Spanish Isolates Research Articles

Analysis of genetic diversity in Monilinia fructicola from the Ebro Valley in Spain using ISSR and RAPD markers

The genetic diversity of Spanish and French field populations of Monilinia fructicola, a quarantine fungal pathogen in Europe, was compared with that of Californian, Uruguayan, and New Zealand M. fructicola populations using inter simple sequence repeat (ISSR) and random amplified polymorphic DNA (RAPD) markers. Unweighted pair-group method with arithmetic average (UPGMA) cluster analysis and principal component analysis (PCA) of the ISSR data set revealed that the Spanish and French M. fructicola isolates were more closely related between themselves than to the non-European isolates. The levels of genetic diversity in the Spanish and French isolates are lower than those of the non-European isolates, indicating that M. fructicola is a recently introduced pathogen. UPGMA cluster analysis and PCA of the combined ISSR + RAPD data set of the European M. fructicola populations revealed that the Spanish isolates were more closely related among themselves than with the French isolates. Analysis of molecular variance partitioned the genetic variance to among the two regions (Spain and France) (20%), among the regional populations (35%), and within the populations in each region (45%) suggesting restricted gene flow between the three European populations. The observed index of association (IA) in each European M. fructicola populations indicates that the French and Spanish populations of M. fructicola are mainly asexually reproducing, with the Sudanell population potentially having a teleomorphic stage. The present finding of low genetic diversity in the Spanish and French M. fructicola populations is probably due to founder effects and genetic drift.

Recovery rates of bluetongue virus serotypes 1, 2, 4 and 8 Spanish strains from orally infected Culicoides imicola in South Africa

Bluetongue (BT) is an infectious disease of ruminants that has spread northwards in Europe during the last decade. The aetiological agent of the disease is an arbovirus [bluetongue virus (BTV)] that belongs to the genus Orbivirus (family Reoviridae). The virus is transmitted by certain species of biting midge within the genus Culicoides (Diptera: Ceratopogonidae). Information on the vector status of the Culicoides species in a specific area will be essential to predict the risk for BTV incursion. Field-collected Culicoides (Avaritia) imicola Kieffer from South Africa were fed on blood containing several Spanish isolates of BTV. Despite the high virus concentrations in the bloodmeal (5.1-6.4 log(10) TCID(50) /mL of blood), virus was recovered from <1% of midges assayed after incubation. Virus concentrations >2.5 log(10) TCID(50) /midge in individual infected C. imicola suggest virus replication with possible risk for transmission to susceptible vertebrate hosts in the field for at least two of the serotypes assayed (BTV-1 and BTV-2). A third serotype (BTV-4) was very close to the estimated threshold for transmission. The relatively low to near refractory status of C. imicola compared with other vector species such as Culicoides bolitinos supports previous results, indicating that Culicoides species other than C. imicola may play a more important role in the epidemiology of BTV.

Origin and Epidemiological History of HIV-1 CRF14_BG

BackgroundCRF14_BG isolates, originally found in Spain, are characterized by CXCR4 tropism and rapid disease progression. This study aimed to identify the origin of CRF14_BG and reconstruct its epidemiological history based on new isolates from Portugal.Methodology/Principal FindingsC2V3C3 env gene sequences were obtained from 62 samples collected in 1993–1998 from Portuguese HIV-1 patients. Full-length genomic sequences were obtained from three patients. Viral subtypes, diversity, divergence rate and positive selection were investigated by phylogenetic analysis. The molecular structure of the genomes was determined by bootscanning. A relaxed molecular clock model was used to date the origin of CRF14_BG. Geno2pheno was used to predict viral tropism. Subtype B was the most prevalent subtype (45 sequences; 73%) followed by CRF14_BG (8; 13%), G (4; 6%), F1 (2; 3%), C (2; 3%) and CRF02_AG (1; 2%). Three CRF14_BG sequences were derived from 1993 samples. Near full-length genomic sequences were strongly related to the CRF14_BG isolates from Spain. Genetic diversity of the Portuguese isolates was significantly higher than the Spanish isolates (0.044 vs 0.014, P<0.0001). The mean date of origin of the CRF14_BG cluster was estimated to be 1992 (range, 1989 and 1996) based on the subtype G genomic region and 1989 (range, 1984–1993) based on the subtype B genomic region. Most CRF14_BG strains (78.9%) were predicted to be CXCR4. Finally, up to five amino acids were under selective pressure in subtype B V3 loop whereas only one was found in the CRF14_BG cluster.ConclusionsCRF14_BG emerged in Portugal in the early 1990 s soon after the beginning of the HIV-1 epidemics, spread to Spain in late 1990 s as a consequence of IVDUs migration and then to the rest of Europe. CXCR4 tropism is a general characteristic of this CRF that may have been selected for by escape from neutralizing antibody response.

