RNA Extraction Research Articles

Distribution and identification of Aedes mosquitoes, vectors of Dengue virus in Abéché, Chad

Aedes mosquitoes, vectors of dengue, chikungunya, Zika, and yellow fever, represent a significant threat to public health due to their role in transmitting these diseases. Their emergence in Chad, driven by increasing urbanization and demographic expansion, raises considerable concerns. The aim of this study is to better understand the diversity and the role of Aedes mosquitoes in dengue transmission in the city of Abéché, Chad. This is a cross-sectional study conducted over four months, from July to October 2024. Mosquitoes were collected using human bait techniques in nine neighborhoods of Abéché. The samples were then subjected to morphological identification, followed by viral RNA extraction and RT-PCR analysis to detect dengue virus. The results show that out of 370 mosquitoes captured, 85.9% (n = 318) belonged to Aedes genus, of which 95% (n = 305) were Aedes albopictus and 4.6% (n = 13) were Aedes aegypti. There is no evidence of dengue virus in all analyzed mosquitos’ samples. This study highlights the significant presence of Aedes mosquitoes, particularly Aedes albopictus, in the city of Abéché, Chad, where they constitute the dominant species. Despite their high abundance and known role as vectors of dengue, none of the analyzed mosquitoes tested positive for the dengue virus. These findings underscore the importance of continued entomological surveillance and further research to better understand the distribution, dynamics, and potential role of Aedes mosquitoes in disease transmission in Chad. Such efforts are crucial for developing effective vector control strategies and mitigating the risk of dengue outbreaks in the region.

First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (Syringa vulgaris L.) in France.

Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.

Beyond genomics: using RNA-seq from dried blood spots to unlock the clinical relevance of splicing variation in a diagnostic setting.

We aimed to assess the impact of splicing variants reported in our laboratory to gain insight into their clinical relevance. A total of 108 consecutive individuals, for whom 113 splicing variants had been reported, were selected for RNA-sequencing (RNA-seq), considering the gene expression in blood. A protocol was developed to perform RNA extraction and sequencing using the same sample (dried blood spots, DBS) provided for the DNA analysis, including library preparation and bioinformatic pipeline analysis. Splicing in genes of interest was inspected using IGV, with at least three unaffected individuals as controls. From the 113 variants, we confirmed an abnormal splicing in 64 variants (57%). In 15 variants (13%), we did not observe a splicing alteration. In the remaining 34 variants, no decision could be made on the splicing effect due to insufficient sample quality (21%) or a low number of reads (9%). The most common event leading to aberrant splicing was exon skipping, identified in 31 variants (48%). Other events included cryptic donor/acceptor site usage (n = 25; 39%), intron retention (n = 4; 6%), and other complex events (n = 4; 6%). In three patients, pathologically reduced enzymatic activity (measured using the same DBS) served as additional confirmation of the abnormal splicing caused by variants in HEXA, GAA, and GLA. We implemented an RNA-seq pipeline using the same sample provided for genomic testing. This multiomic approach, as implemented in our routine diagnostic processes, clarifies the clinical relevance of most of the analyzed variants and delivers more comprehensive genetic testing.

Wastewater-Based Epidemiological Surveillance in France: The SUM’EAU Network

Wastewater surveillance is a powerful public health tool which gained global prominence during the COVID-19 pandemic. This article describes the development and implementation of the national wastewater surveillance network in France: SUM’EAU. Preliminary work included defining a sampling strategy, evaluating/optimising analytical methods, launching a call for tenders to select network laboratories and producing wastewater monitoring indicators. SUM’EAU was then deployed in three stages: (i) a pilot study, (ii) the transfer of analytical activities from the National Reference Laboratory to four selected network laboratories, and (iii) the extension of the system to additional sampling sites. Currently, SUM’EAU monitors SARS-CoV-2 across 54 wastewater treatment plants in mainland France. Once a week on business days, 24 h flow-proportional composite samples are collected at plant inlets and transported at 5 °C (±3 °C) to partner laboratories for analysis. The analytical process involves sample concentration, RNA extraction, and digital RT-PCR/q-RT-PCR to detect and quantify the presence of the SARS-CoV-2 genome in wastewater. Subsequently, data are transferred to Santé publique France, the French National Public Health Agency, for analysis and interpretation. While SUM’EAU has been instrumental in monitoring the COVID-19 pandemic and holds significant potential for broader application, securing sustainable funding for its operation remains a major challenge.

