Ruthenium Polypyridine Research Articles

A TD-DFT study on the electronic spectrum of Ru(II)L 2 [L = bis(5′-methyl-2,2′-bipyridine-6-carboxylato)] in the gas phase and DMF solution

Ruthenium polypyridine and polypyridined-derivative complexes are used in dye-sensitized solar cell as a light to current conversion sensitizers, study on the electronic absorption spectroscopy of which are very important for the understanding of their photovoltaic character. A theoretical research of UV–Vis spectrum on the Ru(II)L 2[L = bis(5′-methyl-2,2′-bipyridine-6-carboxylato)], a polypyridined-derivative mononuclear ruthenium complex, is presented here. Transition excited states of Ru(II)L 2 in the gas phase have been studied by the time-dependent density functional theory (TD-DFT) using a hybrid functional, B3LYP, as well as the 3-21G ∗ basis set. Two maximum absorptions are dominated by the metal-to-ligand-charge-transfer (MLCT) transitions, from Ru 4d orbitals to the bipyridine rings π ∗. Taking account of solvent effect, the electronic absorption spectrum of Ru(II)L 2 in N, N′-dimethyl formamide (DMF) solution has also been investigated on the basis of Polarized Continuum Model (PCM) in connection with TD-DFT. Calculation results indicate that the two maximum MLCT absorption peaks are blue-shifted in DMF solution with respect to those in the gas phase, which is in agreement with the observed phenomenon of other ruthenium polypyridine-type complexes.

Layer-by-Layer Molecular Organization of Polypyridine Ruthenium(II) Complexes on Glass Plates

Abstract We have developed a methodology for the two-dimensional multilayer formation of polypyridine ruthenium complexes on solid surfaces under mild conditions. The alternate multilayers of the ruthenium complex and Zr were fabricated on pretreated glass plates using interlayer phosphonate–Zr linkages. The RuLn molecules in the films are electronically independent, with neither interchromophoric interactions nor electronic perturbations of the ZrIV centers in the ground state.

Improved efficiency of a thiophene linked ruthenium polypyridine complex for dry dye-sensitized solar cells

We report herein the preparation, the electrochemical, the absorption and the emission properties of a new heteroleptic bisterpyridine ruthenium complex. The first terpyridine is functionalized, on the 4′ position, by a phosphonic acid group and the second terpyridine bears in the 4′ position a tert-thiophenyl unit attached via an ethanyl spacer. The latter complex was tested in dye-sensitized solar cells using the liquid electrolyte (I 2/LiI/ tert-butylpyridine/propylene carbonate) or the solid poly(3-octylthiophene) as a hole conductor. It displays an improved photovoltaic photoconversion efficiency compared to the analogous complex in which the tert-thiophene is directly linked to the terpyridine ligand. This study shows that the covalent attachment of a thiophene residue on the sensitizer is a promising strategy for the development of solid-state dye-sensitized solar cells and it highlights the benefit of introducing a non-conjugated spacer between the thiophenyl unit and the polypyridine ruthenium sensitizer.

Sensitive Single-Layered Oxygen-Sensing Systems: Polypyridyl Ruthenium(II) Complexes Covalently Attached or Deposited as Langmuir−Blodgett Monolayer on Glass Surfaces

Oxygen-sensing elements containing single-layered structures of luminescent indicators of ruthenium(II) bipyridyl complexes on glass surfaces prepared by covalent attachment and LB deposition are described. They are capable of detecting gaseous oxygen concentration by luminescence quenching of the indicator with reproducible and large quenching efficiencies that are comparable to the best quenching efficiencies obtained by other ruthenium(II) polypyridine based complexes immobilized in matrixes. The large quenching efficiencies for both films imply that the probe complexes are effectively quenched by oxygen, which is probably due to the thin single-layered structures with large surface-to-area ratio and short distance between the probe complexes and oxygen.

Luminescent Transition Metal Polypyridine Biotin Complexes

AbstractIn view of the fact that many transition metal complexes display intense and long‐lived metal‐to‐ligand charge‐transfer emission with a large Stokes' shift, we have incorporated biotin into a series of luminescent rhenium(I), iridium(III) and ruthenium(II) polypyridine complexes to form new probes for the protein avidin. All these luminescent transition metal polypyridine biotin complexes displayed enhanced emission intensities and extended lifetimes upon binding to avidin. These changes are closely related to the hydrophobic biotin‐binding pockets of avidin and the increased rigidity of the local environment of the probes after they bind to the protein. We have exploited the characteristics of these luminescent transition metal biotin complexes in the development of various assays.

