Specific Primer Sets Research Articles

Genetic and Molecular Typing of Canine Parvovirus Strains Circulating in Symptomatic Dogs in Egypt

Canine parvovirus (CPV) is considered one of the serious and problematic diseases in young puppies. It causes hemorrhagic enteritis and myocarditis in affected dogs. The aim of the present study was to detect CPV-2 in feces of clinically diseased puppies by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Egypt as well as studying some factors associated with the disease incidence. Forty fecal samples were collected from clinically suspected dogs with CPV-2. The clinical diagnosis was confirmed in 35 suspected clinical cases (87.5%) by PCR using common and specific primers sets for detection of (CPV-2, CPV-2a, CPV-2b, CPV-2c) validating that presumptive clinical diagnosis is practically dependable. Nucleotide sequencing of parvovirus (CPV-2) isolates showed that all the three antigenic types (2a, 2b, and 2c) are currently circulating in Egypt.

Cloning and Expression of Recombinant Human Insulin Gene in Pichia pastoris

The main goal of the current study was cloning and expression of the human insulin gene in Pichia pastoris expression system, using genetic engineering techniques and its treatment application. Total RNA was purified from fresh normal human pancreatic tissue. RNA of good quality was chosen to obtain a first single strand cDNA. Human preproinsulin gene was amplified from cDNA strand, by using two sets of specific primers contain EcoR1 and Notl restriction sites. The amplified preproinsulin gene fragment was double digested with EcoRI and Not 1 restriction enzymes, then inserted into pPIC9K expression vector. The new pPIC9K-hpi constructive expression vector was transformed by the heat-shock method into the E.coli DH5α competent cells. pPic9k –hpi, which was propagated in the positive transformant E. coli cells, was isolated from cells and then linearised by restriction enzyme SalI, then transformed into Pichia pastoris GS115 using electroporation method. Genomic DNA of His+ transformants cell was extracted and used as a template for PCR analysis. The results showed, that the pPic9k – hpi was successfully integrated into the P. pastoris genome, for selected His+ transformants clones on the anticipated band at 330 bp, which is corresponded to the theoretical molecular size of the human insulin gene. To follow the insulin expression in transformans, Tricine–SDS gel electrophoresis and Western blot analysis were conducted. The results showed a successful expression of recombinant protein was detected by the presence of a single major band with about (5.8 KDa) on the gel. These bands correspond well with the size of human insulin with the theoretical molecular weight (5.8 KDa).

Detection of Nucleic Acids and Prevention of Carryover Contamination Using Cross-Priming Amplification Combined with Nanoparticles-Based Biosensor and Antarctic Thermal Sensitive Uracil-DNA-Glycosylase.

The current study reports on a cross-priming amplification (CPA) scheme that utilizes antarctic thermal sensitive uracilDNA-glycosylase (AUDG) for simultaneous detection of nucleic acids and prevention of carryover contamination. Amplification products were applied in a nanoparticle-based lateral flow biosensor (LFB). The method shows attractive features in that it only requires the use of a labeled primer, eliminating the use of labeled probes. Thus, it is able to remove false-positive results yielded by undesired hybridization between two labeled primers or between a probe and labeled primer. CPA amplification and AUDG cleavage are carried out in a single pot, and the use of a closed-vessel reaction eliminates unwanted results due to carryover contamination. Then, the assay devised in this report was applied to the detection of the hospital-acquired pathogen Klebsiella pneumoniae in pure cultures and artificial sputum samples. This biosensor can detect K. pneumoniae in pure cultures with a 100 fg · μL-1 detection limit, and in artificial sputum samples with a 520 cfu · mL-1 detection limit. The whole procedure, including specimen processing (20-min), CPA amplification (60-min), AUDG digestion (5-min) and result indicating (within 2-min), can be completed within 1.5 h. As a proof-of-concept technique, this method can be used for detecting a wide variety of other targets if the specific CPA primer set is available.

Rapid Detection of Phosphate-Solubilizing Bacteria from Agricultural Areas in Erzurum.