Selective In Situ Analysis of Hepatogenic Exosomal microRNAs via Virus-Mimicking Multifunctional Magnetic Vesicles.

Drug-induced liver injury (DILI) is a common clinical problem with urgent respect to demanding early diagnosis. Exosomal miRNAs are reliable and noninvasive biomarkers for the early diagnosis of DILI. However, accurate and feasible detection of exosomal miRNAs is often hampered by the low abundance of miRNAs, inefficient exosome separation techniques, and the requirement for RNA extraction from large sample volumes. Here, the multifunctional magnetic vesicles are constructed by loading a multiple signal amplification detection system and magnetic nanoparticles into virus-mimicking engineered vesicles to achieve in situ analysis of hepatogenic exosomal miRNAs, which do not require miRNA extraction or target amplification. Virus-mimicking engineered vesicles carrying large surface proteins of hepatitis B virus are designed to achieve the specific identity and fusion of hepatogenic exosomes, and the multiple signal amplification detection system assembled by catalytic hairpin assembly technology and CRISPR/Cas13a technology can achieve highly sensitive in situ detection of miRNAs in exosomes with a low limit of detection (LOD) of 1.25×102 particles·µL-1. This novel nanoplatforms open a promising avenue for the early clinical diagnosis of DILI.

P0004 Transcriptomic profiling as a tool for prediction of endoscopic inflammation in quiescent Crohn's Disease patients

Abstract Background Biological agents have revolutionized therapy in Crohn's disease (CD), yet ~50% of patients do not respond / lose response to therapy. Therefore, patient-specific therapies are in critical need. Preliminary studies have demonstrated that transcriptomic analysis of fecal aspirates from the colon are associated with patients' inflammatory status1,2. CORE (Capsule & Omics for pRedicting Exacerbation of Crohn’s disease) is a highly defined prospective cohort of clinically non-active CD patients undergoing clinical and endoscopic serial evaluations at Sheba Medical Center (MC). Scarce data exists as to the association of small intestinal biopsies and fecal aspirates from the colon with small bowel inflammation status in quiescent CD. Methods As part of an ongoing prospective cohort study, a biobank of lower-GI biopsies and aspirates (e.g. fluids suctioned from the colon) from CD patients was established at Sheba MC between 2023-2024, along with comprehensive clinical, endoscopic and demographic data. Following RNA extraction and bulk RNA deep sequencing, transcriptomic analysis was performed for all biopsies and fecal aspirated and correlated with clinical and endoscopic data. Results 40 fecal aspirate samples and 50 biopsies were obtained and analyzed from 56 CD patients (median age: 32 years, 73% males). 63% had ileal disease, 5% had colonic disease and 32% had ileo-colonic disease. 48% were treated with Adalidumab, 7% with Infliximab, 16% with Vedolizumab, 12% with Ustekinumab and 17% were not treated with biologics. All patients were in clinical remission at time of analysis. 57% had endoscopically active disease per colonoscopy and 46% per capsule endoscopy. Figure 1 demonstrates the distinct spatial distribution of samples, demonstrating that gene expression variation is significantly associated with small bowel inflammation. 639 genes were significantly differentially expressed between fecal washes of patients with inflamed and non-inflamed small bowel (padj < 0.01). Hierarchical clustering dendrograms show distinct expression patterns that effectively separate inflamed from non-inflamed samples, underlying again a strong transcriptional signature associated with inflammation (Figure 2). The Silhouette score of 0.332, on a scale ranging from -1 to 1, demonstrates moderate clustering separation, validating our analytical approach. Conclusion Colonic fecal-aspirates yield a reliable transcriptomic profile, predicting small bowel inflammation, based on a panel of 639 genes, in quiescent CD. Further studies will enable us to build a PCR based model for prediction of small bowel inflammation in quiescent Crohn's disease.

