Reticulata Cv Research Articles

Dynamic Analysis of the Fruit Sugar-Acid Profile in a Fresh-Sweet Mutant and Wild Type in 'Shatangju' (Citrus reticulata cv.).

Citrate is a major determinant of fruit flavor quality. Currently, citrus species and/or varieties with significant alterations in citrate level have greatly advanced the molecular basis of citrate accumulation in fruit. However, in-depth dissections of the molecular mechanism specific to citrate accumulation are still limited due to the lack of mutants, especially within one single variety. In this study, a fresh-sweet 'Shatangju' mutant (Citrus reticulata cv.) was obtained during a survey of citrus resources in Guangdong, China, and the phenotype, fruit morphology, and primary flavor profiles were comparatively analyzed. Unlike the wild-type 'Shatangju' (WT), the mutant (MT) material exhibited a dwarfed and multi-branched tree shape, delayed flowering and fruit ripening at maturity, a prolonged fruit tree-retention time, and a decreased single fruit weight at maturity. Dynamic measurement of the metabolite levels further suggested that the contents and fluctuation patterns of vitamin C, malate, quinate, and oxalate showed no obvious difference between MT and MT fruits, while the citrate level in MT fruits significantly decreased over various developmental stages, ranging from 0.356 to 1.91 mg g-1 FW. In addition, the accumulation patterns of the major soluble sugars (sucrose, fructose, and glucose), as well as the sugar/acid ratio, were also altered in MT fruits during development. Taken together, this study provides a novel acid-free 'Shatangju' mutant, which can serve as a powerful tool for the research of fruit flavor quality, especially for the comprehensive understanding of the molecular mechanism of citrate accumulation in fruits.

Characteristics of Rhizosphere Microbiome, Soil Chemical Properties, and Plant Biomass and Nutrients in Citrus reticulata cv. Shatangju Exposed to Increasing Soil Cu Levels.

The prolonged utilization of copper (Cu)-containing fungicides results in Cu accumulation and affects soil ecological health. Thus, a pot experiment was conducted using Citrus reticulata cv. Shatangju with five Cu levels (38, 108, 178, 318, and 388 mg kg-1) to evaluate the impacts of the soil microbial processes, chemistry properties, and citrus growth. These results revealed that, with the soil Cu levels increased, the soil total Cu (TCu), available Cu (ACu), organic matter (SOM), available potassium (AK), and pH increased while the soil available phosphorus (AP) and alkali-hydrolyzable nitrogen (AN) decreased. Moreover, the soil extracellular enzyme activities related to C and P metabolism decreased while the enzymes related to N metabolism increased, and the expression of soil genes involved in C, N, and P cycling was regulated. Moreover, it was observed that tolerant microorganisms (e.g., p_Proteobacteria, p_Actinobacteria, g_Lysobacter, g_Sphingobium, f_Aspergillaceae, and g_Penicillium) were enriched but sensitive taxa (p_Myxococcota) were suppressed in the citrus rhizosphere. The citrus biomass was mainly positively correlated with soil AN and AP; plant N and P were mainly positively correlated with soil AP, AN, and acid phosphatase (ACP); and plant K was mainly negatively related with soil β-glucosidase (βG) and positively related with the soil fungal Shannon index. The dominant bacterial taxa p_Actinobacteriota presented positively correlated with the plant biomass and plant N, P, and K and was negatively correlated with plant Cu. The dominant fungal taxa p_Ascomycota was positively related to plant Cu but negatively with the plant biomass and plant N, P, and K. Notably, arbuscular mycorrhizal fungi (p_Glomeromycota) were positively related with plant P below soil Cu 108 mg kg-1, and pathogenic fungi (p_Mortierellomycota) was negatively correlated with plant K above soil Cu 178 mg kg-1. These findings provided a new perspective on soil microbes and chemistry properties and the healthy development of the citrus industry at increasing soil Cu levels.

Recent Advances in the Health Benefits and Application of Tangerine Peel (Citri Reticulatae Pericarpium): A Review.