Pyrosequencing analysis of the beta-tubulin gene in Spanish Teladorsagia circumcincta field isolates

Benzimidazole (BZ) resistance in gastrointestinal nematodes has been associated with single nucleotide polymorphisms (SNPs) at codons 200, 167 and 198 in the beta-tubulin isotype 1 gene and, recently, these SNPs have also been found in macrocyclic lactone (ML) resistant strains of Haemonchus contortus. On this basis, we have studied the same putative SNPs in Spanish Teladorsagia circumcincta field isolates by pyrosequencing. Single L3 (infective 3rd stage larvae) from five sheep flocks were tested after confirming their BZ susceptibility and degree of ivermectin (IVM) resistance. According to the Faecal Egg Count Reduction Test (FECRT) one flock was classified as IVM susceptible, another one was resistant, and the rest had a suspicion of resistance to IVM. DNA extraction was carried out on 598 single L3 and 56% of these were identified as T. circumcincta after the amplification of a species-specific ITS2 fragment. The number of L3 analyzed for the SNPs 198/200 was 255 and for the SNP 167 was 187. Results clearly indicate no resistance-associated SNPs were present at any codon, before or after treatment. Therefore, all T. cicumcincta L3 were designated as susceptible homozygous genotypes for all SNPs. The absence of the mutations in these populations would argue against resistance haplotypes being present in the parasite population prior to drug treatment, at least in Spanish T. circumcincta.

Multiple-disease resistance in Vicia faba: Multi-environment field testing for identification of combined resistance to rust and chocolate spot

The aim of this work was to identify Vicia faba germplasm resistant both to rust and chocolate spot. A collection of 43 accessions of V. faba previously identified as chocolate-spot resistant was evaluated for rust and chocolate spot resistance in Egypt and in Spain. The genotype and genotype × environment (GGE) biplot analyses allowed the selection of 11 accessions resistant to both diseases in those locations. These 11 accessions were evaluated for rust in an additional field trial in Spain, all performing better than the susceptible check. The joint analysis of the 11 accessions in the four field trials where they had been evaluated revealed no significant effects either for genotype, environment or the genotype × environment interaction. They are hence promising sources of resistance, both for their low severities and their stable responses across the studied environments. This collection was also tested under controlled conditions against the Egyptian and the Spanish isolates of rust present in the field trials further underlining the stable performance of these genotypes. Finally, the effect of previous infection with chocolate spot on rust resistance was assessed under controlled conditions and no influence of it was found.

Genetic diversity, sensitivity to phenylamide fungicides and aggressiveness of Phytophthora ramorum on Camellia, Rhododendron and Viburnum plants in Spain

Phytophthora ramorum has been detected in official plant health surveys on Rhododendron, Viburnum and Camellia in ornamental nurseries in northern Spain since 2003. A collection of 94 isolates of P. ramorum was obtained from 2003 to 2008 from plants with symptoms at different geographical locations. Isolates were identified based on morphology and sequence of the rDNA ITS region. Mating type, genetic variation, sensitivity to phenylamide fungicides and aggressiveness of these isolates were determined. All isolates belonged to the A1 mating type, ruling out the possibility of genetic recombination. Seven microsatellite markers were used to study genetic diversity; three out of the seven microsatellite markers were polymorphic within the Spanish population of P. ramorum. This study confirms that all Spanish isolates of P. ramorum belonged to the EU1 lineage. Twelve intralineage genotypes were detected, five that are unique to Spain (EU1MG38, EU1MG41, EU1MG37, EU1MG39 and EU1MG40) and seven that are also present in at least one other European country (EU1MG1, EU1MG29, EU1MG22, EU1MG13, EU1MG2, EU1MG18 and EU1MG26). Genotypes EU1MG37, EU1MG39 and EU1MG40 were isolated from Rhododendron from one region; EU1MG38 and EU1MG41 were isolated from Camellia from two different regions. Isolates of genotype EU1MG38 were resistant to metalaxyl and mefenoxam. The level of genetic diversity within the Spanish population of P. ramorum is limited and indicates a relatively recent clonal expansion.

