Sap Extracts Research Articles

Nutrient concentration in sap extracts of HLB-infected trees

Huanglongbing (HLB) has affected approximately 4% of the citrus trees in São Paulo State, Brazil. Scouting, diagnosis, and eradication of affected plants as well as control of the Asian psyllid vector of Ca. Liberibacter spp. were established as required measures for suppression of disease inoculum and maintenance of fruit production in the orchards. Despite the relative effectiveness of those, growers still look for nutrient management practices to minimize losses due to expected progress of the disease. However, clear evidence of positive effects of improved mineral nutrition on tree health and productivity is lacking. A study was set up in the field with 8-yr-old sweet orange trees to evaluate the effects of nutrients (K, Zn, and Mn), phosphate and salicilate leaf sprays to the trees four times in the year during spring and summer. The orchard presented <2% of HLB infected trees at the beginning of the study and experimental plots that represented 1800 trees each were used, which allowed to examine epidemiology of the disease within studied treatments. Temporal progress of HLB-symptomatic trees, fruit yield and nutritional status of trees has been evaluated. Preliminary results demonstrated that nutritional treatments did not improved vigor of HLB-symptomatic trees. Furthermore, nutrient concentrations in leaves and sap extracts were correlated, and major differences were observed for N, Ca, Mg, Mn, and Zn in sap extracts with predominately lower levels in symptomatic compared to asymptomatic trees. These results have pointed out new research approaches of our research group.

First Report of Cucumber mosaic virus Subgroup IA Isolate Infecting Yucca aloifolia in Italy.

Yucca aloifolia L. (Spanish bayonet), family Asparagaceae, is the type species of the genus Yucca. It is native to Mexico and the West Indies and is appreciated worldwide as an ornamental plant. In 2013, during a survey for viruses in ornamental plants in the Campania region of southern Italy, symptoms consisting of bright chlorotic spots and ring spots 1 to 3 mm in diameter with some necrotic streaks were observed on leaves of two plants of Y. aloifolia growing in a nursery located in the Pignataro Maggiore municipality, Caserta Province. Cucumber mosaic virus (CMV) infection was suspected because the symptoms resembled those caused by CMV in Yucca flaccida (1). A range of herbal plant indicators was inoculated with sap extracts of symptomatic Y. aloifolia plants and developed symptoms indicative of CMV. Furthermore, 30 nm isometric virus particles were observed in the same Y. aloifolia sap extracts by transmission electron microscopy. The identity of the virus was confirmed by positive reaction in ELISA tests with CMV polyclonal antisera (Bioreba) conducted on sap extracts of symptomatic Y. aloifolia plants and systemically infected symptomatic hosts (i.e., Nicotiana tabacum, N. glutinosa, Cucumber sativus cv. Marketer, Solanum lycopersicum cv. San Marzano). The presence of CMV in the two naturally infected Y. aloifolia and other mechanically inoculated plants was further verified by reverse transcription (RT)-PCR. Total RNAs were extracted with the E.Z.N.A. Plant RNA Kit (Omega Bio-Tek), according to the manufacturer's instructions. RT-PCR was carried out with the ImProm-II Reverse Transcription System first-strand synthesis reaction (Promega) using the primer pair CMV1 and CMV2 (2). These primers amplify part of the CP gene and part of the 3'-noncoding region of CMV RNA3 and were designed to produce amplicons of different sizes to distinguish CMV isolates belonging to subgroups I or II (3). RT-PCR products were obtained from both naturally infected Y. aloifolia and mechanically inoculated plants as well as from PAE1 isolate of CMV (2), used as positive control, but not from healthy plants. Based on the length of the amplicons obtained (487 bp), the CMV isolate from Y. aloifolia (named YAL) belonged to subgroup I (3). The amplified RT-PCR products were purified with QIAquick PCR Purification Kit (Qiagen), cloned in the pGEMT vector (Promega), and three independent clones were sequenced at MWG (Ebersberg, Germany). Sequences obtained from the two CMV-infected Y. aloifolia plants were identical. This sequence was deposited at GenBank (Accession No. HG965199). Multiple alignments of the YAL sequence with sequences of other CMV isolates using MEGA5 software revealed highest percentage of identity (98.9%) with the isolates Z (AB369269) and SO (AF103992) from Korea and Japan, respectively. Moreover, the YAL isolate was identified as belonging to subgroup IA, based on the presence of only one HpaII restriction site in the 487-bp sequence, as previously proposed (2). Although CMV seems to not be a major threat currently for the production of Y. aloifolia, because the farming of this plant is performed using vegetative propagation, particular attention should be given to the presence of the virus in donor mother plants in order to avoid the dispersion of infected plants that could serve as sources for aphid transmission to other susceptible plant species. To our knowledge, this is the first report of CMV infection of Y. aloifolia in the world.