Citrus fruits, renowned for their abundant of phytochemicals and bioactive compounds, hold a prominent position as commercially grown fruits with health-promoting properties. In this context, tangerine peel (Citri Reticulatae Pericarpium, CRP) is garnering attention as a byproduct of citrus fruits. Within the framework of the circular economy, CRP has emerged as a focal point due to its potential health benefits. CRP, extracted from Citrus reticulata cv. and aged for over three years, has attracted increasing attention for its diverse health-promoting effects, including its anticancer, cardiovascular-protecting, gastrointestinal-modulating, antioxidant, anti-inflammatory, and neuroprotective properties. Moreover, CRP positively impacts skeletal health and various physiological functions. This review delves into the therapeutic effects and molecular mechanisms of CRP. The substantial therapeutic potential of CRP highlights the need for further research into its applications in both food and medicine. As a value-added functional ingredient, CRP and its constituents are extensively utilized in the development of food and health supplements, such as teas, porridges, and traditional medicinal formulations.

An integrated multi-omics approach reveals polymethoxylated flavonoid biosynthesis in Citrus reticulata cv. Chachiensis

Citrus reticulata cv. Chachiensis (CRC) is an important medicinal plant, its dried mature peels named “Guangchenpi”, has been used as a traditional Chinese medicine to treat cough, indigestion, and lung diseases for several hundred years. However, the biosynthesis of the crucial natural products polymethoxylated flavonoids (PMFs) in CRC remains unclear. Here, we report a chromosome-scale genome assembly of CRC with the size of 314.96 Mb and a contig N50 of 16.22 Mb. Using multi-omics resources, we discover a putative caffeic acid O-methyltransferase (CcOMT1) that can transfer a methyl group to the 3-hydroxyl of natsudaidain to form 3,5,6,7,8,3’,4’-heptamethoxyflavone (HPMF). Based on transient overexpression and virus-induced gene silencing experiments, we propose that CcOMT1 is a candidate enzyme in HPMF biosynthesis. In addition, a potential gene regulatory network associated with PMF biosynthesis is identified. This study provides insights into PMF biosynthesis and may assist future research on mining genes for the biosynthesis of plant-based medicines.

Metabolome Comparison of Sichuan Dried Orange Peels (Chenpi) Aged for Different Years

Chuan chenpi is obtained by aging the peel of Citrus reticulata cv. ‘Dahongpao’, a traditional Chinese citrus variety. Chenpi has been used in traditional Chinese medicine since ancient times. It is believed that the longer the ripening period, the better the health properties. The composition of the metabolome of Chuan chenpi and how different aging periods affect it are not known. Current analysis was performed using Chuan chenpi aged for one (CR1), five (CR5) and ten (CR10) years. Initially, the total flavonoid and phenolic content were quantified, and then the global metabolomic profiles of CR1, CR5 and CR10 were studied. The total flavonoid and phenolic content increased significantly in CR5 compared to CR1 and then decreased in CR10. The metabolomic analyses led to the identification of 781 compounds belonging to more than 19 classes. Flavonoids and phenolic acids accounted for almost half (~48%) of the Chuan chenpi metabolome. Other major classes included amino acids (~8%), alkaloids (7.17%), organic acids (~7%), sugars (5.5%), nucleotides and derivatives (~5%), free fatty acids (3.33%) and other classes. The metabolite diversity of glycerol esters, terpenoids and stilbenes was constant during the three storage periods, whereas those of lignans, vitamins, coumarins, lipids and free fatty acids showed slight variations. The subclass distribution of phenylpropanoids, quinones, sphingolipids, and organic acids showed a decrease in diversity from CR1 to CR5, with CR10 showing a further decrease or remaining constant. Amino acids and derivatives, phenolic acids and flavonoids showed an increasing trend in the number of metabolites over the storage period. Compared to CR5, CR10 showed a higher number of differentially accumulated metabolites; in particular, flavonoids, phenolic acids and organic acids showed increased accumulation in CR10. In conclusion, the metabolome of Chuan chenpi is rich in flavonoids and phenols. Aging significantly affects the metabolome composition. Both CR5 and CR10 may be useful materials for health studies depending on the objectives of pharmacological use.

