Single-stranded DNA Aptamers Research Articles

Highly Sensitive Detection of Target Biomolecules on Cell Surface Using Gold Nanoparticle Conjugated with Aptamer Probe

A method of gold nanoparticle (Au NP) labeling with backscattered electron (BE) imaging of field emission scanning electron microscopy (FE-SEM) was applied for specific detection of target biomolecules on a cell surface. A single-stranded DNA aptamer, which specifically binds to the target molecule on a human acute lymphoblastic leukemia cell, was conjugated with a 20 nm Au NP and used as a probe to label its target molecule on the cell. The Au NP probe was incubated with the cell, and the interaction was confirmed using BE imaging of FE-SEM through direct counting of the number of Au NPs attached on the target cell surface. Specific Au NP-aptamer probes were observed on a single cell surface and their spatial distributions including submicron-order localizations were also clearly visualized, whereas the nonspecific aptamer probes were not observed on it. The aptamer probe can be potentially dislodged from the cell surface with treatment of nucleases, indicating that Au NP-conjugated aptamer probes can be used as sensitive and reversible probes to label target biomolecules on cells.

Highly Sensitive Detection of Target Biomolecules on Cell Surface Using Gold Nanoparticle Conjugated with Aptamer Probe

A method of gold nanoparticle (Au NP) labeling with backscattered electron (BE) imaging of field emission scanning electron microscopy (FE-SEM) was applied for specific detection of target biomolecules on a cell surface. A single-stranded DNA aptamer, which specifically binds to the target molecule on a human acute lymphoblastic leukemia cell, was conjugated with a 20 nm Au NP and used as a probe to label its target molecule on the cell. The Au NP probe was incubated with the cell, and the interaction was confirmed using BE imaging of FE-SEM through direct counting of the number of Au NPs attached on the target cell surface. Specific Au NP-aptamer probes were observed on a single cell surface and their spatial distributions including submicron-order localizations were also clearly visualized, whereas the nonspecific aptamer probes were not observed on it. The aptamer probe can be potentially dislodged from the cell surface with treatment of nucleases, indicating that Au NP-conjugated aptamer probes can be used as sensitive and reversible probes to label target biomolecules on cells.

Designer Tridentate Mucin 1 Aptamer for Targeted Drug Delivery

A single-stranded DNA aptamer (APT) capable of targeting mucin 1 (MUC1) extracellular protein was modified to increase its drug delivery specificity toward MUC1 overexpressing cancer cell line, MCF7. The active targeting region of APT was truncated and variable repeats (one, two, or three) of this sequence were synthesized. An aptamer formed from three repeats of this active targeting region (L3) was shown to possess enhanced doxorubicin (DOX) intercalation ability, and L3-DOX complex exhibited selective cytotoxicity to MCF7 over RAW cells. Most importantly, L3 was able to evade RAW 264.7 macrophages (2-fold reduction in L3 uptake relative to APT), thus resulting in an overall 5.5-fold increase of survivability of RAW cells as compared with when free DOX was used. These results indicate that aptamer L3 has good potential for targeted drug therapeutics.

Antibiotic resistance in bacteria: Structure of a novel ss‐DNA metalloenzyme inhibitor

β‐Lactam antibiotics are among the most important drugs used to fight bacterial infection. Overuse and misuse of β‐lactam antibiotics has caused the evolution of resistance mechanisms, allowing pathogenic bacteria to survive antibiotic treatment. The major source of resistance to β‐lactam antibiotics occurs through production of enzymes called β‐lactamases capable of catalyzing hydrolysis of the β‐lactam rings in these drug compounds. The metallo‐β‐lactamases have become a major threat due to their broad substrate specificities; there are no clinically useful inhibitors for these metalloenzymes. Previously, we reported the discovery of a 10‐residue single‐stranded DNA (ss‐DNA) aptamer that is a potent inhibitor of the B. cereus 5/B/6 metallo‐β‐lactamase [S.‐K. Kim, C. L. Sims, S. E. Wozniak, S. H. Drude, D. Whitson and R. W. Shaw, Chemical Biology and Drug Design, 74, 343–348 (2009)]. The ss‐DNA may have a stem‐loop type of secondary structure. We are utilizing molecular mechanics and molecular dynamics calculations to attempt to predict the solution structure of this 10‐residue ss‐DNA aptamer. Furthermore, we have successfully crystallized this aptamer and have shown that the crystals can diffract to 2.5 Å resolution, or better. (TTU‐OTC)