European 1: A globally important clonal complex of Mycobacterium bovis

We have identified a globally important clonal complex of Mycobacterium bovis by deletion analysis of over one thousand strains from over 30 countries. We initially show that over 99% of the strains of M. bovis, the cause of bovine tuberculosis, isolated from cattle in the Republic of Ireland and the UK are closely related and are members of a single clonal complex marked by the deletion of chromosomal region RDEu1 and we named this clonal complex European 1 (Eu1). Eu1 strains were present at less than 14% of French, Portuguese and Spanish isolates of M. bovis but are rare in other mainland European countries and Iran. However, strains of the Eu1 clonal complex were found at high frequency in former trading partners of the UK (USA, South Africa, New Zealand, Australia and Canada). The Americas, with the exception of Brazil, are dominated by the Eu1 clonal complex which was at high frequency in Argentina, Chile, Ecuador and Mexico as well as North America. Eu1 was rare or absent in the African countries surveyed except South Africa. A small sample of strains from Taiwan were non-Eu1 but, surprisingly, isolates from Korea and Kazakhstan were members of the Eu1 clonal complex. The simplest explanation for much of the current distribution of the Eu1 clonal complex is that it was spread in infected cattle, such as Herefords, from the UK to former trading partners, although there is evidence of secondary dispersion since. This is the first identification of a globally dispersed clonal complex M. bovis and indicates that much of the current global distribution of this important veterinary pathogen has resulted from relatively recent International trade in cattle.

Genetic analyses place most Spanish isolates of Beauveria bassiana in a molecular group with word-wide distribution

BackgroundThe entomopathogenic anamorphic fungus Beauveria bassiana is currently used as a biocontrol agent (BCA) of insects. Fifty-seven Beauveria bassiana isolates -53 from Spain- were characterized, integrating group I intron insertion patterns at the 3'-end of the nuclear large subunit ribosomal gene (LSU rDNA) and elongation factor 1-alpha (EF1-α) phylogenetic information, in order to assess the genetic structure and diversity of this Spanish collection of B. bassiana.ResultsGroup I intron genotype analysis was based on the four highly conserved insertion sites of the LSU (Ec2653, Ec2449, Ec2066, Ec1921). Of the 16 possible combinations/genotypes, only four were detected, two of which were predominant, containing 44 and 9 members out of 57 isolates, respectively. Interestingly, the members of the latter two genotypes showed unique differences in their growth temperatures. In follow, EF1-α phylogeny served to classify most of the strains in the B. bassiana s.s. (sensu stricto) group and separate them into 5 molecular subgroups, all of which contained a group I intron belonging to the IC1 subtype at the Ec1921 position. A number of parameters such as thermal growth or origin (host, geographic location and climatic conditions) were also examined but in general no association could be found.ConclusionMost Spanish B. bassiana isolates (77.2%) are grouped into a major phylogenetic subgroup with word-wide distribution. However, high phylogenetic diversity was also detected among Spanish isolates from close geographic zones with low climatic variation. In general, no correlation was observed between the molecular distribution and geographic origin or climatic characteristics where the Spanish B. bassiana isolates were sampled.

Complete nucleotide sequence of a Spanish isolate of alfalfa mosaic virus: evidence for additional genetic variability

Alfalfa mosaic virus (AMV) is a plant virus that is distributed worldwide and can induce necrosis and/or yellow mosaic on a large variety of plant species, including commercially important crops. It is the only virus of the genus Alfamovirus in the family Bromoviridae. AMV isolates can be clustered into two genetic groups that correlate with their geographic origin. Here, we report for the first time the complete nucleotide sequence of a Spanish isolate of AMV found infecting Cape honeysuckle (Tecoma capensis) and named Tec-1. The tripartite genome of Tec-1 is composed of 3643 nucleotides (nt) for RNA1, 2594 nt for RNA2 and 2037 nt for RNA3. Comparative sequence analysis of the coat protein gene revealed that the isolate Tec-1 is distantly related to subgroup I of AMV and more closely related to subgroup II, although forming a distinct phylogenetic clade. Therefore, we propose to split subgroup II of AMV into two subgroups, namely IIA, comprising isolates previously included in subgroup II, and IIB, including the novel Spanish isolate Tec-1.