The phenetic relationship of citrus plants based on the morphological and anatomical characteristics

Abstract. Nurzaman M, Setiawati T, Hasan R, Qotrunnada NK, Kusmoro J, Permadi N, Julaeha E. 2024. The phenetic relationship of citrus plants based on the morphological and anatomical characteristics. Biodiversitas 25: 1201-1213. Indonesia stands as a global biodiversity hub, boasting an exceptional richness that earns it the distinction of being a mega-biodiversity country. Among its diverse ecosystems, the Rutaceae family holds significance, encompassing numerous genera, notably the Citrus genus, which showcases a splendid array of citrus plants. This research aimed to determine phenetic relationships based on the morphological and anatomical characters of seven citrus plants (Citrus reticulata var. Chokun, C. reticulata var. Fremont, C. reticulata var. Santang, C. reticulata var. Dekopon, C. aurantium var. variegata, C. aurantium, and C. limon) in Parongpong District, West Bandung Regency, West Java. The method used in this research was explorative with purposive sampling. This study collected three samples for respective citrus plants for character observations of leaf morphology, anatomy, and fruit morphology. Morphology and anatomy observations were conducted in the Department of Biology, Padjadjaran University laboratory. The description of morphological and anatomical data obtained from each orange plant was then analyzed using NTSYS PC version 2.11a software to obtain similarity values using the dendrogram analysis method. Phenetic analysis of seven orange plants produced a dendrogram divided into 2 main branches, branch I and branch II, with a similarity coefficient of 0.3846. Branch I consists of Chokun orange (Citrus reticulata var. Chokun), Fremont orange (C. reticulata cv. Fremont), Santang orange (C. reticulata cv. Santang), and variegated orange (C. sinensis cv. variegata) and branch II consists of dekopon orange (C. reticulata var. Dekopon), Sunkist orange (C. aurantium), and lemon (C. limon).

Comprehensive comparison of a new technology with traditional methods for extracting Ougan (Citrus reticulata cv. Suavissima) seed oils: Physicochemical properties, fatty acids, functional components, and antioxidant activities

Citrus seed waste material provides a new solution for addressing the shortage of edible oils in China. supercritical CO2 fluid extraction (SFE), sub-critical butane fluid extraction (SCE), cold press (CP), soxhlet extraction (SXE), and ultrasonic-assisted extraction (UAE) were preformed to obtain Ougan (Citrus reticulata cv. Suavissima) seed oil. Ougan seed oils were tested for physicochemical properties, fatty acid composition, limonoids, polyphenols, total carotenoids, tocopherols, and in vitro antioxidant activities. The results indicated that SCE Ougan seed oil has the most abundant fatty acid composition, and higher in vitro antioxidant capacity, which is mainly positively related to the polyphenol, carotenoid and tocopherol contents. Therefore, SCE may be the optimum procedure for extracting a high content of bioactive substances from Ougan seed oils, providing a theoretical foundation for developing high-quality and nutritional value Ougan seed oils.

Insights into metabolic characteristics and biological activity changes in Zangju (Citrus reticulata cv. Manau Gan) peel at different maturity stages through UPLC–MS/MS-based metabolomics

In this study, comprehensive and systematic nontargeted metabolomics analysis was performed with the metabolites of Zangju peel (Citrus reticulata cv. Manau Gan, CRZP, which has been cultivated for over 400 years in Derong County, China.) at four different mature stages. A total of 1878 metabolites were identified, among which flavonoids were the most abundant (62.04 %), and identified 62 key differential metabolites significantly affected by maturity. Based on biological activity measurements, CRZP showed better antioxidant activity, lipase inhibition ability, inhibition of adipogenic differentiation in 3TT-L1 cells and promotion of lipid metabolism, with the biological activity of CRZP at different maturity stages being associated with key differential metabolite. Thus, CRZP is natural antioxidants and possess anti-obesity potential, and industrial production needs to consider the Maturity stage of its collection.

Integrated hormone and transcriptome profiles provide insight into the pericarp differential development mechanism between Mandarin 'Shatangju' and 'Chunhongtangju'.

Citrus reticulata cv. 'Chunhongtangju' was mutated from Mandarin 'Shatangju', which has been identified as a new citrus variety. Mandarin 'Chunhongtangju' fruits were late-ripening for about two months than Mandarin 'Shatangju'. To understand the pericarp differential development mechanism in Mandarin 'Shatangju' (CK) and 'Chunhongtangju' (LM), hormones and transcriptome profiles of pericarps were performed in different development stages: Young fruit stage (CK1/LM1), Expansion and Turning color stage (CK2), Expansion stage (LM2), Turning color stage (LM3), and Maturity stage (CK3/LM4). In this study, the development of LM was significantly slower, and the maturity was significantly delayed. At the same stage, most hormones in Mandarin 'Chunhongtangju' pericarps were higher than that in 'Shatangju' such as gibberellin A24, cis(+)-12-oxophytodienoic acid, and L-phenylalanine. The deficiency of hormones in late-maturing pericarps was mainly manifested in ABA, 12-OHJA, MeSAG, and ABA-GE. Differences in transcriptome profiles between the two citrus varieties are primarily observed in energy metabolism, signal transduction such as MAPK signaling pathway and plant hormone signaling, and biosynthesis of secondary metabolites. After analyzing the hormones and transcriptome data, we found that the top genes and hormones, such as Cs_ont_5g020040 (transcription elongation factor, TFIIS), Cs_ont_7g021670 (BAG family molecular chaperone regulator 5, BAG5), Cs_ont_2g025760 (40S ribosomal protein S27, Rps27), 5-deoxystrigol, salicylic acid 2-O-β-glucosid, and gibberellin A24, contributed significantly to gene transcription and hormone synthesis. This study suggests that the variances of pericarp development between the two varieties are linked to variations in the transcription levels of genes associated with energy and secondary metabolism, signal transduction related genes. These findings expand our understanding of the complex transcriptional and hormonal regulatory hierarchy during pericarp development.

