First Report of Meloidogyne enterolobii Infecting Mesona chinensis in China.

Abstract

Mesona chinensis Benth is a perennial herb of edible and medicinal value. It is commonly used to cure heatstroke and fever, and treat diseases including diabetes, hypertension, and acute nephritis in modern medicine (Li et al. 2020). In May 2020, M. chinensis plants presented reduced growth and leaf wilting associated with root galls at agricultural base of Guangxi University (22°50'28.41″ N, 108°17'9.00″ E), China. Digging up the roots of the M. chinensis plants revealed lots of root knots. Eggs and second-stage juveniles (689 ± 28) of Meloidogyne spp. were collected in per gram fresh weight roots. Population densities of the J2s averaged 386 ±16 per 100 cm3 soil. The female perineal pattern is usually oval shaped with the dorsal arch being moderately high to high and often rounded. The J2s are truncate with head region rounded and body slender. Tails are narrow with pointed tips, and distinct hyaline tail termini. The morphological measurements (mean, standard deviation and range) of the females (n=10) measurements were: body length = 689.7 ± 11.5 μm; width = 549.3 ± 42.9 μm; stylet length = 15.1 ± 1.0 μm; dorsal esophageal gland orifice (DGO) = 5.4 ± 0.5 μm. The males (n=12) measurements were: body length = 1,341.0 ± 96.2 μm; width =38.6 ± 4.2 μm; DGO = 4.4 ± 0.1 μm. The J2 (n=20) were: body length = 436.1 ± 12.5 μm; body width = 15.7 ± 0.8 μm; stylet length = 12.4 ± 0.8 μm; DGO = 3.8 ± 0.3 μm. Individual J2 (n=4) DNA was further explored by using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Vrain et al. 1992; Powers and Harris 1993; Nadler et al. 1999). Three fragments 765 bp (GenBank accession no. OL663830), 705 bp (OL780766), and 759 bp (OL681885) were amplified, are 100% sequence homology with M. enterolobii (MT406251, MN269947, MT193450), respectively. Species-specific primers Me-F/Me-R were used for amplification of rDNA-IGS2. An expected PCR fragment of approximately 236 bp was obtained, but not presented in M. incognita populations (Long et al. 2006). Therefore, the unknown nematode was further identified as M.enterolobii. To perform Koch's postulates, M. enterolobii from M. chinensis roots were inoculated onto tomato plants for propagation and eggs were extracted from tomato roots. Greenhouse tests were conducted after inoculating 0 or 5,000 eggs into M. chinensis one-month-old healthy cuttings grown in pots filled with sterilized substrates. After 60 days, the inoculated plants (n=12) exhibited galled root symptoms and the noninoculated ones (n=10) exhibited no galls. A reproduction factor of 13.2 ± 3.3 was obtained, confirming the pathogenicity of M. enterolobii on M.chinesis. To our knowledge, this is the first report of a natural infection of M. enterolobii on M.chinensis. It is likely that M. enterolobii may be causing a high level of loss on M. chinensis in southern China.