Frequency of voriconazole resistance in vitro among Spanish clinical isolates of Candida spp. According to breakpoints established by the Antifungal Subcommittee of the European Committee on Antimicrobial Susceptibility Testing.

A total of 4,226 Spanish clinical isolates of Candida spp. were analyzed to assess resistance to voriconazole according to breakpoints established by the European Committee for Antimicrobial Susceptibility Testing (where susceptibility [S] to voriconazole corresponds to a MIC of ≤ 0.12 mg/liter). Resistance was uncommon among Candida albicans (5%), C. parapsilosis (1.2%), and C. tropicalis (11%) isolates. Voriconazole MICs of >0.12 mg/liter were more frequent among Candida glabrata and C. krusei isolates. A significant percentage of voriconazole-resistant strains came from oropharyngeal infections and exhibited high MICs of other azoles.

In vitro invasion efficiency and intracellular proliferation rate comprise virulence-related phenotypic traits of Neospora caninum

In this study, we examined the in vitro invasion and proliferation capacities of the Nc-Liv and ten Spanish Neospora caninum isolates (Nc-Spain 1 H - Nc-Spain 10). The invasion rate was determined as the number of tachyzoites that completed their internalisation into MARC-145 cells at 2, 4, and 6 h post-inoculation (pi). The proliferation rate was evaluated by determining the doubling time during the exponential proliferation period. Significant differences in the invasion rates of these isolates were detected at 2 and 4 h pi (P < 0.0001, Kruskal-Wallis test). At 4 h pi, the Nc-Spain 4 H and Nc-Liv isolates displayed the highest, while the Nc-Spain 3 H and Nc-Spain 1 H isolates had the lowest invasion rates (by Dunn's test). Variations in the proliferation kinetics of these isolates were also observed. Between different isolates, the lag phase, which occurs before the exponential growth phase, ranged from 8 to 44 h, and the doubling time ranged from 9.8 to 14.1 h (P = 0.0016, ANOVA test). Tachyzoite yield, which combines invasion and proliferation data, was also assessed and confirmed marked differences between the highly and less prolific isolates. Interestingly, a direct correlation between the invasion rates and tachyzoite yields, and the severity of the disease that was exhibited by infected pregnant mice in previous works could be established for the isolates in this study (Spearman's coefficient > 0.62, P < 0.05). The results of this study may help us to explain the differences in the pathogenicity that are displayed by different isolates.

New isolates of Citrus tristeza virus naturally occurring in old lemon and mandarin trees in Greece

Citrus tristeza virus (CTV) has quarantine status in Greece. The virus was first reported in 2000 in non-certified sweet orange trees grafted on CTV-tolerant Carrizo citrange originating from Spain (Dimou et al., 2002). High homology of these isolates was then found with the Spanish mild T385 isolate (bio-group 1, Garnsey et al., 2005) from sweet orange grafted on sour orange rootstock, sharing 100% nucleotide sequence identity for the p20 gene (Varveri, 2006). In 2009, surveys were conducted in the area of Poros (Trizinia, Prefecture of Pireaus), where about 20,000 citrus trees grow, mainly lemon. (This was an area previously devoted to citrus cultivation for more than 100 years but now consisting virtually of a wood protected only for its beauty and historical importance). A total of 285 citrus trees, 87% of which were lemon, were tested by ELISA (Enzyme-Linked Immunosorbent Assay) in a programme lasting until September 2010. Six trees (four lemons and two mandarins) were found positive. None of the above mentioned trees showed any symptoms. All ELISA positive samples were confirmed with reverse transcription-polymerase chain reaction (RT-PCR). Two sets of primers targeting the p20 protein (PM48 CGAGCTTACTTTAGTGTTA and PM49 TAATGTCAAACTGACCGC) (Sambade et al., 2002) and the coat protein (cp) genes (CTV1 ATGGACGACGAAACAAAGAA and CTV10 ATCAACGTGTGTTGAATTTCC) (Nolasco et al., 2002) were used. PCR products were purified using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany) and subjected to bidirectional direct sequencing (Macrogen, Inc., Seoul, Korea). Partial sequences of the p20 (483 bp) and cp (617-632 bp) genes of two lemon (L192GR, L594GR) and one mandarin (M8GR) CTV isolates were obtained and deposited in GenBank with the Accession Numbers recorded in Table 1. Sequence comparisons of the cp gene nucleotide sequences (HQ270181, HQ270182, and HQ270183) revealed a 99% identity with CTV isolates from Brazil (I141-62, I141-59), Cyprus (CY96-18, CY93-10, CY89-507) and Portugal (28C) (Table 1), belonging to the 3b genotype group of CTV isolates (Nolasco et al., 2009). Nucleotide sequences of the p20 gene (HQ270180, HQ270185, and HQ270186) showed a 99% identity with a seedling yellows (SY) isolate from Brazil (Galego 50) belonging to bio-group 3 of CTV isolates (Garnsey et al., 2005). Further phylogenetic analysis involving standard, fully sequenced and well characterized natural CTV isolates showed that the newly recovered isolates share a common ancestor with the VT seedling yellows (bio-group 4) isolate from Israel, which reveals a totally different topology in the obtained phylogenetic trees from the mild CTV isolates recovered in 2000-2001 in the country (data not shown). The immunological reaction with the MCA13 monoclonal antibody confirmed the occurrence of a virus strain more virulent than the one thus far recorded in orange groves in Greece. Natural isolation of the “lemonwood” in Poros from hills and the sea has apparently hindered the spread of these isolates in sweet orange trees further on in the same region, which however represents a threat for the local citrus industry. Surveys are being continued intensively in Poros aiming at eradicating CTV. Our findings confirm previous conclusions on the diversity of CTV isolates in the Mediterranean basin reflecting the worldwide virus diversity.