Screening and Characteristics Analysis of Polysaccharides from Orah Mandarin (Citrus reticulata cv. Orah).

This study aimed to screen out polysaccharides with the ability to activate NK cells. Ten polysaccharides (OP) were isolated from orah mandarin (Citrus reticulata cv. Orah) peel using hot-water extraction combined with the alcohol precipitation method and the ultrafiltration-membrane separation method. After measuring the effects of 10 OPs on NK-92MI cell proliferation and cytotoxicity, it was found that the polysaccharide OP5 had the highest activity in vitro. OP5 can significantly promote the proliferation of and increase the gene expression of perforin, granzyme B and IFN-γ in NK-92MI cells. Its molecular weight was between 50 and 70 kDa. The identification results of monosaccharide composition indicated that OP5 was composed of arabinose (31.52%), galacturonic acid (22.35%), galactose (16.72%), glucose (15.95%), mannose (7.67%), rhamnose (2.39%), fucose (1.41%), xylose (1.30%), glucuronic acid (0.42%) and ribose (0.27%). The sugar ring of the β-configuration was the main, and that of the α-configuration was the auxiliary. These results would provide a foundation for the functional product development of OPs.

Oviposition by the oriental fruit fly, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), on five citrus types in a laboratory

AbstractFrugivorous insects use visual, chemical and tactile cues to find a suitable host for oviposition. However, these cues can vary greatly among fruit cultivars and condition, changing their susceptibility to fruit fly oviposition. The aims of this study were to (1) determine the effects of ripeness stage and damage on oviposition propensity by sexually mature, mated female oriental fruit flies, Bactrocera dorsalis (Hendel) (Diptera: Tephritidae), on five citrus types (species and cultivars) under choice and no‐choice conditions and (2) describe the oviposition behaviour of B. dorsalis on ripe fruit of the same five citrus types that were either damaged or undamaged under no‐choice conditions. All tests were conducted in the laboratory. The citrus types tested were Citrus sinensis (L.) Osbeck cv Delta Valencia orange, Citrus sinensis (L.) Osbeck cv Glen Ora Late navel orange, Citrus limon (L) (Burm.f.) cv Eureka lemon, Citrus paradisi (Macfad.) cv Star Ruby grapefruit and Citrus reticulata (Blanco) cv Nadorcott mandarin. Peel physical properties and essential oil composition were determined for each citrus type and stage. Oviposition propensity of B. dorsalis was significantly greater on damaged citrus but was not correlated with fruit diameter, peel thickness, oil gland density or oil gland size. A total of 45 aromatic compounds were found to be significant between the five cultivars investigated, and 6 of 11 compounds were significantly associated with over‐ripe fruits. Bactrocera dorsalis spent a significantly greater proportion of time ovipositing in damaged citrus and showed higher aggression when oviposition occurred in undamaged citrus. These results suggest that the removal of damaged and fallen fruit is important for controlling this pest in citrus orchards.

Diversity Analysis and Function Prediction of Bacterial Communities in the Different Colored Pericarp of Citrus reticulata cv. 'Shatangju' Due to 'Candidatus Liberibacter asiaticus' Infection.