Host-species-dependent physiological characteristics of hemiparasite Santalum album in association with N2-fixing and non-N2-fixing hosts native to southern China

Understanding the interactions between the hemiparasite Santalum album L. and its hosts has theoretical and practical significance in sandalwood plantations. In a pot study, we tested the effects of two non-N2-fixing (Bischofia polycarpa (Levl.) Airy Shaw and Dracontomelon duperreranum Pierre) and two N2-fixing hosts (Acacia confusa Merr. and Dalbergia odorifera T. Chen) on the growth characteristics and nitrogen (N) nutrition of S. album. Biomass production of shoot, root and haustoria, N and total amino acid were significantly greater in S. album grown with the two N2-fixing hosts. Foliage and root δ(15)N values of S. album were significantly lower when grown with N2-fixing than with non-N2-fixing hosts. Significantly higher photosynthetic rates and ABA (abscisic acid) concentrations were seen in S. album grown with D. odorifera. Similarity in the proportional amounts of amino acid of root xylem sap between S. album and its host D. odorifera was also evident, suggesting major access to nitrogenous solutes from D. odorifera to S. album. Irrespective of host species, S. album clearly appeared to optimize xylem sap extraction from its hosts by higher transpiration and lower water-use efficiency than its host. The growth of two non-N2-fixing hosts parasitized by S. album was significantly greater than the equivalent values for unparasitized treatments, and lower growth and photosynthesis were observed for parasitized A. confusa, and significant decreases in root N, photosynthesis and transpiration for parasitized D. odorifera compared with unparasitized treatments. Furthermore, foliage ABA concentrations were significantly higher in all hosts parasitized by S. album than in their unparasitized counterparts. Our study is probably the first to report on host dependence and preference in the hemiparasite S. album, and the generated results may have important implications for understanding of the physiological interactions between host species and parasitic plants, and for successfully mixing plantations of S. album with D. odorifera.

Growth Response of Tapinanthus bangwensis (Engl. and Krause, Danser) Seeds in vitro and Artificial Infestation in the Field

The growth response of mistletoe, Tapinanthus bangwensis (Engl. and Krause) Danser to different temperatures and photoperiods on hormone-free culture media in vitro were assessed. Cultural procedure with plant sap extracts and field infestations were used to study the mistletoe interaction with Gliricidia sepium, Mangifera indica, Coffee robusta and Theobroma cacao. In the laboratory, mistletoe responded positively to a temperature range of 25-30 °C and 16-24 hr photoperiod. The seedling stages of germination, holdfast and haustorium development and leaf emergence were achieved optimally on an artificial medium of 1% (w/v) mineral salts and vitamins, 3% (w/v) sucrose, 1% (w/v) glucose, 0.04% (w/v) potassium nitrate (KNO3) and 1% (v/v) amino acid. Generally, growth was faster in field infestation than in vitro culture. Tapinanthus bangwensis did not develop on G. sepium branches and its extracts. This is consistent with field observations where mistletoes were not found on G. sepium. The selective nature of T. bangwensis to develop on different hosts and their extracts reflects differences in biochemical/nutrient contents of hosts sap. However, it was more probable that physical destruction of M. indica cambial cylinder by mistletoe haustorium deprived the parasite of water and nutrients resulting in its death. Based on T. bangwensis growth responses in nature and in culture, T. cacao was found susceptible, C. robusta was moderately susceptible and G. sepium and M. indica was non-hosts.

First Report of Tomato apical stunt viroid in Tomato in Italy.