In this study, the newly designed pqq gene-specific primer sets were used for determination of phosphate-solubilizing capabilities of bacterial isolates from the agricultural regions of Erzurum. The specificity of newly designed primer sets (PqqA2F/PqqA2R, Pqq5F/Pqq5R, PqqF2/PqqF2R) were tested against ten isolates, whose phosphate-solubilizing activities were initially proved by the conventional methods. Non-phosphate-solubilizing bacteria were also chosen as negative control. According to the results, five of ten phosphate-solubilizing bacteria with PqqA2F/PqqA2R, two of ten phosphate-solubilizing bacteria with Pqq5F/Pqq5R primer set, and one of ten phosphate solubilizing with PqqF2F/PqqF2R bacteria were successfully amplificated in the PCR assay and none of the non-phosphate-solubilizing bacteria was amplificated. Then, the molecular characterization of the active phosphate-solubilizing strains was done based on the partial 16S ribosomal RNA gene region sequence analysis method. Two isolates of Enterobacter sp., 1 Rhizobium sp., 1 Enterococcus sp., 1 Bacillus cereus, 1 Bacillus atrophaeus, 1 Bacillus aryabhattai, 1 Acinetobacter sp., 1 Pseudomonas japonica, and 1 Enterobacter cloacae were identified as active phosphate-solubilizing strains. Consequently, the results showed that this specific primer sets could be used as an economic, rapid, and useful tool for the detection of phosphate-solubilizing strains in the agricultural researches.

A Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Pectobacterium aroidearum that Causes Soft Rot in Konjac.

Bacterial soft rot caused by Pectobacterium species is a serious disease in konjac (Amorphophallus konjac), a healthy source of starch particularly in East Asia. An effective diagnostic method is crucial to control the disease and reduce losses in konjac production. In this study, we evaluated a loop-mediated isothermal amplification (LAMP) assay with a specific primer set for the rapid and accurate detection of P. aroidearum. A comparative genomics approach was used to identify the specific genes suitable for the design of LAMP primers. The candidate target genes were determined through a first-round comparison with a 50-genome nucleotide database, and subjected to a second-round screening with the GenBank NR database. As a result, nine specific genes of P. aroidearum were selected for LAMP primer design. After screening of the primers, the primer set 1675-1 was chosen for LAMP detection owing to its high specificity and sensitivity. The LAMP assay could detect the presence of P. aroidearum genomic DNA at a concentration as low as 50 fg and 1.2 × 104 CFU/g artificially infected soil within 40 min at 65 °C. Subsequently, this primer set was successfully used to specifically detect P. aroidearum in naturally infected and non-symptomatic plant samples or soil samples from the field. This study indicates that a comparative genomic approach may facilitate the development of highly specific primers for LAMP assays, and a LAMP diagnostic assay with the specific primer set 1675-1 should contribute to the rapid and accurate detection of soft-rot disease in konjac at an early stage.

Prevalence of Giardia intestinalis with other co-infecting parasites in Barak Valley, Assam, India: a molecular approach.

Giardia intestinalis was included in the World Health Organization's Neglected Disease Initiative in 2004 as it may range from asymptomatic to chronic or severe diarrhoea and chronic disorders post-infection. The present study aimed to find out the rate of sole infection of G. intestinalis and co-infection of this with other protozoan parasites among the inhabitants of Barak Valley region of Southern Assam by conventional and molecular detection. A total of 1168 samples were collected from different groups of individuals, all the collected samples were subjected to microscopy after specific staining by Lugol's iodine solution, Trichrome staining and modified ZN staining procedures. Microscopically positive samples were further confirmed by PCR using specific primer sets. Of the total no. of samples, 267 (22.85%) were positive by PCR for G. intestinalis with a little higher rate of infection in female (24.06%) (OR = 1.2192, CI = 0.9262 to 1.6049) than male (21.27%). The rate of infection is comparatively higher (25.93%) in the age group of 0-5years (OR = 1.9149, CI = 1.2558 to 2.9200). In 196 samples G. intestinalis co-existence was observed and detected by PCR with some other protozoan parasites like Entamoeba spp., Cryptosporidium spp. and Blastocystis spp. The rate of infection was higher (31.96%) among the participants who collected water from river. Least of the participants showed diarrhoeal symptoms (18.18%) but majority (28.45%) complained for having abdominal cramps (OR = 1.3402, CI = 0.8815 to 1.7855). Among the human infective assemblages, assemblage specific molecular detection revealed the rate of infection of assemblage B was comparatively higher (60.30%) than assemblage A.