Huanglongbing (HLB), caused by the Candidatus Liberibacter spp., is the most devastating disease in the citrus industry. HLB significantly affects and alters the microbial community structure or potential function of the microbial community of leaves and roots. However, it is unknown how the microbial community structure of the pericarp with different pigments is affected by Candidatus Liberibacter asiaticus (CLas). This study identified the enriched taxa of the microbial community in the citrus pericarp with normal or abnormal pigment and determine the effects of HLB on the pericarp microbial community using 16S rRNA-seq. The alpha and beta diversity and composition of microbial communities were significantly different between normal and abnormal pigment pericarp tissues of ripe fruits infected by CLas. Firmicutes, Actinobacteriota, Bacteroidota, Acidobacteriota, and Desulfobacterota dominated the pericarp microbiota composition in WDYFs (whole dark yellow fruits) samples. The relative abundance of most genera in WDYFs was higher than 1%, such as Burkholderia, and Pelomonas. However, with the exception of the HLB pathogen, the relative abundance of most genera in the abnormal-colored pericarp samples was less than 1%. CLas decreased the relative abundance of pericarp taxonomic. The predicted function of microbial was more plentiful and functional properties in the WDYF sample, such as translation, ribosomal structure and biogenesis, amino acid transport and metabolism, energy production and conversion, and some other clusters of orthologous groups (COG) except for cell motility. The results of this study offer novel insights into understanding the composition of microbial communities of the CLas-affected citrus pericarps and contribute to the development of biological control strategies for citrus against Huanglongbing.

Electronic Nose and Head Space GC-IMS Provide Insights into the Dynamic Changes and Regularity of Volatile Compounds in Zangju (Citrus reticulata cv. Manau Gan) Peel at Different Maturation Stages.

Zangju (Citrus reticulata cv. Manau Gan) is the main citrus cultivar in Derong County, China, with unique aroma and flavour characteristics, but the use of Zangju peel (CRZP) is limited due to a lack of research on its peel. In this study, electronic nose, headspace-gas chromatography-ion mobility spectrometry (HS-GC-IMS), and partial least squares-discriminant analysis (PLS-DA) methods were used to rapidly and comprehensively evaluate the volatile compounds of dried CRZP and to analyse the role of dynamic changes at different maturation stages. The results showed that seventy-eight volatile compounds, mainly aldehydes (25.27%) and monoterpenes (55.88%), were found in the samples at four maturity stages. The contents of alcohols and aldehydes that produce unripe fruit aromas are relatively high in the immature stage (October to November), while the contents of monoterpenoids, ketones and esters in ripe fruit aromas are relatively high in the full ripening stage (January to February). The PLS-DA model results showed that the samples collected at different maturity stages could be effectively discriminated. The VIP method identified 12 key volatile compounds that could be used as flavour markers for CRZP samples collected at different maturity stages. Specifically, the relative volatile organic compounds (VOCs) content of CRZP harvested in October is the highest. This study provides a basis for a comprehensive understanding of the flavour characteristics of CRZP in the ripening process, the application of CRZP as a byproduct in industrial production (food, cosmetics, flavour and fragrance), and a reference for similar research on other C. reticulata varieties.

First Report of citrus virus A infecting citrus (Citrus reticulata Blanco) in China.