A highly sensitive aptasensor towards Plasmodium lactate dehydrogenase for the diagnosis of malaria

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (Kd=16.8–49.6nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

Harnessing aptamers for electrochemical detection of endotoxin

Lipopolysaccharide (LPS), also known as endotoxin, triggers a fatal septic shock; therefore, fast and accurate detection of LPS from a complex milieu is of primary importance. Several LPS affinity binders have been reported so far but few of them have proved their efficacy in developing electrochemical sensors capable of selectively detecting LPS from crude biological liquors. In this study, we identified 10 different single-stranded DNA aptamers showing specific affinity to LPS with dissociation constants (Kd) in the nanomolar range using a NECEEM-based non-SELEX method. Based on the sequence and secondary structure analysis of the LPS binding aptamers, an aptamer exhibiting the highest affinity to LPS (i.e., B2) was selected to construct an impedance biosensor on a gold surface. The developed electrochemical aptasensor showed excellent sensitivity and specificity in the linear detection range from 0.01 to 1ng/mL of LPS with significantly reduced detection time compared with the traditional Limulus amoebocyte lysate (LAL) assay.

Selection of DNA aptamers that bind to four organophosphorus pesticides

Single-stranded DNA (ssDNA) aptamers against four organophosphorus pesticides (phorate, profenofos, isocarbophos and omethoate) were simultaneously isolated from an immobilized random ssDNA library by systematic evolution of ligands by exponential enrichment (SELEX) technique. After 12 rounds of in vitro selection, five ssDNA aptamer candidates were selected and their binding affinities were identified by a novel method using a molecular beacon. Two of the five ssDNA sequences, SS2-55 and SS4-54, demonstrated higher affinities and specificities to the four organophosphorus pesticides. They were defined as broad-spectrum aptamers binding to four different targets and their simulated secondary structures showed highly distinct features with typical stem and loop structures. The dissociation constant of SS2-55 and SS4-54 binding to the four organophosphorus pesticides ranged from 0.8 to 2.5μM. These aptamers offered application potential in the analysis and/or neutralization of the residues of the four organophosphorus pesticides.

Aptasensor for ampicillin using gold nanoparticle based dual fluorescence–colorimetric methods

A gold nanoparticle based dual fluorescence-colorimetric method was developed as an aptasensor to detect ampicillin using its single-stranded DNA (ssDNA) aptamer, which was discovered by a magnetic bead-based SELEX technique. The selected aptamers, AMP4 (5'-CACGGCATGGTGGGCGTCGTG-3'), AMP17 (5'-GCGGGCGGTTGTATAGCGG-3'), and AMP18 (5'-TTAGTTGGGGTTCAGTTGG-3'), were confirmed to have high sensitivity and specificity to ampicillin (K(d), AMP7 = 9.4 nM, AMP17 = 13.4 nM, and AMP18 = 9.8 nM, respectively). The 5'-fluorescein amidite (FAM)-modified aptamer was used as a dual probe for observing fluorescence differences and color changes simultaneously. The lower limits of detection for this dual method were a 2 ng/mL by fluorescence and a 10 ng/mL by colorimetry for ampicillin in the milk as well as in distilled water. Because these detection limits were below the maximum residue limit of ampicillin, this aptasensor was sensitive enough to detect antibiotics in food products, such as milk and animal tissues. In addition, this dual aptasensor will be a more accurate method for antibiotics in food products as it concurrently uses two detection methods: fluorescence and colorimetry.