Inert benzothiazole functionalised ruthenium(ii) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Design and spectroscopic study of new ruthenium(II) complexes containing ligands derived from terpyridine and dipyrido[3,2-a:2′,3′-c]phenazine: {Ru(4′-Rph-tpy) [dppz(COOH)]Cl}PF6 with R = NO2, Br, Cl

A series of polypyridine ruthenium complexes of the general formula {Ru(Rph-tpy)[dppz(COOH)]Cl} PF6 with R = Br (1), Cl (2), NO2 (3) where Rph-tpy is 4′-(4-Rphenyl-2,2′:6′,2″-terpyridine and dppz(COOH) is dipyrido[3,2-a:2′,3′-c]phenazine-2-carboxylic acid were prepared and characterized. These complexes display intense metal-to-ligand charge-transfer (MLCT) bands centered about 500 nm. The effect of pH on the absorption spectra of these complexes consisting of protonatable ligands has been investigated in water solution by spectrophotometric titration. The electrochemistry shows oxidation potentials for the Ru(II)–Ru(III) couple at +0.881 (1), +0.907 (2) and +0.447 V (3), respectively. Copyright © 2006 John Wiley & Sons, Ltd.

A New Family of Ruthenium(II) Polypyridine Complexes Bearing 5-Aryltetrazolate Ligands as Systems for Electrochemiluminescent Devices

A new family of mono- and dinuclear ruthenium polypyridyl complexes containing 5-aryltetrazolate ligands such as the deprotonated form of 4-(1H-tetrazol-5-yl)benzonitrile (4-TBNH) and bis(1H-tetrazol-5-yl)benzene (BTBH(2)) have been synthesized and thoroughly characterized. The reactivity of the mononuclear species toward different electrophiles such as H(+) and CH(3)(+) has been investigated, and the effects of the resulting regioselective electrophilic attacks on the electronic and structural properties of the tetrazolate ligand have been studied by NMR ((1)H, (13)C) spectroscopy and X-ray crystal structures. Absorption and emission spectroscopy, together with an electrochemical and UV-vis-NIR spectroelectrochemical investigation of the uncoordinated ligand and complexes, has been performed, highlighting a rather good luminescence efficiency and a poor bridge-mediated electronic communication between the metal centers of the dinuclear complexes. The electrogenerated chemiluminescence (ECL) of the dinuclear species has been explored, and for one of these, an exceptionally high ECL efficiency has been observed, comparable to that of [Ru(bpy)(3)](2+), which is considered a standard in ECL studies.

Luminescent probes for indole-binding proteins derived from ruthenium(II) polypyridine complexes

We report here the synthesis, characterisation, electrochemical, photophysical and protein-binding properties of four luminescent ruthenium(II) polypyridine indole complexes [Ru(bpy) 2(L1)](PF 6) 2 ( 1), [Ru(bpy) 2(L2)](PF 6) 2 ( 2), [Ru(L1) 3](PF 6) 2 ( 1a), and [Ru(L2) 3](PF 6) 2 ( 2a) (bpy = 2,2′-bipyridine; L1 = 4-( N-(2-indol-3-ylethyl)amido)-4′-methyl-2,2′-bipyridine; L2 = 4-( N-(6- N-(2-indol-3-ylethyl)hexanamidyl)amido)-4′-methyl-2,2′-bipyridine). Their indole-free counterparts, [Ru(bpy) 2(L3)](PF 6) 2 ( 3) and [Ru(L3) 3](PF 6) 2 ( 3a) (L3 = 4-( N-(ethyl)amido)-4′-methyl-2,2′-bipyridine), have also been synthesised for comparison purposes. Cyclic voltammetric studies revealed ruthenium-based oxidation at ca. +1.3 V versus SCE and diimine-based reductions at ca. −1.20 to −2.28 V. The indole moieties of complexes 1, 2, 1a and 2a displayed an irreversible wave at ca. +1.1 V versus SCE. All the ruthenium(II) complexes exhibited intense and long-lived orange-red triplet metal-to-ligand charge-transfer 3MLCT (dπ(Ru) → π*(L1–L3)) luminescence upon visible-light irradiation in fluid solutions at 298 K and in alcohol glass at 77 K. The binding of the indole-containing complexes to bovine serum album (BSA) has been studied by quenching experiments and emission titrations.