P1002 Changes in circulating lymphocyte subsets and CCR9 transcripts as mechanistic biomarkers of the small molecule α4β7 inhibitor MORF-057 in patients with Ulcerative Colitis

Abstract Background MORF-057 is an orally administered, selective, and potent small molecule inhibitor of the cell surface receptor integrin a4b7. Upon binding to the a4b7 heterodimer, MORF-057 blocks the interaction of this integrin with the endothelial ligand mucosal vascular addressin cell adhesion molecule 1 (MAdCAM-1) which, in turn, prevents the extravasation of circulating lymphocytes into the intestinal mucosa. In this study, the pharmacodynamic effects of MORF-057 on immune cell trafficking were evaluated in UC patients using a flow cytometry-based assay and by assessing the expression of CCR9 gene in blood. Methods As part of the induction phase of an open-label, single-arm, Phase 2a study (NCT05291689) the efficacy, safety, and tolerability of MORF-057 in 35 patients with moderately to severely active UC disease were evaluated. Patients were treated with MORF-057 at a dose of 100 mg BID orally for an induction period of 12 weeks followed by a 40-week maintenance period. Blood was collected for peripheral blood mononuclear cell (PBMC) isolation and RNA extraction at baseline and post-treatment at Week 2, 6, 12, 20, 28, 36, 44, and 52. Using flow cytometry, levels of CD4+β7+ naïve, CD4+β7+ central memory (TCM), CD4+β7 Hi effector memory (TEM) T cells, and CD19+β7+ switched memory B cells (BSM) subpopulations were quantified as a percentage of the parent populations CD4 naive, TCM, TEM and BSM, respectively, then normalized to pre-treatment baseline. Expression of CCR9 mRNA in the blood was quantified as a fold ratio relative to baseline for the same timepoints. Statistical analyses were performed using the Wilcoxon Signed Rank test. Results The percentages of circulating lymphocyte subsets CD4+β7 Hi TEM cells, CD4+β7+ TCM and CD19+β7+ BSM were significantly elevated relative to baseline as early as Week 2 and up to Week 52 (Table 1). These changes were not observed in the overall lymphocyte counts nor in the CD4+β7+Naïve T cells (except at Week 52). The baseline-normalized expression levels of CCR9 at Weeks 12 and 52 were 1.6 [0.6] (mean [SD]) and 1.7 [0.8], respectively (Figure 1). Conclusion Patients receiving MORF-057 for a period of up to 52 weeks achieved statistically significant increases in specific β7+ lymphocyte subsets expressing ITGβ7. Elevated levels of the CCR9 transcript were observed in blood over the course of treatment. Effects observed were consistent with those reported for patients receiving biologic inhibitors of the same pathway as well as in healthy volunteers receiving MORF-0571,2. These changes in circulating lymphocyte populations and CCR9 transcript levels may be used as mechanistic biomarkers for MORF-057 in UC patients.

Protocol for recombinant rabies virus titration by quantitative PCR.

Preparing high-titer virus and performing accurate titer determination are criticalto subsequent experiments. However, not all applied recombinant rabies viruses, such as the L-deleted virus,1 are equipped with fluorescent proteins for titration by fluorescence-activated cell sorting (FACS). Here, we present a quantitative reverse-transcription PCR (RT-qPCR) approach for titrating recombinant rabies virus. We describe steps for preparing standards for RT-qPCR, rabies virus genome RNA extraction, and reverse transcription of virus RNA. We then detail procedures for RT-qPCR for titration and stereotaxic rabies virus injection for titer verification.

Predicting Survival Rates in Brain Metastases Patients from Non-Small Cell Lung Cancer Using Radiomic Signatures Associated with Tumor Immune Heterogeneity.