A coordination polymer nanobelt (CPNB)-based aptasensor for sulfadimethoxine

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5′-GAGGGCAACGAGTGTTTATAGA-3′), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO3 and 4,4′-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

Broad-spectrum aptamer inhibitors of HIV reverse transcriptase closely mimic natural substrates

A detailed understanding of how aptamers recognize biological binding partners is of considerable importance in the development of oligonucleotide therapeutics. For antiviral nucleic acid aptamers, current models predict a correlation between broad-spectrum inhibition of viral proteins and suppression of emerging viral resistance, but there is little understanding of how aptamer structures contribute to recognition specificity. We previously established that two independent single-stranded DNA aptamers, R1T and RT1t49(−5), are potent inhibitors of reverse transcriptases (RTs) from diverse branches of the primate lentiviral family, including HIV-1, HIV-2 and SIV(cpz). In contrast, class 1 RNA pseudoknots, such as aptamer T1.1, are specific for RTs from only a few viral clades. Here, we map the binding interfaces of complexes formed between RT and aptamers R1T, RT1t49(−5) and T1.1, using mass spectrometry-based protein footprinting of RT and hydroxyl radical footprinting of the aptamers. These complementary methods reveal that the broad-spectrum aptamers make contacts throughout the primer-template binding cleft of RT. The double-stranded stems of these aptamers closely mimic natural substrates near the RNase H domain, while their binding within the polymerase domain significantly differs from RT substrates. These results inform our perspective on how sustained, broad-spectrum inhibition of RT can be achieved by aptamers.

Biofunctionalized Zinc Oxide Field Effect Transistors for Selective Sensing of Riboflavin with Current Modulation

Zinc oxide field effect transistors (ZnO-FET), covalently functionalized with single stranded DNA aptamers, provide a highly selective platform for label-free small molecule sensing. The nanostructured surface morphology of ZnO provides high sensitivity and room temperature deposition allows for a wide array of substrate types. Herein we demonstrate the selective detection of riboflavin down to the pM level in aqueous solution using the negative electrical current response of the ZnO-FET by covalently attaching a riboflavin binding aptamer to the surface. The response of the biofunctionalized ZnO-FET was tuned by attaching a redox tag (ferrocene) to the 3′ terminus of the aptamer, resulting in positive current modulation upon exposure to riboflavin down to pM levels.

Aptamer selection for the detection ofEscherichia coliK88

In this study, the first group of single-stranded DNA aptamers that are highly specific to enterotoxigenic Escherichia coli (ETEC) K88 was obtained from an enriched oligonucleotide pool by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) procedure, during which the K88 fimbriae protein was used as the target and bovine serum albumin as counter targets. These aptamers were applied successfully in the detection of ETEC K88. They were then grouped under different families based on the similarity of their secondary structure and the homology of their primary sequence. Four sequences from different families were deliberately chosen for further characterization by fluorescence analysis. Having the advantage of high sensitivity, fluorescence photometry was selected as single-stranded DNA quantification method during the SELEX process. Aptamers with the highest specificity and affinity were analyzed to evaluate binding ability with E. coli. Since ETEC K88 is the only type of bacterium that expressed abundant K88 fimbriae, the selected aptamers against the K88 fimbriae protein were able to specifically identify ETEC K88 among other bacteria. This method of detecting ETEC K88 by aptamers can also be applied to bacteria other than ETEC K88.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants ( K d [kanamycin] = 78.8 nM, K d [kanamycin B] = 84.5 nM, and K d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Dissection of the Functional Structure of Aptamer17, Which Specifically Recognizes Differentiated PC12 Cells