Preparations and Characterizations of Bichromophoric Systems Composed of a Ruthenium Polypyridine Complex Connected to a Difluoroborazaindacene or a Zinc Phthalocyanine Chromophore

This paper describes the synthesis of a new series of molecules composed of a ruthenium cation liganded by a chloro or a thiocyanato, a 4,4'-(diethoxycarbonyl)-2,2'-bipyridine, and a 2,2':6',2' '-terpyridine substituted in its 4' position by a difluoroborazaindacene or a zinc phthalocyanine. A set of conditions are reported to conveniently synthesize these dyads by a Stille cross-coupling reaction between the trimethyltin derivative of the organic chromophore and the corresponding ruthenium complex with 4'-bromo-2,2':6',2' '-terpyridine and 4,4'-(diethoxycarbonyl)-2,2'-bipyridine. The dyads were studied by UV-visible absorption spectroscopy, steady-state fluorescence, and electrochemistry. The results of these studies indicate strong electronic coupling between the zinc phthalocyanine unit and the ruthenium complex but weakly electronically coupled systems in the case of dyads containing a difluoroborazaindacene unit. The new bichromophoric systems display strong absorbance in the visible spectrum. An efficient quenching of the fluorescence of the organic chromophore by the nearby ruthenium complex was also observed in all of the dyads. In dyads connected to the borazaindacene, excitation spectra indicate efficient photoinduced energy transfer from the borazaindacene to the ruthenium complex.

Synthesis, properties and gas phase collision-induced dissociation of the heptanuclear doubly bridged complex [Ru(bpy) 2(BPE) 2{Ru 3O(CH 3COO) 6(py) 2} 2](PF 6) 4

The [Ru(bpy) 2(BPE) 2{Ru 3O(CH 3COO) 6(py) 2} 2](PF 6) 4 complex, in which bpy = 2,2′-bipyridine, BPE = trans-1,2- bis(4-pyridyl)ethylene and py = pyridine, provides an interesting case of a heptanuclear mixed compound containing two triangular [Ru 3O] clusters attached to a ruthenium polypyridine center. The composition and structural properties of this doubly bridged complex were investigated by means of electrospray mass (ESI-MS) and tandem mass (ESI-MS/MS) spectrometric experiments and NMR spectroscopy ( 1H and 13C). The characteristic multi-isotopic distribution, 1/4 m/ z peak separation and dissociation chemistry of the isotopologue [Ru(bpy) 2(BPE) 2{Ru 3O(CH 3COO) 6(py) 2} 2] 4+ cation provided detailed and unequivocal MS characterization of the complex. In the electronic spectra of the heptanuclear complex broad bands were observed at 427 and 696 nm, and ascribed, respectively, to [Ru(bpy) 2(BPE) 2] metal-to-ligand charge-transfer and to [Ru 3O] internal cluster transitions. The characteristic waves associated with the [Ru 3O] 1−/0/1+/2+/3+ redox couples were found at −1.02, 0.16, 1.20, 2.11 V (versus SHE) in the cyclic voltammograms. Another broad wave was observed at −1.22 V, involving superimposed bpy 0/− and BPE 0/1− redox processes, and a peculiar wave at 1.48 V, exhibiting only a half of the relative intensity, was assigned to the central Ru 3+/2+ redox pair. Despite the two conjugated BPE bridges, the electrochemical and spectroelectrochemical data indicated only a weak coupling through the π-system in the heptanuclear complex.

Interfacial properties of photovoltaic TiO 2/dye/PEDOT–PSS heterojunctions

Systems comprising a dense TiO 2 film electrode, a ruthenium polypyridine dye and a PEDOT–PSS (poly(3,4-ethylenedioxythiophene)–poly(4-styrenesulphonate)) film were prepared. The heterojunctions were shown to have photovoltaic properties, with the dye absorbing the light, the TiO 2 acting as an electron conducting material and PEDOT–PSS acting as a hole transport material. A series of dyes was used to investigate their influence on the photocurrent and the photovoltage characteristics of the heterojunction. These results were compared to a photoelectrochemical system in which the PEDOT–PSS was replaced by a liquid electrolyte containing triiodide/iodide redox-couple. Photoelectron spectroscopy (PES) was used to monitor the interfacial properties of the heterojunction and the investigation points out effects of importance when assembling the materials together to a functional unit. Specifically, it was concluded that the interaction with the dye clearly affects the structure of PEDOT–PSS, both with respect to the surface composition of PSS relative to PEDOT and with respect to the chemical state of the sulphur in the polymers. Moreover, a comparison of the Ru3d and the valence band spectra of the two different interfaces (dye/TiO 2 and dye/PEDOT–PSS) indicates that the energy level structure of the dyes compared to the substrate is different for the two surfaces. Thus, in the combined energy level picture under dark conditions, the energy levels in TiO 2 relative to the energy levels in PEDOT–PSS depend on the dye.