During a survey conducted in October 2013 in tomato greenhouses in Diano Marina (Imola Province, northwest Italy), in a single greenhouse, unusual disease symptoms were observed in four out 1,400 (~0.3%) of tomato plants cv. Ingrid, grafted on 'Beaufort' rootstock. Symptoms including shortened apical internodes associated with tiny, deformed, and brittle chlorotic leaves, while ripe fruits appeared reduced in size and pale red. Samples of leaves from the four plants were collected and examined using commercial antisera (Bioreba AG, Reinach, Switzerland) by double antibody sandwich (DAS)-ELISA against Tomato spotted wilt virus, Cucumber mosaic virus, Alfalfa mosaic virus, Tomato/Tobacco mosaic viruses, and by indirect plate trapped antigen (PTA)-ELISA against potyviruses (potygroup test). None of the tested viruses were detected in the four leaf samples. In addition, PCR tests for begomoviruses and phytoplasmas were also negative. In a host range study, the original symptoms, consisting mainly of stunting and chlorosis, were reproduced within ~10 days in tomato seedlings (Momor line), mechanically inoculated at two true leaves stage with sap extract obtained from the four symptomatic tomato plants, whereas no symptoms were observed in Chenopodium amaranticolor, C. quinoa, Nicotiana tabacum (cv. Xanthi nc), N. glutinosa, or Phaseolus vulgaris (cv. Borlotto rosso). Total RNAs extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) from symptomatic samples were tested in RT-PCR using pospiviroids generic primers PSTVd-32/33 (1), designed to amplify the whole genome of Potato spindle tuber viroid (PSTVd), Tomato apical stunt viroid (TASVd), and Columnea latent viroid (CLVd), and CEVd-FW/RE primers, designed to amplify the whole genome of Citrus exocortis viroid (CEVd) and TASVd (3). Each of the four samples yielded amplicons of the same size (364 bp) with both primer combinations. The identity of the viroid was then determined by sequencing, on both strands, amplicons obtained from the four symptomatic plants at MWG (Ebersberg, Germany). Sequences obtained were identical, showing the highest nucleotide identity (99.7%) with the TASVd isolate Sj1 (AM777161), identified in Germany on Solanum jasminoides. The sequence was deposited in GenBank (Accession No. HG916812) and the field isolate named To1-IT. Two other cases of pospiviroid infection in tomato in Italy have been reported so far and the viroid species detected were PSTVd (2) and CLVd (4), respectively. To our knowledge, this is the first report of TASVd infecting tomato in Italy. The origin of this infection is still unclear, although based on the biological properties and sequence similarity, the To1-IT isolate probably originated from an ornamental species, most likely S. jasminoides, as recently reported for other tomato TASVd isolates, according to their biological and genetic features (5).

Dynamic control of osmolality and ionic composition of the xylem sap in two mangrove species.

• Premise of the study: Xylem sap osmolality and salinity is a critical unresolved issue in plant function with impacts on transport efficiency, pressure gradients, and living cell turgor pressure, especially for halophytes such as mangrove trees.• Methods: We collected successive xylem vessel sap samples from stems and shoots of Avicennia germinans and Laguncularia racemosa using vacuum and pressure extraction and measured their osmolality. Following a series of extractions with the pressure chamber, we depressurized the shoot and pressurized again after various equilibration periods (minutes to hours) to test for dynamic control of osmolality. Transpiration and final sap osmolality were measured in shoots perfused with deionized water or different seawater dilutions.• Key results: For both species, the sap osmolality values of consecutive samples collected by vacuum extraction were stable and matched those of the initial samples extracted with the pressure chamber. Further extraction of samples with the pressure chamber decreased sap osmolality, suggesting reverse osmosis occurred. However, sap osmolalities increased when longer equilibration periods after sap extraction were allowed. Analysis of expressed sap with HPLC indicated a 1:1 relation between measured osmolality and the osmolality of the inorganic ions in the sap (mainly Na+, K+, and Cl-), suggesting no contamination by organic compounds. In stems perfused with deionized water, the sap osmolality increased to mimic the native sap osmolality.• Conclusions: Xylem sap osmolality and ionic contents are dynamically adjusted by mangroves and may help modulate turgor pressure, hydraulic conductivity, and water potential, thus being important for mangrove physiology, survival, and distribution.

