Real-time Reverse transcription-PCR Assay Research Articles

Characterization of the RpoN regulon reveals the regulation of motility, T6SS2 and metabolism in Vibrio parahaemolyticus.

Vibrio parahaemolyticus is a foodborne pathogen that can colonize the small intestine of the host and cause diarrhea. The alternative sigma factor RpoN plays a vital role in regulating motility, carbon utilization and affects host colonization in V. parahaemolyticus RIMD2210633. In this study, transcriptome and phenotypic analysis further expanded our understanding of the RpoN regulon in V. parahaemolyticus. A deletion mutant of rpoN (ΔrpoN) was subjected to RNA-seq for systemic identification of the RpoN-controlled genes. Compared with the wild-type (WT), 399 genes were differentially expressed in the ΔrpoN strain. Moreover, 264 genes were down-regulated in the ΔrpoN strain, including those associated with nitrogen utilization (VP0118), glutamine synthetase (VP0121), formate dehydrogenase (VP1511 and VP1513-VP1515), quorum sensing (opaR and luxZ), polar flagellar systems, and type VI secretion system 2 (T6SS2). Quantitative real-time reverse transcription PCR (qRT-PCR) and electrophoretic mobility shift assay (EMSA) further confirmed that RpoN could directly bind to the promoters of these genes associated with polar flagellar systems (flgB and fliE), lateral flagellar systems (flgB2 and lafA), T6SS2 (hcp2 and VPA1044) and glutamine synthetase (VP0121), and then positively regulate the expression of these systems. A RpoN-binding motif was identified in V. parahaemolyticus using the MEME suite and verified by the EMSA. Besides, the deletion of rpoN caused a significant decrease in hemolytic activity, adhesion, and cytotoxicity. Our results provide new cues to better understand the regulatory networks of RpoN protein to motility, T6SS2, and metabolism in V. parahaemolyticus.

Matrix-Encoding Gene Diversity of 624 Influenza A/H3N2 Genomes Does Not Show Association with Impaired Viral Detection by Commercialized qPCR Assays

As for the case of SARS-CoV-2, genome sequencing of influenza viruses is of potential interest to raise and address virological issues. Recently, false-negativity of real-time reverse transcription-PCR (qPCR) assays that detect influenza A/H3N2 virus RNA were reported and associated with two mutations (A37T and C161T) in the Matrix-encoding (M1) gene located on viral segment 7. This triggered a national alert in France. The present study sought to assess the association between the presence of these mutations and potential false negative results of influenza A/H3N2 virus RNA detection by commercialized qPCR assays at the clinical virology laboratory of our university hospitals in southern France. This study focused on the genetic diversity in the M1 gene and segment 7 of 624 influenza A/H3N2 virus genomes obtained from respiratory samples having tested qPCR-positive with M1 gene-targeting assays in our clinical virology laboratory. A total of 585 among the 624 influenza A/H3N2 virus genomes (93.7%) were of clade 3C.2a1b.2a.2, and 39 (6.3%) were of clade 3C.2a1b.1a. M1 gene substitutions A37T and C161T were both present in 582 (93.3%) genomes, only of clade 3C.2a1b.2a.2. Substitution A37T was present in 621 (99.5%) genomes. Substitution C161T was present in 585 genomes (93.8%), all of clade 3C.2a1b.2a.2. Moreover, 21 other nucleotide positions were mutated in ≥90% of the genomes. The present study shows that A37T/C and C161T mutations, and other mutations in the M1 gene and segment 7, were widely present in influenza A/H3N2 virus genomes recovered from respiratory samples diagnosed qPCR-positive with commercialized assays.

Development and Validation of a Novel COVID-19 nsp8 One-Tube RT-LAMP-CRISPR Assay for SARS-CoV-2 Diagnosis.