Evidence of a Louse-Borne Outbreak Involving Typhus in Douai, 1710-1712 during the War of Spanish Succession

BackgroundThe new field of paleomicrobiology allows past outbreaks to be identified by testing dental pulp of human remains with PCR.MethodsWe identified a mass grave in Douai, France dating from the early XVIIIth century. This city was besieged during the European war of Spanish succession. We tested dental pulp from 1192 teeth (including 40 from Douai) by quantitative PCR (qPCR) for R. prowazekii and B. quintana. We also used ultra-sensitive suicide PCR to detect R. prowazekii and genotyped positive samples.Results and DiscussionIn the Douai remains, we identified one case of B. quintana infection (by qPCR) and R. prowazekii (by suicide PCR) in 6/21 individuals (29%). The R. prowazekii was genotype B, a genotype previously found in a Spanish isolate obtained in the first part of the XXth century.ConclusionLouse-borne outbreaks were raging during the XVIIIth century; our results support the hypothesis that typhus was imported into Europe by Spanish soldiers from America.

Short communication. First detection of Israeli Acute Paralysis Virus (IAPV) in Spanish honeybees

Spanish bee samples were analyzed for the presence of Israel Acute Paralysis Virus (IAPV). Some of these samples were collected from colonies presenting compatible symptoms with the colony collapse disorder (CCD, 240 out of 484) and the rest were asymptomatic. Only one of these samples was diagnosed as positive to IAPV by employing a one step RT-PCR that targets the ORF 2 of the IAPV genome. Specificity of the RT-PCR assay was evaluated by sequence analysis of size specific amplification products. IAPV nucleotide sequences already published in GeneBank were used to construct a phylogenetic tree that included the new Spanish IAPV sequence (FJ821506). They segregated in two main lineages and the Spanish isolate was mainly related with the American ones. As IAPV was detected in Spain in a very low frequency, no causal relation between IAPV and CCD in Spain was found.

Enhancement of clover growth by inoculation of P-solubilizing fungi and arbuscular mycorrhizal fungi

This study evaluated the synergism between several P-solubilizing fungi isolates and arbuscular mycorrhizal fungi to improve clover ( Trifolium pratense) growth in the presence of Araxá apatite. Clover was sown directly in plastic pots with 300g of sterilized washed sand, vermiculite and sepiolite 1:1:1 (v:v:v) as substrate, and grown in a controlled environment chamber. The substrate was fertilized with 3 g L(-1) of Araxá apatite. A completely randomized design, in 8×2 factorial scheme (eight P-solubilizing fungi treatments with or without arbuscular mycorrhizal fungi)and four replicates were used. The P-solubilizing fungi treatments consisted of five Brazilian P-solubilizing fungi isolates (PSF 7, 9, 20, 21 and 22), two Spanish isolates ( Aspergillus niger and the yeast Yarowia lipolytica) and control (non-inoculated treatment). The greatest clover growth rate was recorded when Aspergillus niger and PSF 21 were co-inoculated with arbuscular mycorrhizal fungi. Aspergillus niger, PSF 7 and PSF 21 were the most effective isolates on increasing clover growth in the presence of arbuscular mycorrhizal fungi. Greater mycorrhizal colonization resulted in greater clover growth rate in most PSF treatments. PSF 7 was the best isolate to improve the establishment of mycorrhizal and rhizobia symbiosis.