Non-small cell lung cancer (NSCLC) frequently metastasizes to the brain, significantly worsened prognoses. This study aimed to develop an interpretable model for predicting survival in NSCLC patients with brain metastases (BM) integrating radiomic features and RNA sequencing data. 292 samples are collected and analyzed utilizing T1/T2 MRIs. Bidirectional stepwise logistic regression is employed to identify significant variables, facilitating the construction of a prognostic model, which is benchmarked against four machine learning algorithms. BM tissue samples are processed for RNA extraction and sequencing. The optimal model achieved an AUC of 0.96 and a C-index of 0.89 in the train set and an AUC of 0.84 with a C-index of 0.78 in the test set, indicating strong predictive performance and generalizability. Patients from Xiangya Hospital are stratified into high-risk (n = 11) and low-risk (n = 30) groups. RNA sequencing revealed an enrichment of immune-related pathways, particularly the interferon (IFN) pathway in the low-risk group. Immune cell infiltration analysis identified a significant presence of CD8+-T cells, IFNγ-6/-18 in the low-risk group, suggesting an immunologically favorable tumor microenvironment. These findings highlight the potential of combining radiomic and RNA sequencing data for improved survival predictions and personalized treatment strategies in BM patients from NSCLC.

Comparative Study of Angiotensin Convertase Enzyme (ACE2) Gene Expression in Patients with Covid-19 By Molecular Method

Introduction: The Covid 19 illness is triggered by a coronavirus known as SARS CoV-2. This particular virus spreads rapidly likely because of the Spike proteins affinity, to the human ACE2 cell receptor causing harm to organs, like the lungs in type 2 pneumocytes that abundantly express this receptor. Materials and Methods: The research methodology used in this study involved a case control approach. Patients were referred by a specialist following diagnosis. A total of 50 samples, from infectious cases and 50 samples from cases, with mild symptoms were analyzed for statistical purposes. The ACE2 gene expression was assessed using the Realtime RCR method after RNA extraction. Results: The findings indicate that the average age does not have an impact on individuals experiencing mild symptoms. Moreover, there is a decrease in the expression of ACE2 genes in the blood of patients with severe symptoms hospitalized in intensive care units as compared to those, with mild symptoms, highlighting a substantial disparity. Conclusion: The numerical value of fold change for ACE2 gene in severe type patients shows a decrease compared to mild patients and it is 2.11 times lower in severe type patients than mild type.

The correlation between miR-21 single nucleotide polymorphisms and the susceptibility of non-small cell lung cancer

BackgroundThere are still gaps in the study of the miRNA and its SNPs in some diseases such as non-small cell lung cancer (NSCLC). The study aimed to provide useful information on the treatment of NSCLC by investigating the association between miR-21 and its SNPs and NSCLC susceptibility.MethodsThe serum of NSCLC patients (n = 205) and cancer-free controls (n = 217) were collected in this study for RNA extraction. The qRT-PCR was used to evaluate the expression of miR-21 and Taqman qPCR was used for genotyping and quantifying miR-21 SNPs (rs1292037, rs6504593). The association of the expression of miR-21, the miR-21 SNPs and their interactions with the susceptibility of NSCLC patients were analysed using logistic regression analysis in this study.ResultsThis study showed that the overexpression of miR-21 was related to NSCLC. The C allele and CC genotypes of rs1292037 and rs6504593 were associated with the increased risk of NSCLC susceptibility. Moreover, the interactions of rs1292037 and rs6504593 were also a risk factor for NSCLC. The CC genotypes of rs1292037 and rs6504593 were associated with the increase of miR-21 expression.ConclusionThe overexpression of miR-21, the miR-21 SNPs rs1292037 and rs6504593 and their interactions were associated with NSCLC susceptibility. MiR-21 and its SNPs have potential for being targets in the therapy of NSCLC. This study provided important information for the treatment of NSCLC.

Unravelling the TCRβ repertoire: a key to unlocking the immunopathogenesis and precision medicine in SLE

ObjectivesSLE is a multifaceted autoimmune disorder with a complex pathogenesis involving genetic, environmental and hormonal factors, which converge on immune dysregulation. The T cell receptor (TCR) repertoire’s role in SLE...