Accurate and simple diagnostic tests for coronavirus disease 2019 (COVID-19) are essential components of the pandemic response. In this study, we evaluated a one-tube reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay coupled with clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein-mediated endpoint detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) RNA in clinical samples. RT-LAMP-CRISPR is fast and affordable, does not require bulky thermocyclers, and minimizes carryover contamination risk. Results can be read either visually or with a fluorometer. RT-LAMP-CRISPR assays using primers targeting a highly expressed nsp8 gene and previously described nucleocapsid (N) gene primers were designed. The analytical characteristics and diagnostic performance of RT-LAMP-CRISPR assays were compared to those of a commercial real-time RT-PCR E gene assay. The limits of detection (LODs) of the nsp8 and N RT-LAMP-CRISPR assays were 750 and 2,000 copies/mL, which were higher than that of the commercial real-time RT-PCR assay (31.3 copies/mL). Despite the higher LOD, RT-LAMP-CRISPR assays showed diagnostic sensitivity and specificity of 98.6% and 100%, respectively, equivalent to those of the real-time RT-PCR assay (P = 0.5). The median fluorescence reading from the nsp8 assay (378.3 raw fluorescence unit [RFU] [range, 215.6 to 592.6]) was significantly higher than that of the N gene assay (342.0 RFU [range, 143.0 to 576.6]) (P < 0.0001). In conclusion, we demonstrate that RT-LAMP-CRISPR assays using primers rationally designed from highly expressed gene targets are highly sensitive, specific, and easy to perform. Such assays are a valuable asset in resource-limited settings. IMPORTANCE Accurate tests for the diagnosis of SARS-CoV-2, the virus causing coronavirus disease 2019 (COVID-19), are important for timely treatment and infection control decisions. Conventional tests such as real-time reverse transcription-PCR (RT-PCR) require specialized equipment and are expensive. On the other hand, rapid antigen tests suffer from a lack of sensitivity. In this study, we describe a novel assay format for the diagnosis of COVID-19 that is based on principles of loop-mediated isothermal amplification (LAMP) and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas chemistry. A major advantage of this assay format is that it does not require expensive equipment to perform, and results can be read visually. This method proved to be fast, easy to perform, and inexpensive. The test compared well against an RT-PCR assay in terms of the ability to detect SARS-CoV-2 RNA in clinical samples. No false-positive test results were observed. The new assay format is ideal for SARS-CoV-2 diagnosis in resource-limited settings.

Differences in COVID-19 mortality in males and females: Is estrogen hormone attributing to sex differences?

Objectives: Globally, the case fatality ratio is more in males versus females. Some studies have suggested estrogen hormone decreases susceptibility to SARS CoV-2. We have analyzed the observed sex differences in COVID-19 behavior in males and females and the clinical profiles of females of different age groups of COVID-19 patients and discussed their symptoms, laboratory evaluations, and associated comorbidities. Material and Methods: The patients were tested for COVID-19 through real-time RT-PCR (Reverse Transcription Polymerase Chain Reaction) assay. The data obtained were studied for the epidemiological, clinical, and laboratory characteristics from their medical records. Results: The mortality rate in females was 12.33% (36/292) whereas mortality in males was 19.63% (84/428). In between group analysis, 8.7% (14/161) of females died in the &lt;40 years age group versus 16.8% (22/131) in more than 40 years age group whereas in males, the mortality was 13.7% (21/153) in &lt;40 years versus 22.9%(63/275). The mortality rate in women older than 40 years was greater than mortality in younger females emphasizing the protection provided by estrogen hormone in them. The proportion of patients who expired due to COVID-19 significantly differs by age cutoff of 40 years, X2 (1, n = 428). The difference is statistically significant at P &lt; 0.05. Males more than 40 years are more likely to expire. Conclusion: Sex-related differences in coronavirus pandemic have been found pointing toward the protective role of estrogen hormone and other differences in immunological behavior in males and females. Downregulation of ACE2 expression, thereby reducing viral entry, might also be contributory to decreasing mortality in females.