A specific single-stranded DNA (ssDNA) aptamer (aptamer17) that specifically recognizes differentiated PC12 cells had been previously obtained after 6 rounds of whole cell-based subtractive systematic evolution of ligands by exponential enrichment selection from a random ssDNA library. To further investigate the relationship between the structure and function of this aptamer, 3 truncated ssDNA aptamers were designed according to the predicted secondary structure of aptamer17. Our results show that the stem-loop is the core structure of the aptamers required for specific binding to differentiated PC12 cells, specifically loops I and II. Aptamer17 and the truncated aptamers with this basic structure could bind specifically to differentiated PC12 cells and identify these cells from a mixture of differentiated and undifferentiated PC12 cells. Therefore, truncated forms of aptamer17 may be useful in the clinic to identify undifferentiated and differentiated PC12 cells from a mixture of cells.

A primer-free method that selects high-affinity single-stranded DNA aptamers using thermostable RNA ligase

This article describes a method for selecting single-stranded DNA (ssDNA) molecules that bind with high-affinity aptamers to specific target proteins. This SELEX (systematic evolution of ligands by exponential enrichment) method is similar to other “primer-free” approaches where the random sequence ssDNA starting pool has no fixed sequences at the 5′ and 3′ termini. Therefore, there are no predetermined sequences that could bias selection. Like other SELEX methods, repeated cycles (typically 5–15) of selection and then amplification and reselection are used. The method differs from other primer-free approaches in that the key step for regenerating new material for subsequent rounds is ligation of the selected ssDNA to a defined sequence oligonucleotide using thermostable RNA ligase. Under specific conditions, this ligase ligated 30-nt random sequence ssDNA (5′-N 30-3′) to a specified 20-nt ssDNA with approximately 50% efficiency. Efficiency was improved to approximately 90% by the addition of a single T residue to the 3′ end (5′-N 29T-3′). High efficiency in this step is critical, especially early in the procedure because any selected material that is not ligated is lost. In this study, human immunodeficiency virus reverse transcriptase was used as the target protein, but the method could be applied to essentially any protein.

A Simple and Sensitive Resonance Scattering Spectral Assay for Detection of Melamine Using Aptamer-Modified Nanosilver Probe

Nanosilver of 10-nm size was prepared by the NaBH4–sodium citrate procedure, and it was modified by a single-strand DNA (ssDNA) aptamer to fabricate an AgssDNA probe for melamine. The probe was stabile at pH 7.0 Na2HPO4–NaH2PO4 buffer solutions and in the presence of 25.0 mmol/L NaCl. Upon the addition of melamine, it interacted with the probe to aggregate big clusters, which led to the resonance scattering (RS) intensity at 470 nm increasing greatly. Under the selected conditions, the increased RS intensity (ΔI 470 nm) is linear to melamine concentration in the range of 6.31–378.4 μg/L, with a regression equation of $$ \Delta {I_{{47}0{\rm{ nm}}}} = {1}.{124}c + { 10}.{8} $$ and a detection limit of 3.1 μg/L. The aptamer-modified nanosilver RS assay has been applied for the determination of melamine in milk, with satisfactory results.

Selection and verification of ssDNA aptamers of mutant p53 protein by SELEX technique in vitro