First Report of Apple Stem Grooving Virus Infecting Lotus (Nelumbo nucifera) in China

Lotus (Nelumbo nucifera) is a perennial aquatic plant of the family Nelumbonaceae. Lotus root is one of the most important aquatic food and ornamental crops in China, Japan, India, and other regions. In 2015, we found lotus plants with late germination, early dormancy, decline growth, thin stems, and deep colored, spotted, and striped leaves in Jiangsu province of China. These symptoms seriously affected the quantity and quality of lotus. Several viruses including cucumber mosaic virus (CMV) and dasheen mosaic virus have been reported to infect lotus (Ding et al. 2011; Dong et al. 2017). To identify pathogens associated with lotus samples of cultivar Meirenhong that exhibited yellowing and mosaic symptoms during June to September 2015, bulked leaves of six symptomatic and asymptomatic plants were used for construction of small RNA (sRNA) libraries using Illumina Small RNA version 1.5 Sample Prep Kit. They were sequenced in a single lane on a Genome Analyzer IIx, and the output files were processed with Illumina’s CASAVA pipeline (version 1.8). The reads resulting from sRNA sequencing were processed by removing the adaptor and then assembled de novo into larger contigs using Velvet Software 0.7.31 with a k-mer of 17. BLAST search of the contigs against the GenBank virus reference database revealed the presence of 106 contigs with high similarities of 76.9 to 93.1% with the genomic regions of Apple stem grooving virus (ASGV), a member of the genus Capillovirus of the family Betaflexiviridae. CMV, one novel potyvirus, and badnaviruses were also identified (unpublished). To confirm the presence of ASGV in the plants, total RNA was extracted by TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China). First-strand cDNA was prepared by M-MLV reverse transcription (Invitrogen) using ASGV-specific primers. Two pairs of specific primer sets, ASGVF4641 (TTAGGTGAGAGGCTTTACAC)/ASGVR5784 (TGCAAAGAAGAAGGTAAAGCTC) and ASGVF4791 (CTATCGTCAACGTCAACC)/ASGVR5609 (TTCAATTCTAGCCGAGAG), were designed according to the sequences of contigs obtained in this study and used in nested reverse transcription polymerase chain reaction (RT-PCR), which amplified a 834-bp DNA fragment of the ASGV genome from six lotus plants. A single 834-bp DNA amplicon was randomly selected, purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), and cloned into the pMD19-T vector (TaKaRa). Three clones were sequenced (Genewiz, Suzhou, China), and analysis of the consensus sequence (GenBank accession no. MH507516) revealed the highest nucleotide sequence identity of 83% with a Japanese ASGV isolate (GenBank accession no. D14995) (Yoshikawa et al. 1992) in the movement protein gene. To investigate the occurrence and distribution of ASGV infection, 43 lotus samples (23 with mosaic and yellowing symptoms and 20 without any symptoms) were collected in different regions of the Jiangsu province and tested by the nested RT-PCR and double-antibody sandwich ELISA using an ASGV kit (Qiaodu, Shanghai). Both assays detected the virus in 27 of the 43 plants, indicating the ASGV infection is common in lotus. Among these 27 positive samples, 16 samples had mosaic or yellowing symptoms. To our knowledge, this is the first report of ASGV in lotus in China. This finding suggests that use of virus-free lotus seedlings will benefit the production of lotus in China.

Dynamics of Amoebophrya parasites during recurrent blooms of the ichthyotoxic dinoflagellate Cochlodinium polykrikoides in Korean coastal waters

During the bloom events of the harmful dinoflagellate Cochlodinium polykrikoides in August and October, 2012, infections by two different Amoebophrya species were observed in Korean coastal waters. To investigate the dynamics of the two parasites and their relative impact on the host populations, a quantitative real-time PCR (qPCR) method was applied to detect and quantify the parasites in the free-living and parasitic stages. Each specific primer set of the target species, Amoebophrya sp. 1 and sp. 2 was designed on the large subunit (LSU) and the first internal transcribed spacer (ITS1) of ribosomal RNA (rRNA) gene, respectively. Dynamics of the two Amoebophrya species via qPCR assay showed distinct patterns during the C. polykrikoides bloom events. Amoebophrya sp. 1 showed peaks during both bloom events in August and October with relatively low copies (106 to 107 copies L−1), while Amoebophrya sp. 2 appeared only during the bloom event in October with very high copies (109 to 1010 copies L−1). Overall, the qPCR measurements for the dynamics of two Amoebophrya species in the parasitic stage (> 5 μm fractions) were consistent with parasite prevalence through microscopic observations. Amoebophrya sp. 1 infections were observed during both bloom events in August and October with relatively low parasite prevalence (0.1–1.5%), while Amoebophrya sp. 2 infections were detected only during the bloom event in October with high prevalence (up to 45%). Taken together, Amoebophrya sp. 1 may be a generalist and C. polykrikoides may not be its primary host, while Amoebophrya sp. 2 may be a specialist which can substantially impact host population dynamics.