Diagnostic evaluation of nCoV-QS, nCoV-QM-N, and nCoV-OM detection kits based on rRT-PCR for detection of SARS-CoV-2 in Ecuador

BackgroundEcuador was harshly impacted by COVID-19, in the region was the epicenter of the pandemic with the highest mortality rates and with the lowest rates of processed samples. Real-time reverse transcription PCR assays are essential to identify and manage the SARS-CoV-2 outbreak. Because of the global emergency, in Ecuador several commercial kits were introduced for use without clinical validation. In this manner, having the need to perform an evaluation with clinical samples before use for population screening. ObjectiveThis study aimed to evaluate the diagnostic performance of the nCoV-QS, nCoV-QM-N, nCoV-OM detection kits lately available in Ecuador, against the LightMix E/RdRp kit using nasopharyngeal swab (NPS) samples. Materials and methods198 nasopharyngeal samples were used (66 fresh NPS and 132 RNA stored samples). All samples were analyzed for SARS-CoV-2 with nCoV-QS, nCoV-QM-N, nCoV-OM detection kits and compared the concordance (Cohen's Kappa index, positive percentage agreement and negative percentage agreement) to LightMix E/RdRp as reference detection kit. ResultsThe 198 samples presented strong concordance (96% nCoV-QM-N, 100% nCoV-OM and 100% nCoV-QS). The individual performance of each gene showed that the nCoV-OM kit had a higher number of samples detected with the ORF3a (52.5%) and N (53.5%) genes. The combined genes demonstrated that ORF3a/N of nCoV-OM and nCoV-QS kits presented a higher percentage of detection with 52.5% and 48.5%, respectively. Finally, the detection rate and cycle threshold were not different between ORF3a, N, and E target genes. ConclusionThe nCoV-QS, nCoV-QM-N, and nCoV-OM Detection kits have comparable diagnostic performance to the emergency approved LightMix E/RdRp kit for SARS-CoV-2 detection in suspected COVID-19 patients.

Current State of Molecular and Serological Methods for Detection of Porcine Epidemic Diarrhea Virus.

Porcine epidemic diarrhea virus (PEDV), a member of the Coronaviridae family, is the etiological agent of an acute and devastating enteric disease that causes moderate-to-high mortality in suckling piglets. The accurate and early detection of PEDV infection is essential for the prevention and control of the spread of the disease. Many molecular assays have been developed for the detection of PEDV, including reverse-transcription polymerase chain reaction (RT-PCR), real-time RT-PCR (qRT-PCR) and loop-mediated isothermal amplification assays. Additionally, several serological methods have been developed and are widely used for the detection of antibodies against PEDV. Some of them, such as the immunochromatography assay, can generate results very quickly and in field conditions. Molecular assays detect viral RNA in clinical samples rapidly, and with high sensitivity and specificity. Serological assays can determine prior immune exposure to PEDV, can be used to monitor the efficacy of vaccination strategies and may help to predict the duration of immunity in piglets. However, they are less sensitive than nucleic acid-based detection methods. Sanger and next-generation sequencing (NGS) allow the analysis of PEDV cDNA or RNA sequences, and thus, provide highly specific results. Furthermore, NGS based on nonspecific DNA cleavage in clustered regularly interspaced short palindromic repeats (CRISPR)–Cas systems promise major advances in the diagnosis of PEDV infection. The objective of this paper was to summarize the current serological and molecular PEDV assays, highlight their diagnostic performance and emphasize the advantages and drawbacks of the application of individual tests.

Differential gene expression analysis of common target genes for the detection of SARS-CoV-2 using real time-PCR

COVID-19 currently is the main cause of the severe acute respiratory disease and fatal outcomes in human beings worldwide. Several genes are used as targets for the detection of SARS-CoV-2, including the RDRP, N, and E genes. The present study aimed to determine the RDRP, N, and E genes expressions of SARS-CoV- 2 in clinical samples. For this purpose, 100 SARS-CoV-2 positive samples were collected from diagnostic laboratories of Mazandaran province, Iran. After RNA extraction, the real-time reverse transcription PCR (real-time RT-PCR) assay was performed for differential gene expressions’ analysis of N, E, and RDRP. The threshold cycle (Ct) values for N, RDRP, and E targets of 100 clinical samples for identifying SARS-CoV-2 were then evaluated using quantitative real-time PCR (qRT-PCR). This result suggests N gene as a potential target for the detection of the SARS-CoV‐2, since it was observed to be highly expressed in the nasopharyngeal or oropharynges of COVID-19 patients (P < 0.0001). Herein, we showed that SARS-CoV- 2 genes were differentially expressed in the host cells. Therefore, to reduce obtaining false negative results and to increase the sensitivity of the available diagnostic tests, the target genes should be carefully selected based on the most expressed genes in the cells.