Citrus is one of the most popular fruit crops in the world. Citrus virus A (CiVA, species Coguvirus eburi, genus Coguvirus) is a newly identified virus (Navarro et al. 2018) with two negative-sense single-stranded RNAs (RNA1 and RNA2). To date, CiVA has been detected on different citrus species in South Africa, U.S.A. and Greece (Bester et al. 2021; Park et al. 2021; Beris et al. 2021). CiVA has not been reported in China. In Sept. 2018, virus-like symptoms of leaf mottling, leaf flecking, and oak leaf patterns were observed on 'Orah' mandarin (Or) and 'Harumi' tangor (Ht) trees grown in Neijiang (NJ, Sichuan Province) and on Citrus reticulata cv.'Jinqiushatangju' (Jq) trees in Guizhou Province (GZ). Two mixed leaf samples (HY-NJ: 1 Or and 1 Ht and GZ-1: 2 Jq) were collected from symptomatic trees and then subjected to high-throughput sequencing (HTS). Total RNA was extracted by TRIzol. The cDNA library was constructed after depleting ribosomal RNA using a TruSeq RNA Sample Prep Kit and sequenced by Illumina HiSeq X-ten platform with paired-end reads length of 150 bp. After removing adaptors, low-quality reads, and reads homologous to citrus hosts by CLC Genomics Workbench 11 (Qiagen, U.S.A.), 917,547 and 1,508,134 clean reads were obtained from 56,239,772 and 81,535,900 total reads for HY-NJ and GZ-1, respectively. De novo assembly of the clean reads by CLC Genomics Workbench 11 resulted in 2,181 contigs for HY-NJ and 3,718 contigs for GZ-1. BLASTX searches of the contigs against local virus (taxid:10239) and viroid datasets (taxid:2559587) downloaded from NCBI allowed identification of several viruses and viroids. CiVA, citrus leaf blotch virus, citrus yellow vein clearing virus (CYVCV), and citrus psorosis virus (CPsV) were detected in HY-NJ. CiVA, hop stunt viroid, citrus viroid VI, citrus viroid V, citrus exocortis viroid, citrus dwarfing viroid, citrus bent leaf viroid, citrus bark cracking viroid, CYVCV, citrus tristeza virus, apple stem grooving virus, and CPsV were also detected in GZ-1. The lengths of the CiVA contigs were 6,682-nt and 6,670-nt matching RNA1 and 2,728-nt and 2,715-nt matching RNA2, respectively. The average coverage depth of clean reads mapped to CiVA-related contigs in HY-NJ was 64.90 and 156.54 for RNA1 and RNA2, respectively, and 26.50 and 558.08 in GZ-1. The full-length genomes of CiVA in HY-NJ and GZ-1 were determined by Sanger sequencing of six overlapping cDNA fragments obtained by RT-PCR and 5' and 3' RACE. At least 5 molecular clones were randomly selected for each fragment. The NJ isolate had a 6,690 nt RNA1 (GenBank accession no. MZ436805) and a 2,740 nt RNA2 (MZ436807). The GZ isolate had a 6,688 nt RNA1 (MZ436804) and a 2,734 nt RNA2 (MZ436806). BLASTN showed that the NJ and GZ isolates have 99.31 to 99.60% sequence identity to the isolate CG301 (MT922052; MT9220523). A phylogenetic tree constructed from nucleotide sequences indicated that the NJ and GZ isolates are closely related to the CG301 isolate. Among 105 citrus samples (35 Or and 30 Ht from NJ and 50 Jq from GZ) randomly collected, 11 samples (4 Or, 2 Ht and 5 Jq) with similar symptoms tested positive by RT-PCR using generic primers designed from conservative regions of RNA2 (F: TTGCAGTAGTGAGAAGGGAGT; R: TCAAAAGAGGCAGTGGTAGGA). To our knowledge, this is the first report of CiVA infecting citrus trees in China. The results will help facilitate further research to assess the threat of CiVA to citrus growing areas in China.

Identification and quality evaluation of Citrus reticulata cv. Chachiensis varieties based on SNP markers

The desiccative and mature pericarp of Citrus reticulata cv. Chachiensis (PCRC) contenting rich flavonoids and volatile oil is used as traditional Chinese medicine. However, the biological and mechanical mixing of germplasm seriously affects the quality and clinic efficacy of PCRC. In this study, an identification system based on SNP markers was established which is capable of effectively distinguishing between two main C. reticulata cv. Chachiensis (CRC) varieties of DaZhongyoushen (DZ) and XiZhongyoushen (XZ). Moreover, mechanical mixing was confirmed to exist in another major cultivar DaDong5 (DD). Although the morphological characteristics of DZ and XZ fruits were similar, differences were observed in the contents and compositions of bioactive metabolites between the pericarps of these two CRC varieties. The content of flavonoids, especially hesperidin, in the DZ pericarp was significantly higher than that in the XZ pericarp (P < 0.01). The XZ pericarp contained many specific volatile compounds, and its volatile oil content was slightly higher than that of the DZ pericarp. In conclusion, DZ is more suitable as raw material for producing medicinal PCRC, while XZ is more promising for the development of fragranced products such as Ganpu tea. This study provides the theoretical basis and technical support for the identification and evaluation of CRC germplasm resources, which is instrumental for CRC germplasm resource innovation, further promoting the production of high-quality PCRC.