DNA Interactions with Ruthenium(II) Polypyridine Complexes Containing Asymmetric Ligands

In an attempt to probe nucleic acid structures, numerous Ru(II) complexes with different ligands have been synthesized and investigated. In this contribution we focus on the DNA-binding properties of ruthenium(II) complexes containing asymmetric ligands that have attracted little attention in the past decades. The influences of the shape and size of the ligand on the binding modes, affinity, enantioselectivities and photocleavage of the complexes to DNA are described.

Luminescent ruthenium(II) polypyridine biotin complexes: synthesis, characterization, photophysical and electrochemical properties, and avidin-binding studies.

Two luminescent ruthenium(II) polypyridine complexes containing a biotin moiety [Ru(bpy)(2)(L1)](PF(6))(2) (1) and [Ru(bpy)(2)(L2)](PF(6))(2) (2) (bpy = 2,2'-bipyridine; L1 = 4-(N-((2-biotinamido)ethyl)amido)-4'-methyl-2,2'-bipyridine; L2 = 4-(N-((6-biotinamido)hexyl)amido)-4'-methyl-2,2'-bipyridine) have been synthesized and characterized, and their photophysical and electrochemical properties have been studied. Upon photoexcitation, complexes 1 and 2 display intense and long-lived triplet metal-to-ligand charge-transfer ((3)MLCT) (dpi(Ru) --> pi*(L1 or L2)) emission in fluid solutions at 298 K and in low-temperature glass. We have studied the binding of these ruthenium(II) biotin complexes to avidin by 4'-hydroxyazobenzene-2-carboxylic acid (HABA) assays, luminescence titrations, competitive assays using native biotin, and quenching experiments using methyl viologen. On the basis of the results of these experiments, a homogeneous competitive assay for biotin has been investigated.

(trans-1,4-bis[(4-pyridyl)ethenyl]benzene)(2,2'-bipyridine)ruthenium(II) complexes and their supramolecular assemblies with beta-cyclodextrin.

Two novel ruthenium polypyridine complexes, [Ru(bpy)(2)Cl(BPEB)](PF(6)) and ([Ru(bpy)(2)Cl](2)(BPEB))(PF(6))(2) (BPEB = trans-1,4-bis[2-(4-pyridyl)ethenyl]benzene), were synthesized and their characterization carried out by means of elemental analysis, UV-visible spectroscopy, positive ion electrospray (ESI-MS), and tandem mass (ESI-MS/MS) spectrometry, as well as by NMR spectroscopy and cyclic voltammetry. Cyclic and differential pulse voltammetry for the mononuclear complex showed three set of waves around 1.2 V (Ru(2+/3+)), -1.0 V (BPEB(0/)(-)), and -1.15 (BPEB(-/2-)). This complex exhibited aggregation phenomena in aqueous solution, involving pi-pi stacking of the planar, hydrophobic BPEB ligands. According to NMR measurements and variable-temperature experiments, the addition of beta-cyclodextrin (betaCD) to [Ru(bpy)(2)Cl(BPEB)](+) leads to an inclusion complex, breaking down the aggregated array.

Mixed-valence properties of Ruthenium–Polypyridine dimers bridged by Imidazolate and Triazolate Ligands

The dinuclear complex cis,cis-[(bpy)2ClRu(μ-bim)RuCl(bpy)2] n + (bpy = 2,2′-bipyridine; bim = benzimidazolate; n = 1, 2, or 3) was synthesized, isolated as a hexafluorophosphate salt, and investigated in organic solutions by cyclic voltammetry and UV/visible/NIR spectroelectrochemistry. The mixed-valent species (n = 2) displays significant metal–metal electronic coupling in the ground state but exhibits localized Ru(III) and Ru(II) oxidation states, as deduced from its intervalence charge transfer (IVCT) band and redox parameters. On the basis of the resonance energy (H AB) estimated in the context of Hush's semiclassical theory, the extent of intermetallic communication was found to be larger than that recently reported for the bta-bridged analog (bta = benzotriazolate). Some differences between the IVCT features of these systems have been rationalized in terms of the degree of σ,π-basic character of the bridging ligands, according to an electron superexchange mechanism of the “hole-transfer” type. The stabilization of the mixed-valent complexes is attributed mainly to cooperative metal-to-ligand/ligand-to-metal charge-transfer effects. The combined π-acceptor and σ,π-donor abilities of the ancillary (bpy) and bridging (bim or bta) ligands, respectively, are also responsible for the high stability of the fully oxidized (RuIII–L–RuIII) and fully reduced (RuII–L–RuII) isovalent species.