Genetic diversity of porcine reproductive and respiratory syndrome virus and evaluation of three one-step real-time RT-PCR assays in Korea

BackgroundPorcine reproductive and respiratory syndrome virus (PRRSV) has caused huge economic losses in the global swine industry. Frequent genetic variations in this virus cause difficulties in controlling and accurately diagnosing PRRSV.MethodsIn this study, we investigated the genetic characteristics of PRRSV-1 and PRRSV-2 circulating in Korea from January 2018 to September 2021 and evaluated three one-step real-time reverse transcription polymerase chain reaction (RT-PCR) assays.ResultsA total of 129 lung samples were collected, consisting of 47 samples for PRRSV-1, 62 samples for PRRSV-2, and 20 PRRSV-negative samples. Nucleotide sequence analysis of open reading frames (ORFs) 5, ORF6, and ORF7 genes from PRRSV samples showed that PRRSV-1 belonged to subgroup A (43/47, 91.49%) and subgroup C (4/47, 8.51%), whereas PRRSV-2 was classified as lineage 1 (25/62, 40.32%), Korean lineage (Kor) C (13/62, 20.97%), Kor B (10/62, 16.13%), lineage 5 (9/62, 14.52%), and Kor A (5/62, 8.06%). Amino acid sequence analysis showed that the neutralizing epitope and T cell epitope of PRRSV-1, and the decoy epitope region and hypervariable regions of PRRSV-2 had evolved under positive selection pressure. In particular, the key amino acid substitutions were found at positions 102 and 104 of glycoprotein 5 (GP5) in some PRRSV-2, and at positions 10 and 70 of membrane protein (M) in most PRRSV-2. In addition, one-step real-time RT-PCR assays, comprising two commercial tests and one test recommended by the World Organization for Animal Health (OIE), were evaluated.ConclusionThe results revealed that two of the real-time RT-PCR assays had high sensitivities and specificities, whereas the real-time RT-PCR assay of the OIE had low sensitivity due to mismatches between nucleotides of Korean PRRSVs and forward primers. In this study, we genetically characterized recent PRRSV occurrences and evaluated three one-step real-time RT-PCR assays used in Korea.

Improvement of nested reverse transcription-polymerase chain reaction (RT-PCR) with high specificity and sensitivity detection of sapovirus in food matrix

Sapovirus (SaV) is a causative agent of human gastroenteritis in both community outbreaks and sporadic cases worldwide. Shellfish accumulate a variety of pathogens during filter feeding. In particular, the contamination of shellfish by SaV has caused several outbreaks. As reported previously, nested RT-PCR (nRT-PCR) has been widely used in clinical samples, but has not proven suitable for food samples, such as oysters. This study aimed to identify a primer set for the detection of SaV with high specificity and sensitivity in food samples. To accomplish this, primers were improved in RNA-dependent RNA polymerase (RdRp) regions of SaV whole genome sequences. The sensitivity of the improved nRT-PCR was 100–1000 times higher than that of previous nRT-PCR and > 10 times higher than that of the previous real-time RT-PCR assay. Notably, cross-reaction with other viruses or food matrices was not observed by the specificity test. This study improved the reliable primer set to detect SaV in various food matrices with high sensitivity.

Evaluation of interleukin-17 receptor(IL-17RA) gene expression in PBMCs of patients with premature coronaryartery disease.

