Second-stage Juveniles Research Articles

First Report of Meloidogyne enterolobii Infecting Mesona chinensis in China.

Mesona chinensis Benth is a perennial herb of edible and medicinal value. It is commonly used to cure heatstroke and fever, and treat diseases including diabetes, hypertension, and acute nephritis in modern medicine (Li et al. 2020). In May 2020, M. chinensis plants presented reduced growth and leaf wilting associated with root galls at agricultural base of Guangxi University (22°50'28.41″ N, 108°17'9.00″ E), China. Digging up the roots of the M. chinensis plants revealed lots of root knots. Eggs and second-stage juveniles (689 ± 28) of Meloidogyne spp. were collected in per gram fresh weight roots. Population densities of the J2s averaged 386 ±16 per 100 cm3 soil. The female perineal pattern is usually oval shaped with the dorsal arch being moderately high to high and often rounded. The J2s are truncate with head region rounded and body slender. Tails are narrow with pointed tips, and distinct hyaline tail termini. The morphological measurements (mean, standard deviation and range) of the females (n=10) measurements were: body length = 689.7 ± 11.5 μm; width = 549.3 ± 42.9 μm; stylet length = 15.1 ± 1.0 μm; dorsal esophageal gland orifice (DGO) = 5.4 ± 0.5 μm. The males (n=12) measurements were: body length = 1,341.0 ± 96.2 μm; width =38.6 ± 4.2 μm; DGO = 4.4 ± 0.1 μm. The J2 (n=20) were: body length = 436.1 ± 12.5 μm; body width = 15.7 ± 0.8 μm; stylet length = 12.4 ± 0.8 μm; DGO = 3.8 ± 0.3 μm. Individual J2 (n=4) DNA was further explored by using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Vrain et al. 1992; Powers and Harris 1993; Nadler et al. 1999). Three fragments 765 bp (GenBank accession no. OL663830), 705 bp (OL780766), and 759 bp (OL681885) were amplified, are 100% sequence homology with M. enterolobii (MT406251, MN269947, MT193450), respectively. Species-specific primers Me-F/Me-R were used for amplification of rDNA-IGS2. An expected PCR fragment of approximately 236 bp was obtained, but not presented in M. incognita populations (Long et al. 2006). Therefore, the unknown nematode was further identified as M.enterolobii. To perform Koch's postulates, M. enterolobii from M. chinensis roots were inoculated onto tomato plants for propagation and eggs were extracted from tomato roots. Greenhouse tests were conducted after inoculating 0 or 5,000 eggs into M. chinensis one-month-old healthy cuttings grown in pots filled with sterilized substrates. After 60 days, the inoculated plants (n=12) exhibited galled root symptoms and the noninoculated ones (n=10) exhibited no galls. A reproduction factor of 13.2 ± 3.3 was obtained, confirming the pathogenicity of M. enterolobii on M.chinesis. To our knowledge, this is the first report of a natural infection of M. enterolobii on M.chinensis. It is likely that M. enterolobii may be causing a high level of loss on M. chinensis in southern China.

First Report of Meloidogyne javanica on Globe Artichoke in Florida, U.S.A.

Globe artichoke (Cynara cardunculus var. scolymus L.) is native to the Mediterranean region and cultivated worldwide for its edible flower buds and the medicinal value of its leaves (Pignone and Sonnante 2004). In 2019, artichokes were planted on 29 km2 predominantly in California, with a yield of over 100 million kg (USDA 2020). It has been grown as a specialty crop in Florida since 2017 (Agehara 2017a). Meloidogyne spp. (root-knot nematodes/RKNs) can lead to yield losses to artichoke (Greco et al. 2005). In June 2020, artichokes (cv. Imperial Star) with stunting, wilting, and galled-root symptoms were observed in a research field with sandy soil located at the University of Florida Gulf Coast Research and Education Center (UF/GCREC), Wimauma, Florida. The goal of this report was to identify the RKN species collected from two symptomatic artichoke roots. Morphological measurements (mean, standard deviation and range) of 15 second-stage juveniles (J2s) included body length = 409.1 ± 31.6 (360.3 - 471.3) µm, body width = 15.4 ± 1.6 (12.4 - 18.8) µm, and stylet length = 14.7 ± 0.7 (13.9 -16.1) µm. Perineal patterns of five matured females had a high dorsal arch and double lateral lines. Morphological characteristics of the RKN cultures were consistent with the description of M. javanica (Eisenback and Triantaphyllou 1991). DNA was extracted respectively from two RKN females isolated from the diseased artichoke roots. The nematode species was confirmed with primers Fjav/Rjav and resulted in ≈ 670 bp fragment (Zijlstra et al. 2000). The COXII region of mtDNA was amplified by C2F3/1108 (Powers and Harris 1993), and the sequencing results were submitted to the NCBI with GeneBank Accession No. MZ397905. The molecular sequences had 100% identity with M. javanica in COXII (MK033440 and MK033439). The pathogenicity test was conducted in the greenhouse at UF/GCREC from May to August 2021 (temperature = 26.7 ± 4.1°C, relative humidity = 83.9 ± 14.6 %). Each of the ten 6.5-in-diameter plastic pots containing 3.8-L pasteurized soil was seeded with one artichoke seed. Five pots were inoculated with 5000 eggs of the field RKN cultures 4-week after planting, and five pots served as the untreated control. Two months after inoculation, galled symptoms were only observed in inoculated plants with an average gall index (Bridge and Page 1980) of 6.2 ± 2.2; 99,240 ± 72,250 eggs were extracted from each root system, and the nematode reproduction factor was 19.9 ± 14.4. Meloidogyne spp. has been reported on artichoke in Europe, Asia, and South America (Greco et al. 2005). This is the first report of RKN on artichoke in the United States. Meloidogyne javanica caused severe root gall symptoms and visible aboveground damage in the form of chlorosis, stunting, and wilting of artichoke planted at the UF/GCREC research farm. Meloidogyne javanica is the predominant RKN species at the UF/GCREC research farm and one of the most common RKNs in Florida (Gu and Desaeger 2021). Artichoke is a new crop in Florida, and RKNs is likely to be one of the main soilborne problems for its production in the state. Its long growing season (October - May) (Agehara 2017b) allows for high nematode reproduction rates. Several new growers have already reported RKN as a problem in their fields. For artichoke to become a commodity in Florida, managing RKNs will be critical. This report provides new information on the risk that RKNs pose to artichoke, a newly established specialty crop in Florida.