Anticorrosive ultrathin film derived from bio-based urushiol–Ti by layer-by-layer self-assembly

Abstract Urushiol–metal polymers, obtained by the reaction between metal and urushiol (an extraction of natural Chinese lacquer sap), are a heavy anticorrosive coating used in chemical industry because of their excellent resistance against chemical medias. Herein, through layer-by-layer (LBL) self-assembly of n-butyl titanate and urushiol, a stable anticorrosive multilayer inorganic–organic hybrid Ti/ polyurushiol (Ti/PU)n ultrathin film was constructed after UV irradiation. The formation of the (Ti/PU)n ultrathin film was monitored by Fourier transform infrared (FT-IR) spectroscopy and UV–vis spectroscopy, while the microstructure of the film was analyzed by X-ray photoelectron spectroscopy (XPS), X-ray reflectometry (XRR), atomic force microscopy (AFM) and scanning electron microscopy (SEM) . The anticorrosion property of the (Ti/U)n film with number n (n = 1, 3, 5, 7, 9, 11) and (Ti/PU)n (n = 3, 5, 7, 9, 11) film was investigated in concentrated salt aqueous solution using potentiodynamic polarization measurement. Due to the compact and defectless three-dimensional cross-linking network structure through the coordinate bonding between urushiol and Ti by LBL technique and subsequent photo-induced polymerization, the resultant (Ti/PU)7 film showed pronounced protective efficiency with inhibiting efficiency (IE) of greater than 99%. The morphology of (Ti/PU)7 film remained integrated and defect-free after immersion in 3.5 wt.% NaCl and 1 mol/L HCl solution for 24 h.

Accumulation, selection and covariation of amino acids in sieve tube sap of tansy (Tanacetum vulgare) and castor bean (Ricinus communis): evidence for the function of a basic amino acid transporter and the absence of a γ-amino butyric acid transporter

Sieve tube sap was obtained from Tanacetum by aphid stylectomy and from Ricinus after apical bud decapitation. The amino acids in sieve tube sap were analyzed and compared with those from leaves. Arginine and lysine accumulated in the sieve tube sap of Tanacetum more than 10-fold compared to the leaf extracts and they were, together with asparagine and serine, preferably selected into the sieve tube sap, whereas glycine, methionine/tryptophan and γ-amino butyric acid were partially or completely excluded. The two basic amino acids also showed a close covariation in sieve tube sap. The acidic amino acids also grouped together, but antagonistic to the other amino acids. The accumulation ratios between sieve tube sap and leaf extracts were smaller in Ricinus than in Tanacetum. Arginine, histidine, lysine and glutamine were enriched and preferentially loaded into the phloem, together with isoleucine and valine. In contrast, glycine and methionine/tryptophan were partially and γ-amino butyric acid almost completely excluded from sieve tube sap. The covariation analysis grouped arginine together with several neutral amino acids. The acidic amino acids were loaded under competition with neutral amino acids. It is concluded from comparison with the substrate specificities of already characterized plant amino acid transporters, that an AtCAT1-like transporter functions in phloem loading of basic amino acids, whereas a transporter like AtGAT1 is absent in phloem. Although Tanacetum and Ricinus have different minor vein architecture, their phloem loading specificities for amino acids are relatively similar.

Evaluating Nitrogen Behavior in Sugarcane after Fertilization Using Leaf and Sap Extract Analyzes

Nitrogen (N) fertilization is important for sugarcane crops, for both agronomic and environmental reasons. Better use of N from fertilizer is required for crop management, and in order to achieve it, adequate N nutrition monitoring is necessary. Sap extract analysis is a sensitive technique that has been adopted in other crops to tackle this objective, and can be used for sugarcane. The aim of this study was to evaluate the behavior of N and the response of sugarcane after N fertilization, using sap and leaf tissue analysis. The study was undertaken in two experimental areas in 2012/2013 season, using ratoon cane, following application of 0, 50, 100, and 150 kg&middotha-1 of N. The youngest visible leaves were sampled from sugarcane at five time points between 0 and 150 days after fertilization, to evaluate the nitrate, ammonium, and total N content of sap extract, and total N content of leaf tissue. At the first sampling point (30 days after N fertilizer application), mineral N in sap increased as a result of N fertilization in medium-textured soil, and remained high until 120 days after fertilization in clayey soil. The total N content of sap followed a similar behavior. Stalk yield was only observed to increase in sugarcane grown in the clayey soil. Sap analysis proved to be an efficient method for monitoring N status in sugarcane grown in different soil types.