Polymethoxyflavone–Enriched Fraction from Ougan (Citrus reticulata cv. Suavissima) Attenuated Diabetes and Modulated Gut Microbiota in Diabetic KK-Ay Mice

Diabetes mellitus is a serious, chronic disease worldwide; yet it is largely preventable through physical activity and healthy diets. Ougan (Citrus reticulata cv. Suavissima) is a characteristic citrus variety rich in polymethoxyflavones. In the present study, the anti-diabetic effects of the polymethoxyflavone-enriched fraction from Ougan (OG-PMFs) were investigated. Diabetic KK-Ay mice were supplemented with different doses of OG-PMFs for 5 weeks. Our results demonstrated that OG-PMFs exhibited robust protective effects against diabetes symptoms in KK-Ay mice. The potential mechanisms may partially be attributed to the restoration of hepatic GLUT2 and catalase expression. Notably, OG-PMF administration significantly altered the gut microbiota composition in diabetic KK-Ay, indicated by the suppression of metabolic disease-associated genera Desulfovibrio, Lachnoclostridium, Enterorhabdus, and Ralstonia, implying that the gut microbiota might be another target for OG-PMFs to show effects. Taken together, our results provided a supplementation for the metabolic-protective effects of PMFs and highlighted that OG-PMFs hold great potential to be developed as a functional food ingredient.

First Report of Penicillium oxalicum Causing Postharvest Fruit Rot on Citrus in China.

Ougan (Citrus reticulata cv. Suavissima) is a distinct citrus cultivar local to Zhejiang province, China. (Guo et al. 2021). In November 2021, an unknown postharvest fruit rot was observed in the Sanyang wetland Ougan planting area, Wenzhou City of Zhejiang Province (27.96 °N, 120.69 °E). About 3% of diseased fruits with similar fruit rot symptoms were observed in 900 mandarin fruits from four commercial storages. Initially, the symptoms appeared as light brown lesions that turned deep brown as the lesions expanded. To identify the pathogen, segments (5 mm2) from margins of rotted tissue were excised from 5 symptomatic fruits, surface disinfested twice with 75% ethanol, rinsed three times with sterilized water, placed aseptically onto potato dextrose agar (PDA) medium and incubated for 7 days at 25℃ in darkness for identification. Five fungal isolates with the same morphology were obtained using the single spore method (Leslie and Summerell 2006). Initially, the fungus produced fluffy and white aerial mycelium that eventually turned green on PDA medium after 3 days. Conidiophores were broom-shaped (17.5 ± 2.5 μm) (n=50). Conidia were unicellular and ellipsoid (3.5 to 5.0 ×2.5 to 4.0 μm) (n=50). These morphological characteristics were consistent with Penicillium species (Wu et al. 2022). WZU-OG1 was chosen as a representative isolate for further study. For molecular identification, PCR amplification and DNA sequencing were performed using primers ITS1/ITS4 (White et al. 1990), bt2a/bt2b (Glass and Donaldson 1995), and RPB2-5F/RPB2-7R (Liu et al. 1999) to amplify the complete internal transcribed spacer (ITS) region, β-tubulin gene (TUB), and a portion of RNA polymerase second largest subunit (RPB2). The ITS, TUB, and RPB2 gene sequences of isolate WZU-OG1 were deposited in the GenBank database with acc. nos. ON332735, ON428245, and ON524171, respectively. BLASTn analysis respectively showed 561/561 (MH855125), 414/427 (KF296462), and 936/954 (JN121456) matching with Penicillium oxalicum CBS 219.30. A neighbor-joining phylogenetic analysis based on the concatenated nucleotide sequences (ITS, TUB, and RPB2) grouped this isolate in the Penicillium oxalicum species complex clade at 100% bootstrap support. To verify pathogenicity, 20 healthy mandarin fruit of cultivar Sanyang were superficially disinfested with 75% ethanol and then washed with distilled water. A conidial suspension of 1 × 105 conidia/ml from a 5-day-old culture of WZU-OG1 was injected into 10 fruits (10 μL per fruit). An equal number of fruits inoculated with sterile water were used as the negative control. The inoculated fruits were stored in a constant temperature incubator under the conditions of 28 ℃, 90% humidity, and incubated in a 12-h light/12-h dark cycle for 12 days. Symptoms similar to those on the naturally infected fruit began 5 days after inoculation, whereas no symptoms occurred on the controls. The experiment was repeated three times, and similar symptoms were observed in all diseased fruits. Then, the fungus was reisolated from these infected fruits and identified as P. oxalicum by the morphological and molecular methods described above. This is the first report of P. oxalicum causing postharvest mandarin decay and this study will enable us to rapidly diagnose this disease, identify the occurrence of this disease and develop adequate management strategies to control it in China.