In vitro compatibility of Brassicaceae extracts with nematophagous fungi and their effects against Nacobbus celatus.

Nacobbus celatus sp. n. is one of the main root-knot nematodes in the field destined for horticultural production of the central region of Argentine due to its ability to infect several host plants. The lack of new and safe active ingredients against this nematode has restricted control alternatives for growers. Egg-parasitic fungi and biofumigation with brassicaceae have been considered as potential candidates for the development of bionematicides. Nematicidal effects of Brassica oleracea var. italica (broccoli) and Brassica oleracea var. capitata (cabbage) aqueous extracts (AEs) against second-stage juveniles (J2) of N. celatus were evaluated in vitro. Fisher LSD tests evidenced significant nematicidal (α = 0.05) effects of the two AEs tested, with LD100 of 250 and 500 μLmL-1 for broccoli and cabbage, respectively. Compatibility assays between AEs and five nematophagous fungi were performed on soil extract medium conditioned at 0.99 water activity and incubated at 30, 25 and 20°C. Purpureocillium lilacinum SR14 was the fungal strain that showed compatibility at levels of spore viability, growth rate and conidia productions at LD50 (125 μL mL-1) and LD25 (60 μL mL-1) of broccoli aqueous extract (BAE) and enhanced the nematophagous effect. Moreover, phytotoxic studies revealed that 125 μL mL-1 of BAE applied at the transplantation time could be safely used without affecting tomato culture. In conclusion, the integrated application of BAE with P. lilacinum SR14, which combines two action mechanisms, represents a promising integrated strategy to management phytoparasitic nematodes.

Crude Aqueous Root Extracts of Solanum spp. Show Nematotoxic Activity Against Meloidogyne incognita

Brazilian crops are strongly affected by the root-knot nematode Meloidogyne incognita, which compromises food production and causes serious economic losses around the world. Synthetic nematicides are still some of the main control strategies for this pathogen, despite the high risk to human health and the environment. Therefore, sustainable biotechnology represents a viable alternative for nematode control. Plants of the Solanaceae family are present in several biomes and are a source of secondary metabolites of various chemical classes. In this context, the nematotoxic effect of crude aqueous root extracts (CAREs) of three Solanum species was investigated: Solanum americanum, S. subinerme and S. lycocarpum. CARE showed high nematicidal activity (94.6±9.2% mortality, p ≤ 0.001) against second-stage juveniles (J2) of M. incognita, even after heating to 50 °C. These CAREs also inhibited hatching of juveniles (98.4±0.7% of mortality, p ≤ 0.001) in addition to presenting a mean lethal dose of 336 μg ml-1. No toxic activity was observed against non-target organisms, such as fungi (Trichoderma harzianum and Trichoderma asperellum), yeast (Candida maltosa), nitrogen-fixing bacteria (Bradyrhizobium diazoefficiaens, B. japonicum), two strains of Azospirillum brasilense, AbV 5 and AbV 6 and Bacillus [2538 Ba]. Bioassay performed in a greenhouse demonstrated that CAREs of these species were effective in reducing the number of egg masses and galls (> 85%, p ≤ 0.0001), and did not show a phytotoxic effect on soybean seedlings. Our findings indicate that CAREs from plants of the Solanaceae family, especially S. lycocarpum, demonstrated nematotoxic activity on J2 and inhibited the hatching of Meloidogyne incognita eggs, representing an ecologically appropriate tool to control nematode infection in crops worldwide.

Hot Water Tuber Treatments for Management of Meloidogyne Arenaria in Caladium Cultivars.