Rapid and specific on-site H5Nx avian influenza diagnosis via RPA and PAM-independent CRISPR-Cas12a assay combined with anti-NP antibody-based viral RNA purification

Rapid and accurate detection of H5Nx avian influenza viruses is critical for effective surveillance and control measures. Currently, RT-qPCR with spin column RNA extraction is the gold standard for HPAIV surveillance, but its long reaction time and need for specialized equipment limit its effectiveness for rapid response. In this study, we introduce a centrifuge-free, rapid detection method for on-site detection of H5Nx viruses that combines magnetic bead-based ribonucleoprotein (RNP) purification and concentration with a CRISPR-Cas12a system that is independent of the protospacer adjacent motif (PAM) sequence. Our approach employs anti-NP monoclonal antibodies for the targeted isolation of RNA bound to RNPs, facilitating a quick and specific RNA extraction process that negates the need for centrifugation. Additionally, by denaturing the RT-RPA amplicon using 60% DMSO, we activate the trans-ssDNA cleavage activity of the Cas12a protein without the need for a specific PAM (5’-TTTV-3′) sequence. This strategy increases flexibility in CRISPR RNA design, providing a significant advantage when targeting genes with high variability. We validated the efficacy of our magnetic RNP purification and concentration method in combined with an RT-RPA/PAM-independent Cas12a assay for detecting the H5 gene. The assay achieved a sensitivity threshold of 101 EID50 with fluorescent detection and 102 EID50 using lateral flow strips. It also exhibited high specificity, yielding positive results solely for H5Nx viruses among various influenza A virus subtypes. Furthermore, in clinical samples, the assay demonstrated 80% sensitivity and 100% specificity. These results highlight the advantages of using NP-specific antibodies for RNP purification and CRISPR-Cas12a with viral gene-specific crRNA to achieve exceptional diagnostic specificity.

DNA Methyltransferase Expression (DNMT1, DNMT3a, and DNMT3b) as a Potential Biomarker in Age-Related Macular Degeneration.

Background/Objectives: Age-related macular degeneration (AMD) is a global cause of vision loss, with limited therapeutic options highlighting the need for effective biomarkers. This study aimed to characterize plasma DNA methyltransferase expression (DNMT1, DNMT3A, and DNMT3B) in AMD patients and explore divergent expression patterns across different stages of AMD. Methods: Thirty-eight AMD patients were prospectively enrolled and stratified by disease severity: eAMD, iAMD, nAMD, and aAMD. Comprehensive ophthalmological assessments were performed, including best-corrected visual acuity, digital color fundus photographs, and Spectral Domain Optical Coherence Tomography. Peripheral blood samples were collected for RNA extraction and qRT-PCR to access epigenetic effectors' transcriptional expression, namely DNMT1, DNMT3A, and DNMT3B genes. The collected data were analyzed using IBM SPSS 29. Results:DNMT1 expression was significantly downregulated in late AMD (-0.186 ± 0.341) compared to early/intermediate AMD (0.026 ± 0.246). Within late AMD, aAMD exhibited a marked downregulation of DNMT1 (-0.375 ± 0.047) compared to nAMD (0.129 ± 0.392). DNMT3A and DNMT3B showed similar divergent expression patterns, correlating with disease stage. Conclusions: This study identified stage-specific transcriptional differences in DNMT expression, emphasizing its potential as a biomarker for AMD progression and a target for future research into personalized therapeutic strategies.

HIV-1 drug resistance and genetic transmission networks among patients with sexually transmitted HIV in Ningxia, China