Valorization of essential oils from citrus peel powder using hydro-distillation

Citrus species exhibit many important natural bioactive compounds, such as ascorbic acid, essential oils, and antioxidant substances. Citrus essential oils are a complex mixture of volatile and non-volatile compounds obtained from the citrus fruit peel, which are discarded as waste. These citrus peels are a rich source of essential oils having medicinal benefits such as antioxidant, anticancer, antidiabetic, and anti-inflammatory properties. An experiment was carried out on two Citrus species (Citrus reticulata cv. (kinnow) and Citrus X sinensis (orange)) peel powder to study the essential oil composition. The kinnow and orange peels were dried using the sun and tray drying method and were compared. The peel powder obtained by sun and tray drying was tested for antioxidant activity (DPPH assay, TPC activity, and ascorbic acid activity). The essential oil was extracted from peel powder using a sustainable hydro-distillation technique. The results revealed that the highest yield was obtained in tray-dried orange peel powder (9.98%), followed by tray-dried kinnow peel powder (9.70%). The bioactive composition of the extracted essential oils was analyzed by gas chromatography-mass spectrometry (GC-MS). The kinnow and orange peel essential oil composition was predominated with d-limonene, terpenoids, and sesquiterpenes, enhancing its medicinal value. Thus, this study developed a green, sustainable, and eco-friendly hydro-distillation technique for citrus essential oil extraction.

Physicochemical and microbial qualities of Citrus reticulata cv. Bakraei coated with Lepidium sativum gum containing nanoemulsified Echinophora cinerea essential oil during cold storage

In this study, the effect of an edible coating based on Lepidium sativum gum containing emulsion and nanoemulsion of Echinophora cinerea essential oil (EO) in concentrations of 4% and 8% on the chemical characteristics and microbial load of Citrus reticulata cv. Bakraei fruit during 16 d of storage at 4 °C was investigated. Based on the results, the use of coatings, especially coatings containing EOs, reduced the bacterial population and the numbers of mould and yeast in the samples. Also, coatings containing essential oil nanoemulsion (EON) and a higher concentration of EO were more effective in reducing the microbial load of the samples, so that the fruit coated with coatings+ 8% EON had the lowest microbial load. Compared to the control, the weight loss and total colour changes of the coated samples were also lower. Increasing the concentration of EO and using EON caused a further decrease in weight loss and total colour changes of the samples. Total soluble solids (TSS), total phenolic content (TPC) and antioxidant activity of coated samples were higher than those of the control. The use of coatings containing EON and higher concentrations of EO also increased the mentioned attributes, so that the sample coated with coating+ 8% EON had the highest TSS and TPC and showed higher antioxidant activity. Microbial population, weight loss, total colour changes and total solids in all samples at the end of the storage period were higher than those at the beginning of the period, while their TPC and antioxidant activity were lower.

Mapping of QTLs for citrus quality traits throughout the fruit maturation process on clementine (Citrus reticulata × C. sinensis) and mandarin (C. reticulata Blanco) genetic maps

Citrus fruit quality is defined as the combination of physical and chemical traits; some of which may change during the ripening phase, e.g., acidity and sugar content. A clear understanding of their genetic control would be very helpful for marker-assisted breeding programs especially with regard to the juvenile phase and some reproductive features that hamper the selection of improved hybrids. A genetic study was thus performed on the heredity of quality traits and QTL detection based on segregation in a progeny generated from a cross between clementine cv “Commun” (Citrus × reticulata cv clementine) and mandarin cv “Willow leaf” (C. reticulata Blanco). Parental and consensus genetic linkage maps were constructed using 645 SNP and SSR markers. These maps were represented by 10 linkage groups in clementine and 12 linkage groups in mandarin, representing 75% and 58% respectively of the previously published clementine reference map. A total of 16 traits, including fruit mass, equatorial diameter, juice percentage, total soluble solids, acidity, pH, glucose, fructose, sucrose, and citric and malic acid concentrations were evaluated at three maturation dates. High variations indicating transgressive segregation were found for all traits, with normal or close to normal distributions. QTL analysis performed using the multiple QTL model allowed the detection of 34 QTLs on the three maps. QTLs were distributed in different linkage groups and generally detected at only one date of the ripening phase. The percentage of total variation explained ranged from 12 to 37% per QTL. Major QTLs (R2 ≥ 30%) were detected for equatorial diameter, glucose, and fructose (expressed in percentage dry matter) on linkage groups 8 and 9. Co-localization of QTLs controlling correlated and uncorrelated traits were mainly found on linkage groups 2, 4, 8, and 9, particularly between fruit mass and acidity.