Objective To set up a method to obtain single-stranded DNA aptamers of mutant p53 protein in vitro by SELEX technique and lay a foundation of application of these aptamers to carcinoma in early diagnosis and targeted therapy. Methods The initial length of 75 bp random single-stranded DNA library was constructedin vitro, both ends had a fixed sequence and there were 35 nucleotides in the middle of random sequence, with capacities of about 1×1017-1×1018. By means of cyanogen bromide (CNBr)activated agarose beads as screening medium, the ssDNA aptamers of mutant p53 protein were selected by SELEX technique. The aptamers were cloned and sequenced, and DNAMAN package was employed to analyze the conserved equences and the second structure of the aptamers. The affinity of aptamers to mutant p53 protein was determined by chromatic biotin-streptavidin-horseradish peroxides system. Results Through screening aptamers round by round, the affinity of aptamers to mutant p53 protein was increased gradually(the A450 values were increased from 0.1357 to 0.6818) and the affinity of aptamers at the round 8 was the highest, and then maintained at the prateau. Twenty out of 23 aptamers had the correct length and fixed sequence after cloning and sequencing. The DNAMAN5.29 sofeware analysis revealed that, the identity of 20 clones was 76. 51% without common conserved sequence and the second structure of the aptamers was stem-loop-based and bulge-based. Conclusion After selection of 8 rounds, the ssDNA aptamers we obtained had high specificity and affinity to mutant p53 protein in vitro and didn't have common conserved sequence. Stem-loops and bulge were the basis of aptamers binding to mutant p53 protein. Key words: Aptamers; p53 protein; SELEX technique

A G‐Quadruplex Aptamer Inhibits the Phosphatase Activity of Oncogenic Protein Shp2 in vitro

Shp2 is a member of the protein tyrosine phosphatase (PTP) family, which regulates a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Using a recombinant Shp2-GST protein as the target and GST as a counter target, we have identified two classes of single-stranded DNA aptamers that selectively bind to Shp2 with a K(d) in the nanomolar range. Structural studies of the most abundant sequence in the enriched library, HJ24, revealed a parallel G-quadruplex as the core binding domain. Furthermore, this aptamer was found to be an effective inhibitor of Shp2 phosphatase, an effect which was readily reversed by using the cDNA of HJ24. In view of these characteristics, this aptamer has the potential to be used for further development of Shp2 assays and therapeutics for the treatment of Shp2-dependent cancers and other diseases.

Intracellular delivery of RNA-based therapeutics using aptamers.

The clinical potential of siRNAs for silencing genes critical to disease progression is clear, but a fail-proof method for delivering siRNAs to the cytoplasm of diseased tissues or cells has yet to be identified. A variety of delivery approaches have been explored to directly or indirectly couple siRNAs to delivery vehicles. This review explores the use of synthetic single-stranded DNA and RNA aptamers as a means to deliver siRNAs, shRNAs and antisense oligonucleotides for therapeutic intervention. Topics covered include: the advantages and challenges of using aptamers as delivery tools; current aptamer-mediated siRNA delivery platforms for the treatment of cancer and HIV; and emerging methodologies for the identification of aptamers capable of internalizing into target cell types.

Highly sensitive determination of recombinant human erythropoietin-α in aptamer-based affinity probe capillary electrophoresis with laser-induced fluorescence detection

Recombinant human erythropoietin-α (rHuEPO-α) has been widely used in clinic for anemia treatment. The detection and quantification of rHuEPO-α is essential for monitoring this widespread recombinant glycoprotein pharmaceutical. In this paper, we developed a new affinity probe capillary electrophoresis/laser-induced fluorescence (APCE/LIF) method for the detection of rHuEPO-α by using a specific single-stranded DNA aptamer probe for the first time. In this method, the complex of aptamer-rHuEPO-α and the free aptamer can be well separated and identified by their migration and fluorescence intensity after systematic optimization. The existence of sodium cation in the sample buffer and running buffer played a critical role for stabilizing complex and enhancing the separation efficiency, additionally, suitable high voltage and sample buffer additives were also important for improving the peak height of the complex. Under the optimized conditions, the method was successfully applied for the quantification of rHuEPO-α in physiological buffer, artificial urine and human serum. The linear range for rHuEPO-α was from 0.2 to 100 nM and the limit of detection was 0.2 nM (i.e. 7.4 ng/mL). Further binding experiments using fluorescein isothiocyanate-labeled rHuEPO-α (F-rHuEPO-α) and N-deglycosylated F-rHuEPO-α demonstrated that the oligosaccharides moiety was of importance in the specific interaction between rHuEPO-α and its aptamer.