Detection and Quantification of Xanthomonas albilineans by qPCR and Potential Characterization of Sugarcane Resistance to Leaf Scald.

Leaf scald is an important disease of sugarcane with erratic symptom expression. Latency represents a threat to germplasm exchange, and erratic symptom development makes accurate evaluation of disease resistance during breeding and selection problematic. Real-time quantitative polymerase chain reaction (qPCR) assays for Xanthomonas albilineans, the causal agent of leaf scald, were developed and evaluated for the sensitive, specific detection and quantification of the pathogen. Assays with SYBR Green primers and TaqMan probe and primers derived from the albicidin toxin biosynthesis gene cluster efficiently and reproducibly amplified X. albilineans. Detection was more sensitive with qPCR compared with conventional PCR. Assays were specific for X. albilineans and sap extracts did not inhibit the qPCR reaction. Leaf-scald-resistant and -susceptible cultivars were distinguished by infection incidence, disease severity, and X. albilineans population determined by SYBR Green qPCR in both greenhouse and field experiments. Populations of X. albilineans varied in different tissues. Differences were the greatest within tissues in resistant cultivars, and bacterial populations in systemically infected, young, not yet fully emerged leaves exhibited the greatest differences between resistant and susceptible cultivars. The results demonstrate that qPCR is a highly sensitive method for the detection of X. albilineans that could provide a reliable method for leaf scald resistance screening.

Incidence ofPotato Spindle Tuber Viroid(PSTVs) in Potato Growing Areas of Punjab

Potato Spindle Tuber Viroid (PSTVs) infection in potato fields of Punjab was determined by mechanical transmission and reverse transcriptase polymerase chain reaction (RT-PCR). Potato plants and tubers showing symptoms of PSTVd were selected and transported to lab for indexing. Sap extracts prepared from symptomatic leaves and tubers of potato plants when mechanically inoculated on leaves of young tomato seedlings showed symptoms like epinasty and rugosity after 10 days of inoculation. PSTVd was further detected in infected samples when RT-PCR assay was performed using viroid specific primers. PSTVd results in loss of tuber yield up to 59% and severe infection resulted in to complete destruction of susceptible plants. This study has proven incidence and prevalence of PSTVd in potato growing areas of Punjab.

First Report of Iris yellow spot virus Infecting Green Onion in Indonesia.

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5'-AGCAAAGTGAGAGGACCACC-3' and IYSV-239f: 5' TGAGCCCCAATCAAGACG3' (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact.

Feeding by sugarcane aphid, Melanaphis sacchari, on sugarcane cultivars with differential susceptibility and potential mechanism of resistance

AbstractFeeding behavior of Melanaphis sacchari Zehntner (Hemiptera: Aphididae) was studied on sugarcane, Saccharum spp. (Poaceae), cultivars HoCP 91‐555 (resistant), LCP 85‐384 (moderately resistant), and L 97‐128 (susceptible) using the electrical penetration graph (EPG) technique. Constitutive concentrations of total phenolics and available carbohydrates, water potential at the whole‐leaf tissue level, and free amino acids (FAAs) in phloem sap extracts, and in honeydew produced by aphids fed on L 97‐128 and HoCP 91‐555 were determined. Cultivar did not influence time for M. sacchari to access phloem sieve elements. Total time in sieve elements was ca. two‐fold greater on L 97‐128 than on HoCP 91‐555, whereas it did not differ from LCP 85‐384 in either cultivar. The mean duration of individual events associated with phloem sap ingestion was ca. 50% shorter on both HoCP 91‐555 and LCP 85‐384 than on L 97‐128. Although cultivar effects were not detected for levels of total phenolics, available carbohydrates, and water potential, two free essential amino acids, histidine and arginine, were absent from phloem sap in HoCP 91‐555. Two free essential amino acids, leucine and isoleucine, and two free non‐essential amino acids, tyrosine and proline, were absent from honeydew of aphids fed on HoCP 91‐555. These results suggest that despite apparent biosynthesis of some FAAs, the absence of important FAAs in the phloem sap of HoCP 91‐555 and the inability of M. sacchari and its endosymbionts (e.g., Buchnera) to derive specific free essential and non‐essential amino acids from other ingested molecules, possibly along with other unidentified factors, underlie the pest's decreased phloem sap ingestion and consequently reduced growth potential on HoCP 91‐555.