Hot water treatment was evaluated for its efficacy in controlling Meloidogyne arenaria on caladium. Caladium tubers pre-infested with M. arenaria were immersed in hot water at 50°C for 0 min, 30 min, and 45 min before being planted into 16.5-cm pots filled with sterilized sandy soil. Two caladium cultivars Florida Sweetheart PP 8526 (SWT) and Postman Joyner (PJR), each with three tuber sizes [#3 (<1.5 inch), #1 (1.5–2.5 inch), and Jumbo (>2.5 inch)], were evaluated. Ninety days after the first shoot observation, the number of nematode eggs in roots and second-stage juveniles in soil were significantly reduced, but not eliminated, in both 30 min and 45 min treatments; the 45 min treatment had better results than the 30 min treatment. The efficacy of hot water treatment was affected by caladium cultivar, but not by tuber size. The treated PJR tubers had lower nematode numbers than those of the cultivar SWT. The difference in nematode number between the two caladium cultivars might be related to the morphological characteristics of caladium tubers, as the scale-like tissue on SWT tubers might provide refuge for root-knot nematodes from heat damage. Further research needs to be conducted on determining heat-tolerant thresholds for different Meloidogyne spp. and different caladium cultivars, which will help improve nematode management strategies for caladium growers.

Transcriptional changes of biochemical pathways in Meloidogyne incognita in response to non-fumigant nematicides

Meloidogyne incognita is a destructive and economically important agricultural pest. Similar to other plant-parasitic nematodes, management of M. incognita relies heavily on chemical controls. As old, broad spectrum, and toxic nematicides leave the market, replacements have entered including fluensulfone, fluazaindolizine, and fluopyram that are plant-parasitic nematode specific in target and less toxic to applicators. However, there is limited research into their modes-of-action and other off-target cellular effects caused by these nematicides in plant-parasitic nematodes. This study aimed to broaden the knowledge about these new nematicides by examining the transcriptional changes in M. incognita second-stage juveniles (J2) after 24-h exposure to fluensulfone, fluazaindolizine, and fluopyram as well as oxamyl, an older non-fumigant nematicide. Total RNA was extracted and sequenced using Illumina HiSeq to investigate transcriptional changes in the citric acid cycle, the glyoxylate pathway, upbeta-fatty acid oxidation pathway, oxidative phosphorylation, and acetylcholine neuron components. Observed transcriptional changes in M. incognita exposed to fluopyram and oxamyl corresponded to their respective modes-of-action. Potential targets for fluensulfone and fluazaindolizine were identified in the upbeta-fatty acid oxidation pathway and 2-oxoglutarate dehydrogenase of the citric acid cycle, respectively. This study provides a foundation for understanding how potential nematicide resistance could develop, identifies cellular pathways as potential nematicide targets, and determines targets for confirming unknown modes-of-action.

Transcriptional response of Meloidogyne incognita to non-fumigant nematicides

There is limited research about the impacts of new nematicides, including fluazaindolizine, fluopyram, and fluensulfone, on the plant-parasitic nematode Meloidogyne incognita, despite it being a pervasive agricultural pest. In this study, M. incognita second-stage juveniles were exposed for 24-h to fluensulfone, fluazaindolizine, fluopyram, and oxamyl and total RNA was extracted and sequenced using next-generation sequencing to determine gene expression. The effects of nematicide exposure on cellular detoxification pathways, common differentially expressed (DE) genes, and fatty acid and retinol-binding genes were examined. Fluopyram and oxamyl had the smallest impacts on the M. incognita transcriptome with 48 and 151 genes that were DE, respectively. These compounds also elicited a weak response in the cellular detoxification pathway and fatty acid and retinol-binding (FAR) genes. Fluensulfone and fluazaindolizine produced robust transcriptional responses with 1208 and 2611 DE genes, respectively. These compounds had strong impacts on cellular detoxification, causing differential regulation of transcription factors and genes in the detox pathway. These compounds strongly down-regulated FAR genes between 52–85%. Having a greater understanding of how these compounds function at a molecular level will help to promote proper stewardship, aid with nematicide discovery, and help to stay a step ahead of nematicide resistance.

Nematicidal Activity of Burkholderia arboris J211 Against Meloidogyne incognita on Tobacco.

Root-knot nematode (Meloidogyne incognita) is the most widespread nematode affecting Solanaceae crops. Due to the lack of effective measures to control this nematode, its management can be achieved, using biocontrol agents. This study investigated in vitro efficacy of the antagonistic bacterial strain J211 isolated from tobacco rhizosphere soil against M. incognita, and further assessed its role in controlling nematodes, both in pot and field trials. Phylogenetic analysis of the 16S rRNA gene sequence of strain J211 assigned to Burkholderia arboris. Culture filtrates B. arboris J211 exhibited anematicidal activity against the second-stage juveniles (J2s) of M. incognita, with a 96.6% mortality after 24 h exposure. Inoculation of J211 in tobacco roots significantly reduced the root galling caused by M. incognita, both in pot and field trials. Meanwhile, plant growth-promoting (PGP) traits results showed that J211 had outstanding IAA-producing activity, and the IAA production reached 66.60 mg L−1. In the field study, B. arboris J211 also promoted tobacco growth and increase flue-cured tobacco yield by 8.7–24.3%. Overall, B. arboris J211 as a high-yielding IAA nematicidal strain effectively controlled M. incognita and improved tobacco yield making it a promising alternative bionematocide.