Room-Temperature Photochromism in cis- and trans-[Ru(bpy)2(dmso)2]2+

We report on phototriggered Ru-S --> Ru-O and thermal Ru-O --> Ru-S intramolecular linkage isomerizations in cis- and trans-[Ru(bpy)2(dmso)2]2+. The cis complex features only S-bonded sulfoxides (cis-[S,S]), whereas the trans isomer is characterized by S- and O-bonded dmso ligands. Both cis-[S,S] and trans-[S,O] exhibit photochromism at room temperature in dmso solution and ionic liquid (IL). Rates of reaction in IL were monitored by UV-visible spectroscopy and are similar to those reported in dmso solution (k(O-->S) ranges from approximately 10(-3) to 10(-4) s(-1)). Cyclic voltammetric measurements of cis-[S,S] and trans-[S,O] are consistent with an electrochemically triggered linkage isomerism mechanism. While both cis-[S,S] and trans-[S,O] are photochromic at room temperature, neither complex is emissive. However, upon cooling to 77 K, cis-[S,S] exhibits LMCT (ligand-to-metal charge transfer) emission typical of many ruthenium polypyridine complexes. In contrast to cis-[S,S], trans-[S,O] does not show any detectable emission even at 77 K.

Electron donor-acceptor dyads based on ruthenium(II) bipyridine and terpyridine complexes bound to naphthalenediimide.

Two series of photosensitizer-electron acceptor complexes have been synthesized and fully characterized: ruthenium(II) tris(bipyridine) ([Ru(II)(bpy)(2)(bpy-X-NDI)], where X = -CH(2)-, tolylene, or phenylene, bpy is 2,2'-bipyridine, and NDI is naphthalenediimide) and ruthenium(II) bis(terpyridine) ([Ru(II)(Y-tpy)(tpy-X-NDI)], where Y = H or tolyl and X = tolylene or phenylene, and tpy = 2,2':6',2' '-terpyridine). The complexes have been studied by cyclic and differential pulse voltammetry and by steady state and time-resolved absorption and emission techniques. Rates for forward and backward electron transfer have been investigated, following photoexcitation of the ruthenium(II) polypyridine moiety. The terpyridine complexes were only marginally affected by the linked diimide unit, and no electron transfer was observed. In the bipyridine complexes we achieved efficient charge separation. For the complexes containing a phenyl link between the ruthenium(II) and diimide moieties, our results suggest a biphasic forward electron-transfer reaction, in which 20% of the charge-separated state was formed via population of the naphthalenediimide triplet state.

Linkage isomerism and redox properties of ruthenium-polypyridine benzotriazole complexes

A new series of mono- and di-substituted ruthenium–polypyridine complexes of the type cis-[RuIII,II (bpy)2(L1)(L2)] n + (L1 = Cl−, bta or py; L2 = bta; bpy = 2,2′-bipyridine; bta = benzotriazole; py = pyridine) has been prepared, isolated as hexafluorophosphate salts, and investigated in organic solutions by means of cyclic voltammetry and spectroelectrochemistry. The chemical oxidation of all the benzotriazole derivatives, starting from cis-[RuII(bpy)2(L1)(bta)] x (x = +1 or +2), leads essentially to N(3)-bound products, i.e., cis-[RuIII(bpy)2 (L1)(κN(3){bta})]x+1 isomers. Nevertheless, while the benzotriazole-monosubstituted species undergoes an intramolecular isomerization, κN(3) → κN(2), accompanying the electrochemical reduction centered on the metal ion, RuIII → RuII, the disubstituted derivatives do not display any spectral or electrochemical evidence of linkage isomerism. The equilibrium and kinetic constants for the isomerization were determined from the cyclic voltammograms at several scan rates, according to an electrochemical–chemical (EC) coupling scheme. The data were compared with a set of constants and parameters obtained previously for a series of ruthenium and iron complexes. The experimental results were found to be quite consistent with theoretical calculations, and reflect the importance of π-backbonding interactions in the stabilization of the metal-centered reduced state (MII) on such species with low-spin dπ6 configuration.

RAFT synthesis of linear and star-shaped light harvesting polymers using di- and hexafunctional ruthenium polypyridine reagents

The syntheses of linear and star-shaped light harvesting polymers with well defined structure and narrow molecular weight distribution are described. These polymers have ruthenium polybipyridine moieties as the energy trap cores and styrene functionalized coumarin monomers as the light absorbing antenna chromophores. The polymers have been made by reversible addition–fragmentation chain transfer (RAFT) polymerisation using di- or hexafunctional ruthenium-containing RAFT agents. The resulting ruthenium-containing polymers have narrow molecular weight distribution (polydispersity < 1.1) and exhibit energy transfer efficiencies of up to 60% between the coumarin donor dyes and the ruthenium acceptor chromophores.