BackgroundOver the past decade, sexual transmission has become a dominant source of new HIV-1 infection in China. However, very few studies have been conducted to characterize the two sexual transmissions, homosexual and heterosexual transmission. This study was conducted to better understand the relationship between genotypes, drug resistance, and molecular transmission networks in two groups of sexually transmitted HIV-1 in Ningxia, China.MethodsPlasma samples were collected from sexually transmitted HIV/AIDS patients in Ningxia between 2020 and 2021 for RNA extraction followed by HIV-1 genome sequencing, genotype and drug resistance analyses. The TN93 model in HyPhy2.2.4 with 1.25% as the threshold, was used to calculate the gene distance, and Cytoscape3.7.0 was used to generate a visual molecular transmission network.ResultsA total of 269 samples were successfully sequenced, and 10 HIV-1 subtypes were detected. The two most common subtypes were CRF07_BC and CRF01_AE. All 10 subtypes were detected in heterosexually transmitted patients, and 7 subtypes were found in homosexually transmitted patients who were exclusively men sex with men (MSM). The drug resistance rates of heterosexual individuals and MSMs were 45.34 and 33.33%, respectively. Sequences from 120 patients entered the molecular transmission network, forming 35 clusters. The clustering rate for MSM (52.78%) was higher than that of heterosexual individuals (39.13%). Some MSM and HSTs were involved in the same cluster and might act as bridges for transmission between the two populations.ConclusionOur data showed that heterosexually transmitted HIV-1 was more likely to be a drug-resistant virus, whereas MSM was more likely to contract viruses through network connection. It is strongly recommended that resistance testing be conducted before ART to improve effective treatment and reduce the spread of resistant viruses. Molecular networks can help to identify transmission clusters and provide more precise interventions.

Diagnostic performance of microRNAs for predicting response to transarterial chemoembolization in hepatocellular carcinoma: a meta-analysis.

To provide a detailed pooled analysis of the diagnostic accuracy ofmicroRNAs (miRNAs) in predicting the response to transarterial chemoembolization (TACE) in hepatocellular carcinoma (HCC). A comprehensive literature search was conducted across PubMed, Embase, Cochrane Library, and Web of Science to identify studies assessing the diagnostic performance of miRNAs in predicting TACE response in HCC. Two independent reviewers performed quality assessment and data extraction using the Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. Pooled sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR), and the area under the summary receiver operating characteristic (SROC) curve were calculated using a bivariate random-effects model. Subgroup analyses and meta-regression were performed to explore potential sources of heterogeneity, including sample size, response criteria, specimen source, response evaluation methods, TACE efficacy interval window, and geographical location. Seven studies, comprising 320 HCC responders and 187 non-responders, were included in this meta-analysis. The miRNAs studied included miR-373, miR-210, miR-4492, miR-1271, miR-214, miR-133b, and miR-335. The pooled sensitivity of miRNAs in predicting recurrence after TACE was 0.79 [95% CI: 0.72-0.84], and the pooled specificity was 0.82 [95% CI: 0.74-0.88]. The DOR was 17 [95% CI: 9-33], and the pooled area under the SROC curve (AUC) was 0.85 [95% CI: 0.81-0.88], indicating excellent diagnostic accuracy. Subgroup analyses revealed significant differences in diagnostic performance based on response criteria and geographical location. Meta-regression did not identify any significant sources of interstudy heterogeneity. MiRNAs show promise as diagnostic tools for predicting TACE response in HCC patients. However, their clinical application requires further validation in larger cohorts. Future research should focus on standardizing RNA extraction methods, selecting consistent endogenous controls, and adopting uniform response evaluation criteria to improve reliability and reduce variability.

Effective Mixed-Type Tissue Crusher and Simultaneous Isolation of RNA, DNA, and Protein from Solid Tissues Using a TRIzol-Based Method

One of the major challenges of studying biomarkers in tumor samples is the low quantity and quality of isolated RNA, DNA, and proteins. Additionally, the extraction methods ideally should obtain macromolecules from the same tumor biopsy, allowing better-integrated data interpretation. In this work, an in-house, low-cost, mixed-type tissue crusher combining blade and beating principles was made and the simultaneous isolation of macromolecules from human cells and tissues was achieved using TRIzol. RT-qPCR, genotyping, SDS-PAGE, and Western blot analysis were used to validate the approach. For tissue samples, RNA, DNA, and proteins resulted in an average yield of 677 ng/mg, 225 ng/mg, and 1.4 µg/mg, respectively. The same approach was validated using cell lines. The isolated macromolecule validation included the detection of mRNA levels of ATP-binding cassette (ABC) transporters through RT-qPCR, genotyping of TNFR1 (rs767455), and protein visualization through SDS-PAGE following Coomassie blue staining and Western blot. This work contributed to filling a gap in knowledge about TRIzol efficiency for the simultaneous extraction of RNA, DNA, and proteins from a single human tissue sample. A low-cost, high yield, and quality method was validated using target biomarkers of multidrug resistance mechanisms. This approach might be advantageous for future biomarker studies using different tissue specimens.