Spanish population of Gremmeniella abietina is genetically unique but related to type A in Europe

Genetic structure of the European Gremmeniella abietina var. abietina was analyzed in this study. Ninety-two Spanish isolates, six Swiss isolates of Alpine biotype, 76 Finnish isolates of biotype A and 54 Finnish and seven Russian isolates of biotype B were collected. Genetic variation of different populations was analyzed using sequence analysis of specifically amplified markers GAAA1000, GAAA800 and ACA900. Variation in the GAAA1000 marker was significant, and composed of 33 alleles divided into the following four studied populations: five alleles in the Alpine type, 12 in biotype B, 16 in biotype A and two in the Spanish population. Based on variation in GAAA1000 marker, a subset of isolates were further analyzed using GAAA800 and ACA900 sequences, which showed lower overall genetic variability, and no variation among the Spanish population. Genetic differentiation analysis revealed a high genetic differentiation among populations. Finally, clustering analysis of GAAA1000 sequences showed that the Spanish isolates clearly separated from the rest of the biotypes, whereas the Alpine type was closely related to the B type. However, one of the A-type isolates had an identical GAAA1000 allele with the prevailing allele among Spanish isolates. Altogether, our data suggest that the Spanish population is genetically highly differentiated from any other G. abietina population in Europe with a probable A-type origin.

Molecular variability of Spanish and Hungarian isolates of Tomato torrado virus

The population structure and genetic variation of Tomato torrado virus (ToTV) were estimated from 19 Spanish isolates collected from 2001 to 2009 in different tomato‐production areas by analyses of the partial nucleotide sequences of five regions of the virus genome: the protease cofactor (Pro‐Co) and the RNA‐dependent RNA polymerase (RdRp) in RNA1, and the movement protein (MP) and two subunits of the coat protein (CP; viz. Vp35 and Vp23) in RNA2. Three Hungarian isolates of the virus were also included in the analyses. All the ToTV isolates clustered together in the phylogenetic analysis of the nucleotide sequences of the different regions. However, some genetic diversity was observed in the case of the two CP subunits among the Gran Canaria isolates and the remaining ToTV‐isolates analysed, which grouped together. A high similarity was observed among all the isolates and the two published ToTV isolates: the ToTV type isolate (PRI‐ToTV0301) and the Polish isolate Wal03. The most variable encoding regions studied were those on RNA2. In general, no correlation was found between genetic diversity and collection date. Studying the genetic distances between pairs of sequences, the ratio between nonsynonymous (amino‐acid‐replacing) and synonymous (silent mutational) substitutions was low, indicating a strong negative selective pressure in the studied regions. Nine negatively selected sites (distributed in Pro‐Co, MP, Vp23 and Vp35) and just one positively selected one (in Pro‐Co) were found for all the genome regions studied.

Phylogenetic analysis of a virulent Borrelia species isolated from patients with relapsing fever.

Multilocus sequence analysis (MLSA) was used to clarify the taxonomic status of a virulent Borrelia organism previously isolated from patients with relapsing fever and from ticks in Spain that is designated the Spanish relapsing fever (SRF) Borrelia. This species has been used extensively in experimental infection models because of its continued virulence. Seven genes were amplified to analyze the phylogenetic relationships among several Spanish isolates of SRF Borrelia and other relapsing fever Borrelia species. The genes targeted in this study included rrs and flaB, which have commonly been used in phylogenetic studies; the rrf-rrl intergenic spacer (IGS), which is highly discriminatory; and four additional genes, p66, groEL, glpQ, and recC, which are located on the chromosome and which have therefore evolved in a clonal way. The species included in this study were Borrelia duttonii, B. recurrentis, B. crocidurae, and B. hispanica as Old World Borrelia species and B. turicatae and B. hermsii as New World Borrelia species. The results obtained by MLSA of the SRF Borrelia on the basis of 1% of the genomic sequence data analyzed confirmed that the SRF Borrelia isolates are B. hispanica. However, the prototype isolates of B. hispanica used in this study have an uncertain history and display unique phenotypic characteristics that are not shared with the SRF Borrelia. Therefore, we propose to use strain SP1, isolated from a relapsing fever patient in 1994 in southern Spain, as the type strain for B. hispanica.