Efficacy of Seed Priming With Cucurbitacin Phytonematicides Against Meloidogyne incognita on Pea

The cost and environment concerns of existing drench-application technologies of cucurbitacin phytonematicides resulted in conceptualization of the priming-and-drying (PAD) technology of seeds with hypogeal germination. The preliminary observations suggested that the PAD technology improved seed germination, plant growth, and vigor in pea (Pisum sativa), with limited information on suppression of root-knot (Meloidogyne species) nematodes. Post-soaking pea seeds in geometric concentrations of Nemarioc-AL and Nemafric-BL phytonematicides, seedlings were raised in greenhouse and on microplot experiments during 2019 and validated in 2020. At 60 days after inoculation with 300 eggs + second-stage juveniles (J2) of M. incognita seasonal data were pooled. Gall rating, eggs in root, and J2 in root vs. Nemarioc-AL phyto nematicide in greenhouse and on microplot exhibited negative quadratic relations, with models explained by 80–85% and 89–94% associations, respectively. Similarly, for the respective sites negative quadratic models for nematode variables vs. Nemafric-BL phytonematicide were explained by 82–93% and 90–94% associations, respectively. In conclusion, pea seed remnants belowground gradually released cucurbitacins into the rhizosphere throughout the growing period, thereby suppressing nematode population densities, and therefore, the PAD technology has the potential for assessment in a large-scale application of cucurbitacin phytonematicides for pea production.

Temperature Effects on Development of Meloidogyne Enterolobii and M. Floridensis.

Meloidogyne enterolobii and M. floridensis are virulent species that can overcome root-knot nematode resistance in economically important crops. Our objectives were to determine the effects of temperature on the infectivity of second-stage juveniles (J2) of these two species and determine differences in duration and thermal-time requirements (degree-days [DD]) to complete their developmental cycle. Florida isolates of M. enterolobii and M. floridensis were compared to M. incognita race 3. Tomato cv. BHN 589 seedlings following inoculation were placed in growth chambers set at constant temperatures of 25°C, and 30°C, and alternating temperatures of 30°C to 25°C (day–night). Root infection by the three nematode species was higher at 30°C than at 25°C, and intermediate at 30°C to 25°C, with 33%, 15%, and 24% infection rates, respectively. There was no difference, however, in the percentages of J2 that infected roots among species at each temperature. Developmental time from infective J2 to reproductive stage for the three species was shorter at 30°C than at 25°C, and 30°C to 25°C. The shortest time and DD to egg production for the three species were 13 days after inoculation (DAI) and 285.7 DD, respectively. During the experimental timeframe of 29 d, a single generation was completed at 30°C for all three species, whereas only M. floridensis completed a generation at 30°C to 25°C. The number of days and accumulated DD for completing the life cycle (from J2 to J2) were 23 d and 506.9 DD for M. enterolobii, and 25 d and 552.3 DD for M. floridensis and M. incognita, respectively. Exposure to lower (25°C) and intermediate temperatures (30°C to 25°C) decreased root penetration and slowed the developmental cycle of M. enterolobii and M. floridensis compared with 30°C.

Varietal Susceptibility and Disease Resistance of Tomato Cultivars against Meloidogyne incognita in Greenhouse Condition

Background: Root-knot nematodes (Meloidogyne spp.) are the most devastating pests of vegetables, especially in the tropic and subtropic regions. Meloidogyne incognita is among the major pathogens found in the tomato crop and causes a significant yield loss. This study evaluates the resistance and susceptible cultivar of tomato against root-knot nematodes (Meloidogyne incognita). Methods: A greenhouse study was conducted to evaluate the resistance or susceptibility of nine tomato cultivars against M. incognita. Nine cultivars of tomato (Jyoti-4, Navuday, P-21, T9, Pusa-Rohini, Pusa-Sheetal, Pusa-Ruby, Tomato-Ped and Tomato-Round) were procured from Indian Institute of Agriculture Research (IARI), New Delhi and Chola seeds store Aligarh, Uttar Pradesh, India. Two weeks old seedlings of each cultivar were transplanted singly into each pot of 15 cm diameter (1 kg mixture of soil). Only one healthy seedling of each cultivar was maintained in each pot, including the control. Each pot was inoculated with 1500 freshly hatched second-stage juveniles (J2s) of M. incognita. This experiment was carried out in a completely randomized design (CRD) with five replications of each cultivar. Result: According to the rating scale of galls and reductions in growth parameters, cultivars Pusa-Ruby and Tomato-Ped were found highly susceptible. Five cultivars, namely Jyoti-4, Navuday, Pusa-Sheetal, P-21 and Tomato-Round were found susceptible, while cultivar Pusa-Rohini was found moderately susceptible. Only one cultivar viz., T9, was found moderately resistant.

Trichoderma virens mitigates the root-knot disease progression in the chickpea plant

ABSTRACT This study was planned to investigate the efficacy of various concentrations of Trichoderma virens against Meloidogyne incognita in vitro. The five concentrations viz., S, S/2, S/ 10, S/25, S/50 were prepared and planned for in vitro study to test the potential of T. virens against hatching and mortality of second-staged juveniles of M. incognita. It was observed a reduction in second-staged juveniles hatching within all tested aqueous concentrations of T. virens. The second-stage juvenile mortality was also recorded in the above-given concentrations of T. virens. The maximum decrease in second-stage juveniles hatching was found in standard aqueous fungal concentration (S). Moreover, in the same T. virens concentration (S), mortality of juveniles was also recorded as highest, and was followed by S/2, S/10, S/25 and S/50. Additionally, the application of T. virens as an individual, simultaneous, and sequential order with M. incognita was also investigated in pot-grown chickpea plants and found that its use was significantly effective in suppressing root-galling disease and improved the plants' growth and physiological attributes. According to the correlation coefficient analysis, the root-knot index correlated significantly with the per cent reduction of the plants' growth and physiological attributes.

