First Report of Apple Stem Grooving Virus Infecting Lotus (Nelumbo nucifera) in China

Abstract

Lotus (Nelumbo nucifera) is a perennial aquatic plant of the family Nelumbonaceae. Lotus root is one of the most important aquatic food and ornamental crops in China, Japan, India, and other regions. In 2015, we found lotus plants with late germination, early dormancy, decline growth, thin stems, and deep colored, spotted, and striped leaves in Jiangsu province of China. These symptoms seriously affected the quantity and quality of lotus. Several viruses including cucumber mosaic virus (CMV) and dasheen mosaic virus have been reported to infect lotus (Ding et al. 2011; Dong et al. 2017). To identify pathogens associated with lotus samples of cultivar Meirenhong that exhibited yellowing and mosaic symptoms during June to September 2015, bulked leaves of six symptomatic and asymptomatic plants were used for construction of small RNA (sRNA) libraries using Illumina Small RNA version 1.5 Sample Prep Kit. They were sequenced in a single lane on a Genome Analyzer IIx, and the output files were processed with Illumina’s CASAVA pipeline (version 1.8). The reads resulting from sRNA sequencing were processed by removing the adaptor and then assembled de novo into larger contigs using Velvet Software 0.7.31 with a k-mer of 17. BLAST search of the contigs against the GenBank virus reference database revealed the presence of 106 contigs with high similarities of 76.9 to 93.1% with the genomic regions of Apple stem grooving virus (ASGV), a member of the genus Capillovirus of the family Betaflexiviridae. CMV, one novel potyvirus, and badnaviruses were also identified (unpublished). To confirm the presence of ASGV in the plants, total RNA was extracted by TaKaRa MiniBEST Plant RNA Extraction Kit (TaKaRa, Dalian, China). First-strand cDNA was prepared by M-MLV reverse transcription (Invitrogen) using ASGV-specific primers. Two pairs of specific primer sets, ASGVF4641 (TTAGGTGAGAGGCTTTACAC)/ASGVR5784 (TGCAAAGAAGAAGGTAAAGCTC) and ASGVF4791 (CTATCGTCAACGTCAACC)/ASGVR5609 (TTCAATTCTAGCCGAGAG), were designed according to the sequences of contigs obtained in this study and used in nested reverse transcription polymerase chain reaction (RT-PCR), which amplified a 834-bp DNA fragment of the ASGV genome from six lotus plants. A single 834-bp DNA amplicon was randomly selected, purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China), and cloned into the pMD19-T vector (TaKaRa). Three clones were sequenced (Genewiz, Suzhou, China), and analysis of the consensus sequence (GenBank accession no. MH507516) revealed the highest nucleotide sequence identity of 83% with a Japanese ASGV isolate (GenBank accession no. D14995) (Yoshikawa et al. 1992) in the movement protein gene. To investigate the occurrence and distribution of ASGV infection, 43 lotus samples (23 with mosaic and yellowing symptoms and 20 without any symptoms) were collected in different regions of the Jiangsu province and tested by the nested RT-PCR and double-antibody sandwich ELISA using an ASGV kit (Qiaodu, Shanghai). Both assays detected the virus in 27 of the 43 plants, indicating the ASGV infection is common in lotus. Among these 27 positive samples, 16 samples had mosaic or yellowing symptoms. To our knowledge, this is the first report of ASGV in lotus in China. This finding suggests that use of virus-free lotus seedlings will benefit the production of lotus in China.