) in Asc1 identical to that found in SLL cv. Aichi-first. Another mutation (nt 931_932insT) that may confer AAL-toxin susceptibility was identified in SP PER018805. In the phylogenetic tree based on the 18 COSII sequences, a clade (S3) is composed of SP, including the AAL-toxin susceptible PER018805, and SLC. AAL-toxin susceptible SLC PER018894 and SLJ M5-3 were in Clade S2 with SLL cultivars. As SLC is thought to be the ancestor of SLL, and SLJ is an intermediate tomato between SLC and SLL, Asc1s with/without the mutation seem to have been inherited throughout the history of tomato domestication and breeding.

New specific quantitative real‐time PCR assays shed light on the epidemiology of two species of the Leptosphaeria maculans–Leptosphaeria biglobosa species complex

AbstractPhoma stem canker, a highly damaging disease of oilseed rape (Brassica napus), is caused by fungi of the Leptosphaeria maculans/Leptosphaeria biglobosa species complex. On B. napus, at least in Europe, L. maculans ‘brassicae’ (LMB) and L. biglobosa ‘brassicae’ (LBB) are often found together, in the same fields. The biology and epidemiology of LMB have been intensively studied, but few studies have investigated the infection and colonization processes of LBB, and unanswered questions remain concerning the relative contributions of these two species to phoma stem canker disease. We addressed this question by developing two species‐specific robust quantitative PCR (qPCR) assays, one for each species, for detecting and quantifying these species in field samples of oilseed rape. The assays were highly specific, reproducible, and sensitive. We used them to obtain an overview of stem canker epidemiology in a two‐year field study of a B. napus genotype susceptible to LMB, and a near‐isogenic line harbouring Rlm11, a gene conferring effective resistance to LMB. Inoculum pressure differed considerably between the two years of the experiment, and we found that LMB leaf spotting intensity at limited observation time points was insufficient for predicting final disease severity. We also found that LBB was more prevalent than previously thought, with epidemiological and colonization biology characteristics very similar to those of LMB, but a necrotrophic lifestyle. The general presence of these two species together on leaves and in the stem tissues of the same individual plant raises questions about their relative incidence and biological interactions within plant tissues.

Molecular Characterization and Disease Control of Stem Canker on Royal Poinciana (Delonix regia) Caused by Neoscytalidium dimidiatum in the United Arab Emirates.

In the United Arab Emirates (UAE), royal poinciana (Delonix regia) trees suffer from stem canker disease. Symptoms of stem canker can be characterized by branch and leaf dryness, bark lesions, discoloration of xylem tissues, longitudinal wood necrosis and extensive gumming. General dieback signs were also observed leading to complete defoliation of leaves and ultimately death of trees in advanced stages. The fungus, Neoscytalidium dimidiatum DSM 109897, was consistently recovered from diseased royal poinciana tissues; this was confirmed by the molecular, structural and morphological studies. Phylogenetic analyses of the translation elongation factor 1-a (TEF1-α) of N. dimidiatum from the UAE with reference specimens of Botryosphaeriaceae family validated the identity of the pathogen. To manage the disease, the chemical fungicides, Protifert®, Cidely® Top and Amistrar® Top, significantly inhibited mycelial growth and reduced conidial numbers of N. dimidiatum in laboratory and greenhouse experiments. The described “apple bioassay” is an innovative approach that can be useful when performing fungicide treatment studies. Under field conditions, Cidely® Top proved to be the most effective fungicide against N. dimidiatum among all tested treatments. Our data suggest that the causal agent of stem canker disease on royal poinciana in the UAE is N. dimidiatum.

Stem Canker on Cyclocarya paliurus Is Caused by Botryosphaeria dothidea.

Cyclocarya paliurus, an important endangered plant in China, has considerable medicinal, timber, and horticultural value. However, little is known about diseases that affect its health. In recent years, stem canker diseases on C. paliurus have been observed frequently in newly established nurseries in Jiangsu Province, China. Symptomatic trees showed elliptical, sunken lesions on the bark, with internal discoloration, leading to enlarging cankers with delineated margins. Pathogenicity tests with fungi isolated from symptomatic samples reproduced typical canker symptoms on both detached branches and potted plants of C. paliurus. Moreover, conidia from pycnidia of isolate ZB-23 could also cause stem canker on C. paliurus. Through combined morphological observation and DNA sequences of ITS region, β-tubulin, and translation elongation factor 1-α genes, the pathogen was identified as Botryosphaeria dothidea. Multigene maximum likelihood and maximum parsimony phylogenetic analyses further supported the identification of the pathogen. To our knowledge, this is the first report of B. dothidea causing stem canker on C. paliurus in China.