Present study has been carried out to analyze the IL-17R gene expression in PBMCs of patients with premature coronary artery disease (CAD) in comparison to normal controls. Premature CAD results in disability and lack of quality of life over the years and consequent mortality.Cardiovascular disease (CVD) has global distribution. In 2022, CAD is the leading cause of mortality in the United States and Iran. IL-17 cytokine family plays an important role in promoting inflammation and producing pro-inflammatory cytokines, chemokines, and matrix metalloproteinases. Entirely, 60 subjects were entered into this examination. The case group consisted of 30 subjects with CAD as well as the control group which consisted of 30 healthy persons. The real-time quantitative reverse transcription PCR assay was used to find out, the relative expression (fold) level of IL-17R gene. Our findings indicated that, the relative expression (fold) level of IL-17R gene in the patients group showed an increased level as compared to the control group. The analysis of findingsobtained in this study showed that the patient group is significantly different from the control group regarding the IL-17R mRNA level (fold) (p = 0.035). It has been concluded that IL-17R plays an important role in the pathogenesis of CAD. It follows that superior understanding of IL-17/IL-17R signaling way will be vital for innovating novel therapeutic targets that will facilitate the designing of new drugs for the management of patients (Ref. 40).

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Transcriptome analysis revealed the role of capsular polysaccharides in desiccation tolerance of foodborne Staphylococcus aureus

Staphylococcus aureus (S. aureus) is a momentous factor affecting food safety. It can survive under long-term desiccation stress and contaminate foods that have intermediate to low water activities. However, the specific molecular mechanisms by which it survives and persists under low water activity stress are often overlooked. In this study, transcriptome analysis was applied to investigate the effect of desiccation stress on gene expression of S. aureus RMSA24, a food-borne S. aureus strain that was isolated from a raw milk sample. Results of transcriptome analysis showed that the mRNA levels of genes related to capsular polysaccharides (CPs) synthesis were significantly upregulated after desiccation treatment, which was further confirmed by real-time reverse transcription PCR assays. Furthermore, the results of colony count experiments demonstrated that the survival of CPs mutant was decreased compared with the wild type strain. And the biofilm formation ability of CPs mutant showed no difference compared with that of wild type according to biofilm formation assays. Those results indicated that CPs mutant decrease the resistance to desiccation in S. aureus RMSA24 via a biofilm-independent pathway. This study provides new evidence regarding the mechanisms of desiccation resistance of food-borne S. aureus and contributes to the prevention of food contamination caused by this bacterium.

Enhanced detection and serotyping of foot-and-mouth disease virus serotype O, A, and Asia1 using a novel multiplex real-time RT-PCR.

Rapid and accurate detection and serotyping of foot-and-mouth disease (FMD) virus (FMDV) is essential for implementing control policies against emergent FMD outbreaks. Current serotyping assays, such as VP1 reverse transcription-polymerase chain reaction (RT-PCR)/sequencing (VP1 RT-PCR/sequencing) and antigen detection enzyme-linked immunosorbent assay (ELISA), have problems with increasing serotyping failure of FMDVs from FMD outbreaks. This study was conducted to develop a multiplex real-time RT-PCR for specific detection and differential serotyping of FMDV serotype O, A, and Asia 1 directly from field clinical samples. Primers and probes were designed based on 571 VP1 coding region sequences originated from seven pools. Multiplex real-time RT-PCR using these primers and probes demonstrated serotype-specific detection with enhanced sensitivity compared to VP1 RT-PCR/sequencing for reference FMDV (n = 24). Complete serotyping conformity between the developed multiplex real-time RT-PCR and previous VP1 RT-PCR/sequencing was demonstrated using FMDV field viruses (n = 113) prepared in cell culture. For FMDV field clinical samples (n = 55), the serotyping rates of multiplex real-time RT-PCR and VP1 RT-PCR/sequencing were 92.7% (51/55) and 72.7% (40/55), respectively. Moreover, the developed multiplex real-time RT-PCR demonstrated improved FMDV detection (up to 33.3%) and serotyping (up to 67.7%) capabilities for saliva samples when compared with 3D real-time RT-PCR and VP1 RT-PCR/sequencing, during 10 days of challenge infection with FMDV serotype O, A, and Asia 1. Collectively, this study suggests that the newly developed multiplex real-time RT-PCR assay may be useful for the detection and differential serotyping of FMDV serotype O, A, and Asia 1 in the field.