First Report of Root-Knot Nematode Meloidogyne enterolobii onCockscomb (Celosia argentea var. cristata) in Taiwan.

Cockscomb (Celosia argentea) is commonly found in subtropical and temperate zones of Africa, South America and South East Asia, and is a popular ornamental plant in the family Amaranthaceae. Cockscomb has been known to contain antiviral proteins, betalains, and anthocyanin, which can be applied in beneficial ways (2). In September 2020, a cockscomb plant (Celosia argentea var. cristata) showing typical galling root symptoms likely infected by root-knot nematodes (Meloidogyne sp.) was collected from a garden in Taichung, Taiwan, and a quick exam of several individuals using MK7F/R primers (7) indicating they were M. enterolobii. Nematode population was established from a single egg mass and was later used for species identification and pathogenicity tests. Five perineal patterns of mature females from the single female population show round to oval shapes with weak lateral lines. Dorsal arches are moderate to high, almost squared, with the smooth ventral striae. Second-stage juveniles are vermiform and have a slender tail, tapering to rounded tip with distinct hyaline region at the tail terminus. Morphological measurements of 28 J2s revealed body length = 457.2 ± 20.6 (416.1-506.9) μm, body width = 16.0 ± 2.0 (13.4-20.3) μm, stylet length = 14.7 ± 0.5 (13.9-15.9) μm, dorsal gland orifice to the stylet base = 4.0 ± 0.5 (2.0-4.8) μm, and tail length = 56.0 ± 3.8 (47.4-60.3) μm. Female perineal patterns and morphometric data are similar to the original description of Meloidogyne enterolobii (9). DNA purified from approximately 1500 juveniles using GeneMark Tissue & Cell Genomic DNA Purification Kit (GeneMark, Taiwan) was used to amplify 18S rDNA fragment, D2-D3 expansion segments of 28S rDNA, and a COII region on mtDNA with primer sets 1A/MelR, D2A/D3B, and C2F3/1108, respectively (4,5,6). The 18S rDNA sequence (OK076893) of this study shares 99.94% nucleotide identity with those of M. enterolobii isolated from the United States (KP901058) and China (MN832688). D2D3 sequence of haplotype 1 (OK076898) shows 100% identity to those of M. enterolobii from China (MT193450) and Taiwan (KP411230). Sequence of haplotype 2 (OK076899) shows 99.86% identity to those of M. enterolobii from the United States (MN809527) and China (MN269945). Sequence of the COII region (OK086042) show 99.86% identity to that of M. enterolobii from China (MN269945). Phylogenetic trees of the three gene sequences were plotted following Ye et al.(10), revealing that the newly described root-knot nematode on Cockscomb is grouped with other M. enterolobii isolates. DNA fragment amplified by primer sets Me-F/R(3) and MK7F/R specifically targeting of M. enterolobii yielded 236 bp and 520 bp, respectively. Pathogenicity tests were assayed, from July to September 2021, on three-week-old nematode-free cockscomb plant directly germinated from seeds of SkyStar® (ASUSA SPIKE SEEDS, Taipei, Taiwan) planted in a 10.5 cm diameter pot filled with 600 ml sterilized peat moss: sand (1:1, v/v) soil in a 28℃walk-in chamber. Nematode eggs were extracted using 0.05% NaoCl as described by Vrain(8), and cockscomb plants (n=3) were inoculated by adding 6000 eggs (10 eggs/ cm3). Cockscomb plants treated with water were used as mock controls. Rf value of the inoculated plants were determined by the method of Belair and Benoit (1) 45 days after inoculation, and the average was 4.13. No galls were observed on the roots of control plants. The results confirmed that cockscomb is the new host of M. enterolobii. To the best of our knowledge, this is the first report of M. enterolobii on Celosia argentea var. cristata in Taiwan.

Methyl Esters of (E)-Cinnamic Acid: Activity against the Plant-Parasitic Nematode Meloidogyne incognita and In Silico Interaction with Histone Deacetylase

(E)-Cinnamaldehyde is very active against Meloidogyne incognita but has low persistence in soil. To circumvent this problem, esters of cinnamic acid were evaluated as a substitute for (E)-cinnamaldehyde. The best results under assays with M. incognita second-stage juveniles (J2) were obtained for the methyl esters of (E)-p-fluoro- (13), (E)-p-chloro- (14), and (E)-p-bromocinnamic acid (15), which showed lethal concentrations to 50% (LC50) J2 of 168, 95, and 216 μg/mL, respectively. Under the same conditions, the LC50 values for the nematicides carbofuran and fluensulfone were 160 and 34 μg/mL, respectively. Substances 13-15 were also active against nematode eggs, which account for most of the M. incognita population in the field. According to an in silico study, substances 13-15 can act against the nematode through inhibition of histone deacetylase. Therefore, esters 13-15 and histone deacetylase are potentially useful for the rational design of new nematicides for the control of M. incognita.

First Report of Meloidogyne graminicola on Tomato (Solanum lycopersicum) in Hainan of China.