Seasonal Distribution of Bemisia tabaci (Hemiptera: Aleyrodidae) MEAM1 Species and Impact on Incidence of Begomoviral Diseases in Baja California Sur.

For more than four decades, the presence of the whitefly Bemisia tabaci Gennadius complex as a pest and transmitter of begomoviral diseases has been one of the most important phytopathological events in cultivated species worldwide. In addition, the number of whitefly species, as well as the viruses they transmit, has been increasing over time. In the state of Baja California Sur (BCS), Mexico, the diversity of B. tabaci has been delimited to MEAM1 and NW species, affecting mainly tomato, pepper, and squash. However, the relationship of these species with the dispersion of the begomoviruses previously detected in the study area is still unknown. In a 5-yr study (2012-2016), these species of whiteflies and begomoviruses were identified. Moreover, the recurrence, seasonal distribution, and impact they have on the spread of the begomoviral diseases were assessed. The identification of whiteflies was done targeting the mtCOI by PCR-DNA barcoding assay. For begomoviruses identification, a set of degenerate and specific primers targeting the IR region and CP gene were used. To determine seasonal abundance, monitoring was performed every 15 d by means of yellow traps. The MEAM1 species in all localities was observed with the highest peak population (>10 whiteflies/trap) from March to April. The guidelines for naming begomovirus species for the International Committee on Taxonomy of Viruses (ICTV) establish that the names when they are preceded by the acronym the whole name is in lowercase, not italicized (e.g. bean golden mosaic virus (BGMV)); when the name goes alone without the acronym then its capitalizes the first letter (e.g. Bean golden mosaic virus) and when these are referred to in a taxonomic sense they are italicized and the first letter is capitalized (e.g. Bean golden mosaic virus). This study provides details of the distribution and occurrence of MEAM1 species and diversity of begomoviruses that could be useful in disease management in BCS and worldwide.

Identification of influenza C virus in young South Korean children, from October 2013 to September 2016

BackgroundInfluenza C virus has been largely neglected, compared to influenza A orB viruses, and is not routinely tested in clinical practices. However, several studies have indicated that influenza C virus causes severe acute respiratory illness and pneumonia in all ages. ObjectiveWe conducted a study to identify influenza C virus among young children in South Korea.Study design. From October 2013 to September 2016, 973 young children with influenzalike illness (ILI) were enrolled at three university hospitals. We tested nasopharyngeal samples for 16 types of respiratory viruses. Among the tested samples, 564 were positive for one or more respiratory viruses. Except for the samples where 16 types of respiratory viruses were found, 409 negative samples were examined for the presence of influenza C virus, using a matrix gene specific primer set. ResultsAmong 409 nasopharyngeal samples, five influenza C viruses were detected. The manifestation of influenza C virus infection in young children was observed acute respiratory illness, such as fever, rhinorrhea, and cough, but no pneumonia or severe respiratory illness. Nucleotide sequencing was conducted and a phylogenetic tree was generated. We found that C/Sao Paulo/387/82-like lineage viruses circulated in South Korea, and the fully sequenced virus (C/Seoul/APD462/2015) was closely related to C/Victoria/2/2012 and C/Tokyo/4/2014 strains. ConclusionsThis study was the first report of influenza C virus detection in South Korea. Although severe illness was not observed in this study, we suggest the necessity for influenza C virus testing in pediatric patients with ILI, considering other reports of severe illnesses caused by influenza C virus infections.

A second HD mating type sublocus of Flammulina velutipes is at least di-allelic and active: new primers for identification of HD-a and HD-b subloci.