Detection of SARS-CoV-2 VOC-Omicron using commercial sample-to-answer real-time RT-PCR platforms and melting curve-based SNP assays

ObjectivesThe World Health Organization (WHO) had designated the SARS-CoV-2 lineage B.1.1.529 as the new Variant of Concern Omicron (VOC-Omicron) on 26th November 20211. Real-time reverse transcription polymerase chain reaction (RT-PCR), single nucleotide polymorphisms (SNP) and whole genome sequencing (WGS) tests were widely employed to detect SARS-CoV-2 and its variant. Yet, the SARS-CoV-2 Omicron detection performance of commercial real-time RT-PCR platforms and SARS-CoV-2 spike SNP assays remain to be elucidated.MethodsIn the first part of this study, we evaluated the VOC-Omicron detection performance of three commercial RT-PCR sample-to-answer platforms i.e. Roche cobas® 6800/8800, Roche cobas® Liat®, and Cepheid GeneXpert® systems. The detection performances were compared to one commercial conventional real-time RT-PCR assay (TIB MOLBIOL LightMix Modular SARS and Wuhan CoV E-gene) and one in-house real-time RT-PCR assay targeting RNA-dependent RNA polymerase (RdRP) gene of SARS-CoV-2 in the WHO COVID-19 Reference Laboratory at Public Health Laboratory Services Branch, Centre for Health Protection, Department of Health, The Government of the Hong Kong Special Administrative Region. In the second part of this study, we evaluated the SNP detection performance of four TIB MOLBIOL melting curve-based assays (1. Spike S371L/S373P, 2. Spike E484A, 3. Spike E484K and 4. Spike N501Y) in clinical samples obtained from hospitalized COVID-19 patients in Hong Kong. The SNP results were compared to whole genome sequences generated by Illumina platform.ResultsThe VOC-Omicron detection limits of three commercial sample-to-answer assays were tested to be ≤ 2.35 Log10 dC/ml. The detection performances of the sample-to-answer platforms were comparable to the two tested conventional real-time RT-PCR assays. The test sensitivities of TIB MOLBIOL VirSNiP SARS-CoV-2 Spike S371L/S373P assay and the Spike E484A assays were 100% and 96.6% respectively and the test specificities of both assays were 100%. An aberrant melting peak at Tm 42-44°C was observed when the specimens with Omicron variant were tested with the TIB MOLBIOL VirSNiP SARS-CoV-2 Spike E484K assay. Notably, the TIB MOLBIOL VirSNiP SARS-CoV-2 Spike N501Y assay failed to detect the spike N501Y mutation of Omicron variant in the tested specimens.ConclusionsThe SARS-CoV-2 detection sensitivity of three commercial platforms, Roche cobas® 6800/8800, Roche cobas® Liat®, and Cepheid GeneXpert® systems were shown not to be impacted by the large number of mutations of VOC-Omicron. Also, the signature mutations i.e. Spike S371L/Spike S373P and Spike E484A in VOC-Omicron were correctly identified by the TIB MOLBIOL VirSNiP SARS-CoV-2 Spike S371L/S373P and VirSNiP SARS-CoV-2 Spike E484A assays. Unexpected findings including a shifted melting peak or absence of amplification curve/melting peak were observed when specimens with Omicron variant were tested with the TIB MOLBIOL VirSNiP SARS-CoV-2 Spike E484K assay and Spike N501Y assay, suggesting a potential alert for Omicron variant, prior confirmation by whole genome sequencing.