Expression of endogenous para-retroviral genes and molecular analysis of the integration events in its plant host Dahlia variabilis

The dahlia (Dahlia variabilis) genome contains an endogenous pararetrovirus sequence (EPRS) tentatively designated as DvEPRS. The DvEPRS shares genome structure and organization that is typical of members of the Caulimovirus genus. Studies were carried out to better understand the nature of this integration and to determine the gene expression of this DvEPRS. Genomic Southern hybridization showed multiple and random integration events of the DvEPRS in the dahlia genome. To investigate the presence of DvEPRS transcripts, RT-PCR was done on DNase-treated total RNA from DvEPRS-infected dahlia plants. Results showed the expression of open reading frames I, V, and VI. Direct PCR from sap extracts produced more intense DNA amplicons of Dahlia mosaic virus and Dahlia common mosaic virus which are believed to exist as typical episomal caulimoviruses, whereas significantly less intense amplicon was seen in case of DvEPRS in comparison with internal transcribed spacer region of dahlias amplicon. The DvEPRS in wild and cultivated species of Dahlia offer a model system to study the molecular events underlying the ecology, evolution and spread of DvEPRS within natural and managed ecosystems and the factors affecting integration of these EPRS in the plant genome.

Diagnostic real-time RT-PCR for the simultaneous detection of Citrus exocortis viroid and Hop stunt viroid

Citrus exocortis viroid (CEVd) and Hop stunt viroid (HSVd) are two important viroids known to infect several plant species worldwide. In this study, a real-time reverse transcription (RT) TaqMan polymerase chain reaction (PCR) assay was developed and optimized for the simultaneous detection of CEVd and HSVd. The assay's analytical and diagnostic sensitivity and specificity were evaluated using reference isolates. Two different RNA extraction methods and one rapid crude template preparation procedure were compared in terms of extraction purity and efficiency for PCR applications. Extraction method Q included a commercially available kit, whereas method C was a modified chloroform-phase extraction in house protocol. Procedure S involved blotting the sap extract on a positively charged nylon membrane and elution. The multiplex RT-TaqMan PCR assay successfully discriminated the two viroid species from all reference samples and its recorded diagnostic sensitivity (Dse) and specificity (Dsp) was 100%. On the contrary, in conventional RT-PCR tests, the overall Dse and Dsp were lower and estimated at 94 and 95% for CEVd, and 97 and 98% for HSVd, respectively. In a direct comparison, the developed assay presented 1000-fold more analytical sensitivity. Spectrophotometric results showed that RNA extraction methods Q and C, yielded the purest RNA, and gave the lowest mean Ct values. Alternative template preparation method S resulted in Ct values statistically similar to those obtained with methods Q to C when tested by RT-TaqMan PCR. The developed assay, using crude template preparation S, allows the simple, accurate and cost-effective testing of a large number of plant samples, and can be applied in surveys and certification schemes.

First Report of Sweet potato virus G and Sweet potato virus 2 Infecting Sweetpotato in North Carolina.