Detection of SARS-CoV-2 and a possible variant in shelter cats.

SARS-CoV-2 is the cause of mild to severe acute respiratory disease that led to significant loss of human lives worldwide between 2019 and 2022. The virus has been detected in various animals including cats and dogs making it a major public health concern and a One Health issue. In this study, conjunctival and pharyngeal swabs (n = 350) and serum samples (n = 350) were collected between July and December 2020 from cats that were housed in an animal shelter and tested for the infection of SARS-CoV-2 using real time reverse-transcription polymerase chain reaction (rRT-PCR) that targeted the N1 and N2 genes, and a SARS-CoV-2 surrogate virus neutralization Test (sVNT), respectively. 203 (58%) swab samples were negative (N1 and N2 not detected), 2 (0.6%) were positive (N1 and N2 detected) and 145 (41%) were inconclusive (only N1 detected). Analysis of the N2 region and multiple sequence alignment revealed base-pair deletions and substitutions in the N2 probe binding region of the feline samples RNA extracts in comparison with the positive control and human SARS-CoV-2 sequences in the GenBank database. Substituting the N2 probe with a probe derived from the cat sample amplicon sequences, 123 of 127 (96.9%) of the N2 negative samples returned positive. All but one of the 350 serum samples were negative for SARS-CoV-2 antibody. These observations indicated that although detection of SARS-CoV-2 infection was low in the samples tested, pet cats can harbor the virus and serve as potential source for virus spread that may lead to human infections. Additionally, cats may harbor a yet-to-be described virus that is somewhat related to SARS-CoV-2.

LncRNA SERPINB9P1 Mitigates Cerebral Injury Induced by Oxygen‒Glucose Deprivation/Reoxygenation by Interacting with HSPA2.

Dysregulation of long non-coding RNAs (lncRNAs) is implicated in the pathophysiology of ischemic stroke (IS). However, the molecular mechanism of the lncRNA SERPINB9P1 in IS remains unclear. Our study aimed to explore the role and molecular mechanism of the lncRNA SERPINB9P1 in IS. This study revealed downregulation of the lncRNA SERPINB9P1 in the peripheral blood of IS patients, which was corroborated by the GSE140275 dataset. Furthermore, high lncRNA SERPINB9P1 expression was associated with lower National Institutes of Health Stroke Scale (NIHSS) scores and favorable outcome. Clinically, lncRNA SERPINB9P1 expression was correlated with inflammation and coagulation parameters in IS patients. Furthermore, lncRNA SERPINB9P1 silencing inhibited cell viability, induced apoptosis and inflammatory response under oxygen-glucose deprivation/reperfusion ; however, these effects were reversed upon its overexpression. Additionally, Chromatin Isolation by RNA Purification and mass spectrometry (CHIRP-MS) and western blot confirmed that the lncRNA SERPINB9P1 was involved in the pathological process of IS through binding to heat shock protein 2 (HSPA2). HSPA2 was upregulated in IS patients, and its protein interaction network was significantly enriched in IS-related pathways. In conclusion, the lncRNA SERPINB9P1 may ameliorate neurological injury in IS patients by interacting with the HSPA2 protein and engaging in IS-related pathways, providing new insights into treatment strategies for IS.

Protocol for detecting eDNA in ecological rare fish using RPA-CRISPR-Cas12a technology.

The recombinase polymerase amplification (RPA)-CRISPR-Cas12a-FQ system enables sensitive detection of environmental DNA (eDNA) in rare fish species. Here, we present a protocol for eDNA amplification and Cas12a for target recognition using RPA. We describe steps for identifying a target site, synthesis and purification of CRISPR RNA (crRNA), and RPA isothermal amplification. We then detail procedures for constructing the eDNA CRISPR-Cas12a detection system and verifying its sensitivity. This protocol offers a high-sensitivity approach for monitoring aquatic biodiversity and conservation efforts, even in low eDNA concentrations. For complete details on the use and execution of this protocol, please refer to Wei etal.1.