Irisin Protects Cerebral Neurons from Hypoxia/Reoxygenation via Suppression of Apoptosis and Expression of Pro-Inflammatory Cytokines

Background: Ischemic stroke is a major health issue that causes high incidents of morbidity and mortality worldwide. Irisin is an excise-induced protein that has exhibited pleiotropic properties. Accumulating evidence reveals its critical roles in the regulation of various cellular functions, including nervous system functions. This study aims to disclose the effect of irisin on rat cerebral neurons suffering from hypoxia/reoxygenation (H/R) treatment and to explore the potential underlying molecular mechanisms. Methods: The percentage of rat cerebral neuron cell death was determined by flow cytometry analysis and MTT assay. The expression levels of target genes were measured by western blotting and real-time quantitative reverse transcription PCR assay. Results: Our results demonstrated that irisin treatment substantially reduced H/R-induced apoptosis of rat cerebral neurons. Further investigation revealed that irisin treatment markedly decreased mitogen-activated protein kinase (MAPK) signaling pathway activation and suppressed pro-informatory cytokine expression in cerebral neurons with H/R challenge. Finally, we showed that the neuroprotective effect and anti-inflammatory effect of irisin were comparable with three MAPK signaling inhibitors. Conclusion: Irisin exerts profound neuroprotective and anti-inflammatory effects on H/R-stimulated cerebral neurons by inhibiting the MAPK signaling activation. Therefore, irisin may serve as a potential drug for the treatment of patients with ischemic stroke.

Comparison of RT-PCR, RT-LAMP, and Antigen Quantification Assays for the Detection of SARS-CoV-2

A rapid and simple alternative test to real-time reverse transcription-polymerase chain reaction (RT-PCR) is required for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) to help curb the spread of coronavirus disease (COVID-19). In the present study, we compared the RT-PCR method with chemiluminescent enzyme immunoassay (CLEIA) and reverse transcription loop-mediated isothermal amplification (RT-LAMP). We observed that the number of SARS-CoV-2 RNA copies and the CLEIA antigen quantification values were highly correlated. The detection limit for antigen quantification was 42.8 RNA copies for saliva samples and 23.4 copies for nasopharyngeal swab samples. For both purified RNA and purification-free crude RNA, the number of RNA copies and RT-LAMP threshold time (Tt) values were inversely correlated. RT-LAMP with purified RNA detected low copy numbers of RNA (5-50 copies), whereas fewer than 250 RNA copies could not be detected using crude RNA. CLEIA antigen quantification is potentially useful for large-scale screening, as it is compatible with high-throughput testing. RT-LAMP with crude RNA samples is applicable for rapid point-of-care testing because it can directly use patient specimens. It is important to select a diagnostic method that is simple and rapid when compared with RT-PCR, depending on the situation.

Duplex One-Step RT-qPCR Assays for Simultaneous Detection of Genomic and Subgenomic RNAs of SARS-CoV-2 Variants.

A hallmark of severe acute respiratory syndrome virus (SARS-CoV-2) replication is the discontinuous transcription of open reading frames (ORFs) encoding structural virus proteins. Real-time reverse transcription PCR (RT-qPCR) assays in previous publications used either single or multiplex assays for SARS-CoV-2 genomic RNA detection and a singleplex approach for subgenomic RNA detection. Although multiplex approaches often target multiple genomic RNA segments, an assay that concurrently detects genomic and subgenomic targets has been lacking. To bridge this gap, we developed two duplex one-step RT-qPCR assays that detect SARS-CoV-2 genomic ORF1a and either subgenomic spike or subgenomic ORF3a RNAs. All primers and probes for our assays were designed to bind to variants of SARS-CoV-2. In this study, our assays successfully detected SARS-CoV-2 Washington strain and delta variant isolates at various time points during the course of live virus infection in vitro. The ability to quantify subgenomic SARS-CoV-2 RNA is important, as it may indicate the presence of active replication, particularly in samples collected longitudinally. Furthermore, specific detection of genomic and subgenomic RNAs simultaneously in a single reaction increases assay efficiency, potentially leading to expedited lucidity about viral replication and pathogenesis of any variant of SARS-CoV-2.