Tomato (Solanum lycopersicum) is an important vegetable crop in Hainan province, Southern China. In this area, rice and tomato rotation is the most common way for tomato cultivation. During March of 2021, in a field of Yazhou District, Sanya City, Hainan Province, leaves of some tomato plants (cv. Jinsheng) turned yellow, although there were no obvious dwarf plants observed. The tomato plants with yellow leaves exhibiting obvious galls on the roots were collected. Several females and gelatinous egg masses of Meloidogyne spp. were found inside the cortex of the root galls after dissection. The perineal patterns of females (n=12) were dorsal-ventrally oval with low and round dorsal arches, lacking obvious lateral lines. Most of the striae were smooth and sometimes short and irregular striae were observed within them. Morphological measurements of females (n=20) included body length (L) = 569.2 ± 53.6 (457.6 - 662.7) µm, body width (BW) = 342.7 ± 69.8 (245.5 - 457.9) µm, stylet = 11.8 ± 0.7 (10.5 - 13.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.0 ± 0.2 (3.7 - 4.6) µm, vulval slit length = 24.1 ± 3.7 (16.7 - 30.7) µm, and vulval slit to anus distance = 16.0 ±1.9 (12.6 - 19.3) µm. The second-stage juveniles (J2s, n=20) had the following morphological characters: L = 440.6 ± 26.7 (395.7 - 488.3) µm, BW = 15.9 ± 1.0 (14.5 - 17.9) µm. stylet = 13.5 ± 0.8 (12.3 - 14.9) µm, tail length = 69.5 ± 3.7 (65.4 - 76.9) µm, hyaline tail terminus = 21.0 ± 2.1 (17.3 - 24.9) µm. These morphological characters matched the original description of Meloidogyne graminicola (Golden and Birchfield, 1968). Ten individual females were transferred to ten different tubes for DNA extraction. The species-specific primers Mg-F3 (5'-TTATCGCATCATTTTATTTG-3') and Mg-R2 (5'-CGCTTTGTTAGAAAATGACCCT-3') were used for the identification of M. graminicola (Htay et al. 2016). For the ten DNA samples, a 369 bp fragment was amplified by this pair of primers, confirming their identities as M. graminicola. The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A DNA fragment of 531 bp was obtained and the sequence (GenBank Accession No. MZ576221) was 99.8% identical to the sequences of M. graminicola (GenBank Accession Nos. MH033621, MK616527, and MG356945). Part of the rDNA spanning ITS1, 5.8S gene, and ITS2 was amplified with primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequences from the ITS region were 790 bp (GenBank Accession No. MZ312595) and were all 100% identical to the known sequences of M. graminicola (GenBank Accession Nos. MF320126, HM623442, and KY020414). In glasshouse tests, six 30-day-old tomato plants (cv. Jinsheng) were individually transplanted in pots (V sand :V soil = 3:1) and inoculated with 1500 J2s hatched from the egg masses of collected M. graminicola samples per plant. Two non-inoculated tomato plants served as negative controls. After 50 days, inoculated plants had galled roots similar to those encountered in the field and there were J2s and eggs within the galls. The nematode reproduction factor (RF = final population/initial population) was 5.3. No symptoms were observed on control plants. These results confirmed the nematode's pathogenicity on tomato. To our knowledge, this is the first time of a natural infection of tomato with M. graminicola in China.

First Report of the Cactus Cyst Nematode, Cactodera cacti, Infecting Cereus jamacaru (Cactaceae) in Brazil.