BackgroundSexual development in Flammulina velutipes is controlled by two different mating type loci (HD and PR). The HD locus contains homeodomain (Hd) genes on two separate HD subloci: HD-a and HD-b. While the functionality of the HD-b sublocus has been largely confirmed, the status and content of the HD-a sublocus has remained unclear.MethodsTo examine the function of the HD-a sublocus, genome sequences of a series of F. velutipes strains were analyzed and tested through series of amplification by specific primer sets. Furthermore, activity of di-allelic HD-a locus was confirmed by crossing strains with different combinations of HD-a and HD-b subloci.ResultsSublocus HD-b contained a large variety of fixed Hd1/Hd2 gene pairs, while the HD-a sublocus either contained a conserved Hd2 gene or, a newly discovered Hd1 gene that was also conserved. Identification of whole HD loci, that is, the contents of HD-a and HD-b subloci in a strain, revealed that strains with similar HD-b subloci could still form normal dikaryons if the two genes at the HD-a sublocus differed. At least di-allelic HD-a sublocus, is thus indicated to be actively involved in mating type compatibility.ConclusionsHD-a sublocus is active and di-allelic. Using the new information on the HD subloci, primers sets were developed that specifically amplify HD-a or HD-b subloci in the majority of F. velutipes strains. In this way, unknown HD mating types of F. velutipes can now be quickly identified, and HD mating type compatibility conferred by HD-a or HD-b can be confirmed by PCR.

Development of an interspecies interaction model: An experiment on Clostridium cadaveris and Clostridium sporogenes under anaerobic condition

The specific primer and probe sets for quantifying Clostridium cadaveris and Clostridium sporogenes using a quantitative real-time PCR were designed. Each primer and probe set detected only the target species very specifically. The two species were cultivated in pure and mixed culture in batch mode with glucose as the only carbon source. The designed QPCR sets were used successfully to estimate the biokinetic parameters of each species in pure culture: i.e., maximum specific growth rate μmax, half saturation concentration Ks, growth yield Y, and decay coefficient Kd. of C. cadaveris and C. sporogenes were 0.311 ± 0.020 and 0.360 ± 0.019 h-1, 4.241 ± 1.653 and 5.171 ± 1.097 g/L, 0.301 ± 0.065 and 0.199 ± 0.037 1011 copies/g, 0.005 ± 0.043 and 0.009 ± 0.025 h-1, respectively. The effect of interspecific interaction of on substrate consumption rate and microbial growth was evaluated using mixed culture; curve fitting and comparison of coefficients detected increase in substrate consumption rate but decrease in microbial growth rate; these results imply interspecific interaction effect. A new model was of the interspecific interaction was developed, with focus on accuracy, realism, simplicity and biological significance. This interspecific interaction model may be extended to more-complex bioprocesses such as biological wastewater treatment systems and anaerobic digestion.

Bioinformatics analysis of aflatoxins produced by Aspregillus sp. in basic consumer grain (corn and rice) in Saudi Arabia

The food contaminants by aflatoxins are inevitable even when all precautions and good agricultural practices are applied. Samples of white rice and corn (yellow, red) grains were collected from different local markets and houses. Three Aspergillus flavus strain isolated were identified using molecular characterization of AFLR (aflR) toxin gene. DNA genome of the three A. flavus isolates (namely A. flavus _ YC; A. flavus _ RC; A. flavus _ Rice) which corresponds to isolates from, yellow corn, red corn and white rice respectively were used as a template for PCR to amplify Aspergillus flavus AFLR (aflR) toxin gene. Partially sequenced was amplified using a specific primer set to confirm its identity, phylogenetic relationships between the three isolates as well as determination of the corresponding antigenic determinants. The epitope prediction analysis demonstrated that there were 1, 2, 3 and 4 epitopes whose score were equal 1 in A. flavus _ YC; A. flavus _ RC; A. flavus _ Rice, respectively. Interestingly, there were great dissimilarity in the epitope sequences among the three isolates except in RLQEGGDDAAGIPA, SPPPPVETQGLGGD, RPSESLPSARSEQG and PAHNTYSTPHAHTQ were found to be similar between all isolates. This work articulates that the molecular identification and characterization of three A. flavus using Aspergillus flavus AFLR (aflR) toxin gene and the unique antigenic determinants that could be used for design of a broad-spectrum antibody for rapid detection of A. flavus in foods and support quality system of food safety.

Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae

In order to establish a rapid detection method for Mycoplasma ovipneumoniae, this study used the loop-mediated isothermal amplification (LAMP) technique to carry out nucleic acid amplification and chromatographic visualization via a lateral flow dipstick (LFD) assay. The M. ovipneumoniae elongation factor TU gene (EF-TU) was detected using a set of specific primers designed for the EF-TU gene, and the EF-TU FIP was detected by biotin labeling, which was used in the LAMP amplification reaction. The digoxin-labeled probe specifically hybridized with LAMP products, which were visually detected by LFD. Here, we established the M. ovipneumoniae LAMP-LFD rapid detection method and tested the specificity, sensitivity, and clinical application of this method. Results showed that the optimized LAMP performed at 60 °C for 60 min, and LFD can specifically and visually detect M. ovipneumoniae with a minimum detectable concentration at 1.0 × 102 CFU/mL. The sensitivity of LAMP-LFD was 1000 times that of the conventional PCR detection methods, and the clinical lung tissue detection rate was 86% of 50 suspected sheep infected with M. ovipneumoniae. In conclusion, LAMP-LFD was established in this study to detect M. ovipneumoniae, a method that was highly specific, sensitive, and easy to operate, and provides a new method for the prevention and diagnosis of M. ovipneumoniae infection.

Rapid and sensitive detection of goose parvovirus and duck-origin novel goose parvovirus by recombinase polymerase amplification combined with a vertical flow visualization strip

Goose parvovirus (GPV) is one of the most serious viral pathogens in goslings. Recently, a new pathogen to the Chinese mainland—duck-origin novel goose parvovirus (N-GPV)—was found to be 90.8–94.6% identical to the nucleotide sequence of GPV, and typically causes growth disorders and high infection rates in meat ducks. The spread of both of these viruses hinders the healthy development of the waterfowl breeding industry. In this study, recombinase polymerase amplification (RPA) was combined with a vertical flow (VF) visualization strip to develop a universal assay for the rapid detection of GPV and N-GPV. A set of specific primers and probes were designed to target the VP3 gene. Detection was possible at a constant temperature of 37 °C within 5–10 min. The assay successfully detected GPV and N-GPV with high-specificity and did not exhibit cross-reactivity with other waterfowl viruses and bacteria. The analytical sensitivity of the GPV-RPA-VF assay was 2 × 102 copies of GPV plasmid. Validation of the GPV-RPA-VF assay—using 60 samples from the field–—confirmed 100% similarity between the results of GPV-RPA-VF and conventional qPCR. The results indicate that the GPV-RPA-VF assay was accurate, sensitive, and specific. This assay can be performed with minimal equipment and training to rapidly detect GPV and N-GPV during the early phase of an outbreak, especially when timely veterinary diagnoses are needed in the field and in rural areas.

Species-specific detection of medically important aspergilli by a loop-mediated isothermal amplification method in chronic pulmonary aspergillosis.

Chronic pulmonary aspergillosis (CPA) is a common subtype of pulmonary aspergillosis and a life-threatening disease. However, its diagnosis remains difficult due to the lack of specific clinical features and radiologic findings, as well as the difficulty of isolating Aspergillus spp. We developed a novel species-specific detection method of medically important aspergilli using a loop-mediated isothermal amplification (LAMP) for CPA. Specific LAMP primer sets for Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus, and Aspergillus nidulans were designed. The use of the LAMP assay was validated using respiratory specimens (CPA cases, n = 21; nonaspergillosis cases, n = 23). A total of 15 cases were positive in the CPA group (A. fumigatus, n = 5; A. flavus, n = 1; A. niger, n = 1; A. terreus, n = 7; A. nidulans, n = 1), but only three in the non-CPA group (A. niger, n = 2; A. terreus n = 1). The sensitivity and specificity of the diagnosis of CPA by the LAMP system were 71.4% and 87.0%, respectively. In conclusion, we developed a species-specific detection approach for five medically important aspergilli using the LAMP method. The system showed high sensitivity and specificity for diagnosis of CPA.

Characterization of Pectobacterium carotovorum subsp. carotovorum isolates from a recent outbreak on cabbage in Bosnia and Herzegovina