Development of a duplex TaqMan real-time RT-PCR assay for simultaneous detection of goose astrovirus genotypes 1 and 2

Goose astrovirus (GAstV) is a novel pathogen that was discovered in 2018. It has two genotypes, GAstV-1 and GAstV-2, and both can cause visceral gout of goslings and result in significant economic losses. The present work aimed to develop a duplex TaqMan real-time quantitative reverse transcription PCR (RT-qPCR) assay to distinguish the two genotypes. MegAlign software was used to design two pairs of primers and a pair of matched probes based on the open reading frame 2 (ORF2) sequence with the greatest difference between GAstV-1 and GAstV-2, and primer and probe concentrations and annealing temperatures were optimised. Fluorescence signals were obtained for GAstV-1 and GAstV-2 in the FAM and VIC channels, respectively, but no fluorescent signal was observed for other pathogens. The detection limit for GAstV-1 and GAstV-2 was 33.3 and 33.7 DNA copies/μL, respectively. Intra- and inter-assay variability tests revealed excellent reproducibility. Furthermore, the assay detected GAstV-1 and GAstV-2 in allantoic fluids (100% positive) spiked with viruses, and 70 clinical gout gosling samples were examined, of which 11.4% were positive for GAstV-1, 74.3% were positive for GAstV-2%, and 5.7% were positive for mixed infection. In summary, the developed duplex RT-qPCR assay has high specificity, sensitivity, and reproducibility, and can be used in the clinic for detection of GAstV-1 and GAstV-2.

Rapid and Accurate Identification of SARS-CoV-2 Variants Using Real Time PCR Assays.

BackgroundGenomic surveillance efforts for SARS-CoV-2 are needed to understand the epidemiology of the COVID-19 pandemic. Viral variants may impact routine diagnostic testing, increase viral transmissibility, cause differences in disease severity, have decreased susceptibility to therapeutics, and/or confer the ability to evade host immunity. While viral whole-genome sequencing (WGS) has played a leading role in surveillance programs, many laboratories lack the expertise and resources for performing WGS. This study describes the performance of multiplexed real-time reverse transcription-PCR (RT-PCR) assays for identification of SARS-CoV-2 variants.MethodsSARS-CoV-2 specimens were tested for spike-gene variants using a combination of allele-specific primer and allele-specific detection technology (PlexPrime® and PlexZyme®). Targeted detection of spike gene mutations by RT-PCR was compared to variant detection in positive specimens by WGS, including the recently emerged SARS-CoV-2 Omicron variant.ResultsA total of 398 SAR-CoV-2 RT-PCR positive and 39 negative specimens previously tested by WGS were re-tested by RT-PCR genotyping. PCR detection of spike gene mutations N501Y, E484K, and S982A correlated 100% with WGS for the 29 lineages represented, including Alpha (B.1.1.7), Beta (B.1.351), and Gamma (P.1). Incorporating the P681R spike gene mutation also allowed screening for the SARS-CoV-2 Delta variant (B.1.617.2 and AY sublineages). Further sampling of 664 specimens that were screened by WGS between June and August 2021 and then re-tested by RT-PCR showed strong agreement for Delta variant positivity: 34.5% for WGS vs 32.9% for RT-PCR in June; 100% vs 97.8% in August. In a blinded panel of 16 Omicron and 16 Delta specimens, results of RT-PCR were 100% concordant with WGS results.ConclusionsThese data demonstrate that multiplexed real-time RT-PCR genotyping has strong agreement with WGS and may provide additional SARS-CoV-2 variant screening capabilities when WGS is unavailable or cost-prohibitive. RT-PCR genotyping assays may also supplement existing sequencing efforts while providing rapid results at or near the time of diagnosis to help guide patient management.

Rapid detection of the emerging tick-borne Tamdy virus by TaqMan-based real-time reverse transcription PCR

Tamdy virus (TAMV) is an emerging zoonotic tick-borne arbovirus in the genus Orthonairovirus. Reports of human infections with TAMV have been increasing and development of a rapid detection assay is thus urgently required. In the present study, singleplex and dual-target real-time reverse transcription PCR (qRT-PCR) assays were established for the detection of TAMV. Sensitivity and specificity were evaluated, which demonstrated high sensitivity for both the singleplex and dual-target qRT-PCR assays with no cross-reaction with common bunyaviruses and tick-borne viruses. The TaqMan-based qRT-PCR methodology established in this study can be employed for epidemiological surveillance and pathogenesis studies of TAMV.