Sweet potato virus G (SPVG) and Sweet potato virus 2 (SPV2) are two members of the genus Potyvirus, distinct from Sweet potato feathery mottle virus (SPFMV) (1,2,4). The significance of SPVG and SPV2 to sweetpotato (Ipomoea batatas Lam.) is that each virus can synergistically interact with Sweet potato chlorotic stunt virus (SPCSV) inducing sweet potato virus disease (SPVD) (1,2,4). During the summer of 2012, susceptible indicator plants (I. setosa) were evenly distributed in sweetpotato experimental plots at two research stations (Clinton and Kinston) in North Carolina (NC). Naturally infected indicator plants (n = 129) showing virus-like symptoms including vein clearing, chlorotic mosaic, and chlorotic spots were collected and tested for the presence of viruses. Sap extract from plants tested positive for SPVG and SPV2 by nitrocellulose immune-dot blot, using SPVG antiserum obtained from the International Potato Center (Lima, Peru) and SPV2 antiserum kindly provided by C. A. Clark, Louisiana State University. Total RNA was extracted from 200 mg of symptomatic leaf tissue by using the QIAGEN RNeasy Plant Mini Kit (Hilden, Germany) adding 2% PVP-40 and 1% 2-mercaptoethanol to the extraction buffer. Multiplex RT-PCR was carried out using the SuperScript III One-Step RT-PCR System (Invitrogen, Carlsbad, CA) with specific primers designed for simultaneous detection and differentiation of four closely related sweetpotato potyviruses (3). Amplicons were cloned using the pGEM-T Easy cloning kit (Promega, Madison, WI) and sequenced. Quantitative RT-PCR was used for SPCSV detection. Results confirmed the presence of SPVG and SPV2 in single infections on 7% and 0.8% of samples, respectively; and in mixed infections on 54% and 3% of samples, respectively. SPVG was found as the most prevalent in all viral combinations where 14% of samples were infected with SPVG and SPFMV; and 15% of samples were infected with SPVG, SPFMV, and Sweet potato virus C (SPVC). SPV2 was detected in less common combinations (0.8%) associated with SPVG and SPFMV. The mixed infection SPVG and SPCSV as well as the combination SPV2 and SPCSV was detected in 0.8% of samples. Sequence analyses of the samples at nucleotide level (GenBank Accession Nos. KC962218 and KC962219, respectively) showed 99% similarity to SPVG isolates from Louisiana (4) and SPV2 isolates from South Africa (1). Scions from infected indicator plants were wedge grafted onto healthy sweetpotatoes (cvs. Beauregard and Covington). Eight weeks after grafting, chlorotic mosaic was observed on plants with mixed potyvirus infections whereas plants with single potyvirus infection showed no obvious symptoms. RT-PCR testing and sequencing of amplicons corroborate the presence of both viruses initially detected in indicator plants. Additionally, naturally infected sweetpotato samples (n = 102) were collected in the same experimental plots. SPVG and SPV2 were detected and identified following the described methodology. In the United States, SPVG has been shown to be prevalent in Louisiana (4) and the results presented here indicate that SPVG is spreading in NC. Our results confirm the presence of SPVG and SPV2 in NC. To our knowledge, this is the first report of SPVG and SPV2 in sweetpotato fields in NC.

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3'), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu.

SAP NITRATE IN FROZEN-THAWED AND REFRIGERATED STEMS OF AMARANTHUS TRICOLOR IS INDICATIVE OF NITROGEN FERTILIZER SUPPLY

Amaranthus tricolor is a potential accumulator of nitrate but nutrient sufficiency guidelines have not been developed for this vegetable. We investigated whether the shoot stem of A. tricolor is a suitable index for crop nitrate status, and whether freezing the stem, which aids sap extraction, would render it unsuitable for the analysis of nitrate and other nutrients. We grew A. tricolor at two nitrogen (N) rates (100 and 200 mg L−1 as nitrate-N) and established that sap nitrate from both fresh and frozen-thawed stems did not differ but was significantly increased by additional N fertilizer. Shoot growth was correspondingly higher with additional N. Therefore, the stem is a suitable index for crop nitrate. Boron (B), calcium (Ca), iron (Fe), magnesium (Mg), manganese (Mn), molybdenum (Mo), sodium (Na) and sulfur (S) were significantly affected by frozen storage but potassium (K), phosphorus (P) and zinc (Zn) were not. A single sufficiency guideline is possible for these nutrients, for use with both fresh and frozen-thawed stem sap.

Estimating the maple syrup production potential of American forests: an enhanced estimate that accounts for density and accessibility of tappable maple trees

This paper examines the maple syrup production potential of American forests by analyzing Forest Inventory & Analysis (FIA) data provided by the US Forest Service on the resource of sugar maple (Acer saccharum Marsh.) and red maple (Acer rubrum L.) trees in twenty states. The analysis is based on tree species and size (diameter at breast height, or dbh), ownership category, jurisdiction, the density of maple trees in a stand, and the distance of the stand to an access road. Although there are over 2 billion sugar and red maple trees of tappable size growing in US forests, when narrowed down according to the attributes of an optimal ‘sugarbush’, there are 100 million potential taps from sugar maples alone and 286 million potential taps with sugar and red maples combined. Overall, 45 % of the tappable-size maple trees are found in stands whose density is not high enough to support commercial sap extraction whereas only 6 % are found in stands that are at least 1.6 km from an access road. The ten states with commercial maple syrup industries have a much higher percentage of their maple trees occurring in stands of optimal density and also contain a higher percentage of sugar maple than red maple trees. States that are utilizing the highest percentage of their potential sugarbushes include Vermont and Maine, whereas states that have significant room for expansion include Michigan, New York, and Pennsylvania.