The causal agent of soft rot disease associated with a cabbage outbreak in Semberija region, Bosnia and Herzegovina, in 2018 was identified and characterized. Symptoms appeared in the form of water-soaked lesions on leaves and specific odour. Disease incidence ranged from 20% to 30%. The causal pathogen was isolated on nutrient agar (NA), King?s B and crystal violet pectate (CVP) media. Eight creamy-white, round and convex bacterial isolates, which produced characteristic pits on CVP medium were taken as representative. They were gram negative, facultative anaerobe, oxidase negative, catalase positive, nonfluorescent on King?s B medium, levan and arginine dehydrolase negative. The isolates were able to cause soft rot on cabbage and potato tuber slices 24 h after inoculation under conditions of high relative humidity. Polymerase chain reaction (PCR) was performed for preliminary identification by using three specific primer sets: F0145/E2477 (specific for Pectobacterium carotovorum subsp. carotovorum), Br1f/L1r (specific for P. carotovorum subsp. brasiliensis) and ECA1f/ECA2r (specific for P. atrosepticum). All isolates produced the band size of 666 bp with F0145/E2477 primer pair, indicating that they belong to the species P. carotovorum subsp. carotovorum. Further genetic characterization was based on sequence analysis of the gapA and mdh housekeeping genes. BLAST analysis confirmed 99.39% (Q. cover 100%, E. value 0.0) and 100% (Q. cover 100%, E. value 0.0) identity of the isolates with P. carotovorum subsp. carotovorum strains deposited in the NCBI database as M34 (KY047594) for gapA and Pcc t0437 (KC337296) for mdh genes, respectively. Phylogenetic analysis showed genetic homogeneity among the cabbage isolates.

Tropical theileriosis, epidemiology and Molecular diagnosis in cattle in New Valley Province, Egypt

In this study during one year 294 blood samples, collected from cattle showing clinical signs arousing suspicion of theileriosis and apparently healthy neighboring animal (related one) for diagnosis of theileriosis using stained blood film and molecular diagnosis (Semi nested PCR). the result of blood film revealed that 91 out of 294 examined cattle (30.95%) were positive for the piroplasmic form (intra erythrocytic stage) of T. annulate infection, the highest prevalence of infection by theileriosis was (39.50 %) in Summer, and the lowest rate was (13.95 %) in Winter. and the highest prevalence of infection was 39.30 %, in age group1(1day – 6months) and the lowest rate was 21.40%. in group 5 (> 4 Years). The Tbs-S/Tbs-A primer set was used for PCR amplification of Theileria sp. And the Ta-S/Tbs-A specific primer set was used in semi-nested PCR technique for detection of Theileria annulata. The semi-nested PCR accurately revealed (60%) positive samples The results indicated that Giemsa staining method, having 50% sensitivity, is not suitable for determination of Theileria annulata in carrier cattle, while semi-nested PCR technique can be used as a gold standard method for the mentioned aim and also can be used for screening of Theileria annulata carrier cattle in all regions. The phylogenic analysis of DNA of theileriosis revealed two sequences deposited in the GenBank database under accession numbers MK332380 and MK332382.

A Rapid and Reliable Method for Molecular Detection of Fusarium guttiforme, the Etiological Agent of Pineapple Fusariosis

Abstract Pineapple (Ananas comosus var. comosus) fusariosis is an economically important fungal disease affecting the plant and its fruit. A rapid and reliable diagnosis is the base of integrated disease management practices. Fusariosis has resulted in quarantines for pineapple products in Central America, Africa and Asia. Difficulties diagnosing and correctly identifying the fungus Fusarium guttiforme, agent of the pineapple fusariosis, have led to the search for new methodologies, and for this we developed a new reliable molecular method to detect it. For diagnostic purposes, real-time PCR of elongation factor gene 1-α (ef1) was used to rapidly, specifically and sensitively diagnose F. guttiforme. A pathogenicity test was conducted with slips of the pineapple cultivar Perola, a multiplex PCR was run, and the results compared with those obtained with real-time PCR. The real-time PCR assay with its specific primer set could readity distinguish F. guttiforme from other Fusarium species known to occur on pineapple. The real-time PCR test had 95% sensitivity and 100% specificity with a significance level p<0.0001. For field samples the test had 100% sensitivity and specificity. Thus, this new test is fit for use in serial analyses of pineapples, and may have application in the evaluation of propagation materials and making quarantine decisions. The ability to rapidly and specifically detect F. guttiforme in plant samples will facilitate monitoring of the pathogen and improve disease management.

PCR Detection Method for Rapid Diagnosis of Bacterial Canker Caused by Clavibacter michiganensis on Tomato

Bacterial canker caused by Clavibacter michiganensis is considered to be one of the most serious diseases, leading to economic damage to tomato worldwide. Diagnosis of the bacterial canker on tomato is known to be difficult because the causal pathogen is slow-growing on artificial media as well as causes latent infection in tomato. In this study, as a less time-consuming method, a specific primer set was newly designed for rapid detection of C. michiganensis. The method presented here is so simple, easy, and fast that it can be useful and practical in direct detection of the bacterial canker pathogen from tomato plants.