Cryphonectriaceae on Myrtales in China: phylogeny, host range, and pathogenicity.

Plantation-grown Eucalyptus (Myrtaceae) and other trees residing in the Myrtales have been widely planted in southern China. These fungal pathogens include species of Cryphonectriaceae that are well-known to cause stem and branch canker disease on Myrtales trees. During recent disease surveys in southern China, sporocarps with typical characteristics of Cryphonectriaceae were observed on the surfaces of cankers on the stems and branches of Myrtales trees. In this study, a total of 164 Cryphonectriaceae isolates were identified based on comparisons of DNA sequences of the partial conserved nuclear large subunit (LSU) ribosomal DNA, internal transcribed spacer (ITS) regions including the 5.8S gene of the ribosomal DNA operon, two regions of the β-tubulin (tub2/tub1) gene, and the translation elongation factor 1-alpha (tef1) gene region, as well as their morphological characteristics. The results showed that eight species reside in four genera of Cryphonectriaceae occurring on the genera Eucalyptus, Melastoma (Melastomataceae), Psidium (Myrtaceae), Syzygium (Myrtaceae), and Terminalia (Combretaceae) in Myrtales. These fungal species include Chrysoporthe deuterocubensis, Celoporthe syzygii, Cel. eucalypti, Cel. guangdongensis, Cel. cerciana, a new genus and two new species, as well as one new species of Aurifilum. These new taxa are hereby described as Parvosmorbus gen. nov., Par. eucalypti sp. nov., Par. guangdongensis sp. nov., and Aurifilum terminali sp. nov. Pathogenicity tests showed that the eight species of Cryphonectriaceae are pathogenic to two Eucalyptus hybrid seedlings, Melastoma sanguineum branches, and Psidium guajava and Syzygium jambos seedlings. The overall data showed that Chr. deuterocubensis is the most aggressive, followed by Par. eucalypti. Significant differences in tolerance were observed between the two tested Eucalyptus hybrid genotypes, suggesting that disease-tolerant genotypes can be selected for disease management in the Eucalyptus industry.

Population Genomic Analyses Reveal Connectivity via Human-Mediated Transport across Populus Plantations in North America and an Undescribed Subpopulation of Sphaerulina musiva.

Domestication of plant species has affected the evolutionary dynamics of plant pathogens in agriculture and forestry. A model system for studying the consequences of plant domestication on the evolution of an emergent plant disease is the fungal pathogen Sphaerulina musiva. This ascomycete causes leaf spot and stem canker disease of Populus spp. and their hybrids. A population genomics approach was used to determine the degree of population structure and evidence for selection on the North American population of S. musiva. In total, 122 samples of the fungus were genotyped identifying 120,016 single-nucleotide polymorphisms after quality filtering. In North America, S. musiva has low to moderate degrees of differentiation among locations. Three main genetic clusters were detected: southeastern United States, midwestern United States and Canada, and a new British Columbia cluster (BC2). Population genomics suggest that BC2 is a novel genetic cluster from central British Columbia, clearly differentiated from previously reported S. musiva from coastal British Columbia, and the product of a single migration event. Phenotypic measurements from greenhouse experiments indicate lower aggressiveness of BC2 on Populus trichocarpa. In summary, S. musiva has geographic structure across broad regions indicative of gene flow among clusters. The interconnectedness of the North American S. musiva populations across large geographic distances further supports the hypothesis of anthropogenic-facilitated transport of the pathogen.

First Report of Seedling Stem Canker Disease of Acacia melanoxylon Caused by Pseudolagarobasidium acaciicola in China

First Report of Seedling Stem Canker Disease of <i>Acacia melanoxylon</i> Caused by <i>Pseudolagarobasidium acaciicola</i> in China

Kanker Batang: Penyakit Baru pada Kopi di Lampung

Stem Canker: A New Disease of coffee in LampungStem cancer is a new disease that has attacked smallholder coffee plantations in Lampung since 2010. The cause of the disease was unknown. This study aims to describe the symptoms of the disease, the incidence of the disease in the affected plantation, and identify morphologically and molecularly the canker pathogens of the coffee stem canker diseases. All stages of Koch’s postulate were carried out in laboratories and greenhouses. The isolated pathogens were morphologically characterized by colony shape and color as well as the conidia shape and size. Molecular identification was carried out by using a general primer (ITS1 and ITS4) and followed by sequencing. The main symptoms of the disease are stem cancer and dieback, as well as more infecting older plants. Pathogen of the coffee stem canker disease that attacks coffee plants in Lampung has been identified as Fusarium solani which has 99% homology with F. solani KY245947.1.