The First Report of Hepatozoon Species Infection in Leopard Cats (Prionailurus bengalensis) in Korea

Hepatozoon species infections were detected in 4 of 5 heart samples from leopard cats (Prionailurus bengalensis) in Korea examined by light microscopy and PCR. Microscopically, the schizonts of the Hepatozoon species were observed within the parasitophorous vacuoles of unidentified host cells that were located between myocytes. The schizonts were approximately 31 +/- 4 x 19 +/- 3 microm in size; 3 mature schizonts contained approximately 24, 25, and 35 merozoites. In analyses of the partial 18S rRNA gene sequence, the Hepatozoon species infecting the Korean leopard cats was closely related to Brazilian (99.2-99.8% identical) and Spanish (97.0-98.2% identical) isolates of Hepatozoon felis.

First Report of Apricot latent virus and Plum bark necrosis stem pitting-associated virus in Apricot from Spain.

Representing 2% of world production, 20,000 ha of apricot (Prunus armeniaca L.), are cultivated in Spain, primarily in the southeast. A survey was conducted during the spring of 2008 in orchards in the region of Murcia to assess the incidence of several stone fruit viruses. Leaf and fruit samples from 160 trees from 40 orchards were collected randomly for reverse transcription (RT)-PCR analysis. Total RNA extracted (3) from leaves and fruits was tested by a multiplex one-step RT-PCR protocol with a mix of primers that detect eight distinct viruses (4). Amplicons of 250 bp expected for Plum bark necrosis stem pitting-associated virus (PBNSPaV), corresponding to part of the heat shock 70 protein gene, were obtained from four trees and amplicons of 700 bp expected for Apricot latent virus (ApLV), corresponding to part of the coat protein (CP) gene, were obtained from two trees. In all cases, amplicons were obtained using RNA extracted from leaf and fruit tissues. RT-PCR results were confirmed by uniplex RT-PCR with primers specific for each virus and dot-blot hybridization with virus-specific digoxygenin-labeled RNA probes (2). To further characterize the new viruses, we designed primers to amplify specifically the CP gene of ApLV (5'-CCCGACCATGGCTACAAGC-3' and 5'-TTGCCGTCCCGATTAGGTTG-3') and the minor CP gene of PBNSPaV (5'-GAACAAACTACAGCAGCACC-3' and 5'-CAAGGGTAGGACGGGTAACGC-3'). Amplicons of 1,500 and 950 bp corresponding to the ApLV and PBNSPaV CP genes, respectively, were purified from agarose gels and cloned in the pTZ57R plasmid (Fermentas, Burlington, Ontario, Canada). Blastp analysis of the full-length ApLV CP sequence from one infected tree (GenBank Accession No. GQ919051) revealed 86% amino acid (aa) similarity to the single full-length ApLV CP sequence available (No. AAC16234) and 79 and 66.9% similarity to Peach sooty ringspot virus (No. AAG48314) and Apple stem pitting virus (No. NP604468), respectively. Identity/similarity analysis of the full-length PBNSPaV minor CP genes using the Matrix Global Alignment Tool software, version 2.02 (1), revealed 98.8 to 99.6% aa similarity between the Spanish PBNSPaV isolates (Nos. GQ919047, GQ919048, GQ919049, and GQ919050) and 97.1 to 97.4% with the PBNSPaV isolate from the United States (No. EF546442). None of the six infected trees were associated with any particular field symptoms. Five infected trees were cv. Búlida and one was native cv. Murciana, which was infected with ApLV. All infected trees were located in geographically separated orchards. The incidence of ApLV and PBNSPaV was 1.25 and 2.5%, respectively. The low incidence of both viruses together with the scattered geographic distribution could be due to the recent introduction of virus-contaminated plants, although we cannot exclude that it is a consequence of a low dissemination rate. Even though no symptoms were observed, we cannot discard that the infection could affect fruit production or flowering or even cause a synergistic effect in mixed infection with other stone fruit viruses, a risk especially relevant considering the total area of cultivated apricot. To our knowledge, this is the first report of ApLV and PBNSPaV in Spain.