During a survey in 2018 for plant nematodes associated with roots and soil in cactus cultivation areas in Ceará State (3°44'48"S, 38°34'29"W), cysts were found on roots of mandacaru, Cereus jamacaru DC. This cactus is native to Brazil, can grow to 6-10 meters in height, and is widely distributed in the Northeast region (Romeiro-Brito et al. 2016) where it is used in construction, in disease remedies, as forage, and as an ornamental (Sales et al. 2014). Several cysts, second-stage juveniles (J2) and eggs extracted from the soil and roots, using sucrose centrifugation, were examined by scanning electron microscopy (SEM) and light microscopy (LM) to determine morphological and morphometric characteristics. Molecular characteristics were determined by DNA extraction from J2 and embryonated eggs using a protocol specific for Heteroderidae (Subbotin et al., 2018). The internal transcribed spacer sequence (ITS) region of the rDNA and D2-D3 regions of the 28S rDNA were amplified using the universal primers TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'), D2A(5'-ACAAGTACCGTGAGGGAAAGTTG-3') and D3B(5'-TCGGAAGGAACCAGCTACTA-3'), respectively. To confirm that mandacaru is a host for C. cacti, six plantlets of mandacaru were inoculated with 1,800 eggs of the nematode, and kept in a greenhouse at 31 ± 3 ºC and irrigated daily. Six non inoculated mandacaru plantlets served as control treatment. Morphometric characteristics of cysts (n=35) were body length, excluding neck, 555.8 ± 87.8 (354,9 - 727,6) μm, body width 392.1 ± 63.4 (297.9 - 553.7) μm, neck length 63.5 ± 25.8 (49.8-105.0) μm, length to width ratio 1.4 ± 0.2 (1.0-1.8) μm and vulval cone length 48.4 ± 15.2 (40.7 -53.6) μm. Cysts had a rough surface, were lemon-shaped to rounded and had a zigzag cuticular pattern with a protruding vulval cone. They were circumfenestrate without underbridge and bullae, but with the presence of vulval denticles. Measurements of second-stage juveniles (n = 13) included the body length 511.2 ± 33.7 (452.7 - 551.5) μm, stylet length 28.0 ± 2.8 (25.4 - 34.0) μm, tail length 50.7 ± 5.1 (40.6 - 57.4) μm, tail hyaline region 22.7 ± 2.2 (18.9 - 27.1), with a = 20.9 ± 2.2 (17.7-24.3) μm, b = 5.4 ± 0.4 (5.1-5.8) μm, b'= 3.4 ± 0.4 (3.1-3.9) μm, c = 10.2 ± 1.3 (8.9-13.3) μm and c' = 3.8 ± 0.4 (3.0-4.5) μm. The observations of essential morphological characteristics for identification indicated that the species found on C. jamacaru was Cactodera cacti (Filipjev & Schuurmans-Stekhoven, 1941) Krall & Krall, 1978. The sequences of the studied rDNA regions were submitted to GenBank (ITS: MW562829 and D2-D3 regions of 28S: MW562830). The samples used for molecular analysis showed a high degree of sequence identity (99.59%) with C. cacti, from China, Iran and USA for the ITS region. The identity of the D2-D3 regions of 28S sequence was 99.54% with C. cacti isolates from Germany and 99.41% with isolates from USA. Phylogenetic analyses were performed using Maximum likelihood (ML) method for both individual loci, confirming the species as Cactodera cacti. All inoculated mandacaru plantlets showed C. cacti cysts on the roots after 60 days, confirming that mandacaru is a host for C. cacti. This species was reported in São Paulo State, in 2001, associated with ornamental cactus cultivated in pots, but plant species were not identified (Santos et al., 2001). The second report in Brazil was to Schlumbergera sp., an ornamental plant (Oliveira et al. 2007). In both studies, the nematode was not morphologically nor molecularly characterized. Cactodera cacti has been commonly associated with cactus worldwide (Esser, 1992). It has been reported in association with C. jamacaru was first reported in 2011 in China (Duan et al. 2012). This is the first report of the occurrence of C. cacti on C. jamacaru in field conditions in Brazil, and its presence in cactus cultivation areas with agricultural importance represents a threat to cactus production in the country.

First Report of Meloidogyne incognita on Cardamine violifolia in China.

Cardamine violifohia is an economically-important medicinal plant, and also a valuable plant for strong ability to accumulate selenium (Se) (Ebba et al. 2020). It is not only be used to extract selenium protein and selenium polysaccharide, but also widely used to develop selenium-supplement reagent. In September 2020, root-knot nematodes (RKN; Meloidogyne spp.) infection experiments showed that galls and egg masses were observed on the roots of numerous C. violifolia plants in Enshi (30°32'25.67″ N; 109°48'48.46″ E), Hubei Province, China. Meanwhile, the overground plants of C. violifohia were stunted and leaves were yellow. Almost 5% C. violifohia plants were affected by the disease. The roots with galls were collected, and nematodes were dissected and extracted (Fig. S1). Based on phytopathological clinic, the number of galls on each plant was 91.87 ± 19.01, and egg masses was 15.27 ± 5.36 (n = 15). Nematodes and galls were collected from soil and infected roots (Barker 1985). The morphological diagnostic of the nematode species was measured as follows. Measurements of adult females (n=20), body length = 628.15 ± 73.69 μm, width = 356.77 ± 36.72 μm, stylet length = 15.58 ±0.93 μm. Meanwhile, a high and trapezoidal dorsal arch with thick striations was observed in the perineal region of females. Second-stage juveniles (J2s) (n=20): body length = 377.09 ± 18.19 μm, body width = 15.64 ± 1.24 μm, stylet length = 13.31 ± 1.04 μm, tail length = 42.49 ± 4.64 μm, hyaline tail terminus = 12.35 ± 2.02 μm and presented well developed esophageal glands. Eggs (n=20): length = 80.81 ± 3.47 μm, and width = 37.09 ± 2.98 μm. All the morphological characteristics of the identified species were consistent with the descriptions of Meloidogyne incognita (Kofoid & White, 1919) Chitwood, 1949 (Whitehead, 1968). Molecular identification was carried out by PCR with the M. incognita-specific primers Mi-F/Mi-R (Meng et al. 2004) and 28S rDNA D2/D3 region primers MF/MR (Hu et al. 2011). The target fragments of 955 bp and 478 bp amplified by of the primer pairs Mi-F/Mi-R and MF/MR were observed under a UV light, which confirmed that these nematodes collected from C. violifohia were M. incognita (Fig. S2). Fragments were, sequenced (MZ596342 and MZ566843, respectively) and aligned with available sequences on NCBI, which were 100% identical to the MK410954, MN728679, and MK410953, MF177882 M. incognita sequences, respectively. Pathogenicity testing was conducted to perform Koch's postulates in a greenhouse by inoculation of 500 J2s from the original population into C. violifohia seedlings (n = 30, 5-6 leaves stage). After 7 weeks, all inoculated plants exhibited the same symptoms that observed in the field initially. Different life stages of M. incognita were observed in dissected galled tissues. The average reproductive factor was 37.30 ± 6.13, which is considered as the pathogenicity of M. incognita to C. violifohia. Therefore, C. violifohia is a suitable host for M. incognita in China. The growers should be informed of the current findings to avoid serious economic losses that might be caused by this pathogenic nematode, and prepare for proper management action. To our knowledge, this is the first report of M. incognita infecting C. violifohia in China.