First Report of Potato virus Y in Kalimeris indica in China.

Kalimeris indica, a tall, fecund plant in the family Asteraceae, a native of China, Japan, and Siberia, has been around a long time. It was first mentioned in 1825 and is popular in Europe. It is widely grown in Heilongjiang, Liaoning, Jilin, Hebei, Shanxi, and other provinces in China for its medicinal properties. K. indica is believed to have a clearing effect on eyesight, reduces blood pressure and swelling, and is rich in carotene, which can reduce internal heat, enhancing human immunity. It also grows as a weed around tobacco fields and can transmit viruses to tobacco. In June of 2012, we observed diffuse chlorotic and necrotic spots on the leaves of K. indica in the field in Liaoning Province. Sap extracts from symptomatic plants were tested by direct antigen coated ELISA using polyclonal antibodies specific to Potato virus Y (PVY), Cucumber mosaic virus (CMV), and Tobacco mosaic virus (TMV). Samples were negative for CMV and TMV but positive for PVY. RNA extracted from symptomatic leaves of K. indica was used as template for obtaining PVY genomic sequences. cDNA of the PVY genome were prepared using PrimeScript II High Fidelity RT-PCR Kit (TaKaRa Biotechnology Dalian Co., Ltd) as described by the manufacturer. The strategy for amplification of overlapping genome fragments and determining the 5'-terminal end of the genome by 5'-RACE and 3'-terminal end of the genome by 3'-RACE was described previously (1). PCR amplification was performed using the TaKaRa PrimeSTAR GXL DNA Polymerase (TaKaRa Biotechnology Dalian Co., Ltd) following the manufacturer's instructions with PVY1F(5'-AAAACAACTCAATACAACAT-3'), PVY3R(5'-GTCTCCTGATTGAAGTTTACAGYCACT-3'), R2743 (5'-CTGTTGCTGCCGTGTCAATTAT-3'), F1810 (5'-CTGGCTGAGTTTAGGCGGAAGA-3'), R5868 (5'-GCTTGACTTGCCCATACCAACA-3'), F5711 (5'-CTCACCAGGGCAAGAACAAATC-3'), F830 (5'-ATCTCGCCAGGACGGACAAGTG-3'), R2678 (5'-GCTAAGGCGGACAATAACGATG-3'), R7713 (5'-TTCAGGTAGACGCCGAAGCAAT-3'), F7442 (5'-TTACTGAGGCGGATAAAGAGGA-3'), R8940 (5'-TCCGTTGATGTTTGGCGAGGTT-3'), F1 (5'-AATGAAAATGCCCAAGAGTAAG-3'), F3 (5'-TCTGCGCGATGGAAGTTTGG-3'), R1 (5'-TCTGGGCATCAGTCTTGTATCG-3'), R2 (5'-AACTTCTCGTTTCCCCGCAACT-3') primers. The expected genome sequence was amplified from symptomatic leaves and the amplicon was cloned and sequenced (GenBank Accession No. JQ971975). The complete genome sequence named ME162 was determined to be 9,714 nucleotides in length, excluding the 3'-terminal poly (A) tail. Comparisons of amplicon with the nucleotide sequences available in the NCBI database using BLAST showed 99% identity with PVY from Uganda (GenBank Accession No. DQ157180). The isolate was most closely related to potato virus Y N strain. The serological and sequence data revealed that K. indica plants were infected by PVY. To our knowledge, this is the first report of PVY in K. indica in China. K. indica is an important medicinal plant. This report provides the scientific evidence for virus control on future K. indica plantings. K. indica grows as a weed around tobacco fields and can serve as an indirect host for virus transfer. Controlling virus incidence on K. indica is an important way to protect tobacco from infection by PVY. Reference: (1) J. Chen and J. P. Chen. Chin. J. Virol. 18:371, 2002.