Filtrates of mixed Bacillus spp inhibit second-stage juvenile motility of root-knot nematodes

The global expansion of soybean (Glycine max (L.) Merr.) exposes it to more diseases and pests such as nematodes. In South Africa particularly, Meloidogyne incognita and M. javanica are considered the predominant genera infecting soybean, but a more pathogenic root-knot species, M. enterolobii, was recently reported in the Mpumalanga Highveld of South Africa. The use of chemicals to manage these pests is usually preferred although various concerns exist regarding their potential impact on the environment. An increasing need for the development of less toxic alternatives for nematode management thus exists. This study determined the nematicidal activity of Bacillus spp. mixtures isolated from soybean rhizospheres on the motility of second-stage juveniles (J2) of mixed Meloidogyne communities co-occurring in these rhizospheres. Roots and soil from 10 soybean fields in the Mpumalanga Highveld were collected and Bacillus spp. isolated, while the population density and molecular identification of the co-existing Meloidogyne spp. were also done. The filtrates of the Bacillus spp. were then used in in vitro assays to determine their potential nematicidal activity. Results confirmed the presence of M. enterolobii (100%) M. incognita (50%) and M. javanica (40%) in the sampled fields, with single populations found in 20% and mixed communities in 80% of the fields. The filtrate mixture of B. cereus, B. megaterium, B. subtilis and B. thuringiensis caused approximately 85–90% immobility of Meloidogyne spp. J2 after 96 h. The results show that the use of Bacillus spp. mixtures can aid in the development of biocontrol products to combat root-knot nematodes and might be more effective than products from a single species in limiting J2 motility.

Juglone and 1,4-Naphthoquinone-Promising Nematicides for Sustainable Control of the Root Knot Nematode Meloidogyne luci.

The scarce availability of efficient and eco-friendly nematicides to control root-knot nematodes (RKN), Meloidogyne spp., has encouraged research toward the development of bionematicides. Naphthoquinones, juglone (JUG) and 1,4-naphthoquinone (1,4-NTQ), are being explored as alternatives to synthetic nematicides to control RKN. This study expands the knowledge on the effects of these natural compounds toward M. luci life cycle (mortality, hatching, penetration, reproduction). M. luci second-stage juveniles (J2)/eggs were exposed to each compound (250, 150, 100, 50, and 20 ppm) to monitor nematode mortality and hatching during 72 h and 15 days, respectively. Tomato seedlings were then inoculated with 200 J2, which had been exposed to JUG/1,4-NTQ for 3 days. The number of nematodes inside the roots was determined at 3 days after inoculation, and the final population density was assessed at 45 days after inoculation. Moreover, the potential mode of action of JUG/1,4-NTQ was investigated for the first time on RKN, through the assessment of reactive oxygen species (ROS) generation, acetylcholinesterase (AChE) in vitro inhibitory activity and expression analysis of ache and glutathione-S-transferase (gst) genes. 1,4-NTQ was the most active compound, causing ≥50% J2 mortality at 250 ppm, within 24 h. At 20 and 50 ppm, hatching was reduced by ≈50% for both compounds. JUG showed a greater effect on M. luci penetration and reproduction, decreasing infection by ≈80% (50 ppm) on tomato plants. However, 1,4-NTQ-induced generation of ROS and nematode vacuolization was observed. Our study confirms that JUG/1,4-NTQ are promising nematicidal compounds, and new knowledge on their physiological impacts on Meloidogyne was provided to open new avenues for the development of innovative sustainable nematicides.

Identification of Heterodera schachtii on sugar beet in Xinjiang Uygur Autonomous Region of China

The sugar beet cyst nematode, Heterodera schachtii, is a major parasite of sugar beet which has been recognized and listed as a quarantine nematode in China and more than 20 countries and regions worldwide. A survey for important nematodes was undertaken in the sugar beet planting area of China during 2015–2018, and numerous cysts were collected from sugar beet fields in Xinyuan County, Xinjiang Uygur Autonomous Region of China. The observations of morphological and morphometric characteristics revealed that cysts, vulval cones and second-stage juveniles of the Xinjiang population were in the same range of each other and within those of other reported H. schachtii populations. Molecular analysis of rDNA-ITS, 28S-D2/D3 and mtDNA cytochrome c oxidase subunit 1 (COI) gene sequences suggested that the Xinjiang population clustered in a branch with those foreign populations, and the sequence similarity was as high as 99.81–100%. Moreover, this result was confirmed by PCR assay with species-specific primer SHF6 and rDNA2 of H. schachtii, and the pathogenicity test confirmed successful Xinjiang population reproduction in both plant hosts. In conclusion, based on morphological and molecular characterization, this study confirmed that the cyst nematode population collected from sugar beet fields in Xinjiang is H. schachtii. As far as we know, this is the first report of H. schachtii on sugar beets in Xinjiang, China.