Results Of Ophthalmologic Examination Research Articles

Clinical features and MYH9 gene variant in two Chinese siblings with Fechtner syndrome

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.

Current status of treatment of type 2 diabetes mellitus in Ningbo, China

The treatment status of type 2 diabetes mellitus (T2DM) in Ningbo has not been reported in the past. To evaluate the current status of T2DM in Ningbo and provide evidence to formulate more policies, a multicenter investigation was needed. The Ningbo Clinical Research Group of Diabetes constituted nine hospitals. Participants included 3015 patients who visited the nine hospitals from June to December 2016. General characteristics, the medication situation, the laboratory indexes in nearly 3months consisting of glycosylated hemoglobin level (HbA1c), low-density lipoprotein cholesterol (LDL-C), and fasting blood glucose (FBG), and the results of ophthalmologic examination were investigated. The evaluation criteria were defined based on 2013 China guideline for T2DM. The 3015 subjects included 1685 men and 1330 women. The average age was 63.3±13.0years. The prevalence of hypertension and dyslipidemia was 58.7% and 56.7%, respectively. In the examinees, nephropathy appeared in 11.6% and retinopathy in 14.5%. More than half (50.9%) of the subjects were overweight. The achievement rate of blood pressure (BP) was 39.6% (<140/80mmHg), FBG was 46.0% (4.4-7.0mmol/L), HbA1c was 41.7% (<7.0%), and LDL-C was 51.7% (<1.8mmol/L; and if accompanied by CHD, <2.6). Ningbo City T2DM status is not optimistic, and there is a big gap with the indicators.

C-reactive protein and N-terminal pro-brain natriuretic peptide discrepancy: a differentiation of adenoviral pharyngoconjunctival fever from Kawasaki disease.

PurposeTo differentiate adenoviral pharyngoconjunctival fever (PCF) from acute Kawasaki disease (KD) using laboratory tests before results of virus-real time polymerase chain reaction and ophthalmologic examination are obtained.MethodsBaseline patient characteristics and laboratory measurements were compared between 40 patients with adenovirus infection and 123 patients with KD.ResultsThe patients with adenovirus infection were generally older than those with KD (median: 3.9 years vs. 2 years, P=0.000). White blood cell and, platelet count, and aspartate aminotransferase, alanine aminotransferase, and N-terminal pro-brain natriuretic peptide (NT-proBNP) levels showed significant differences between the 2 groups, but the C-reactive protein (CRP) levels did not (6.8±3.0 mg/dL vs. 8.3±5.8 mg/dL, P=0.126). In the adenovirus infection group, the CRP levels were <1, <3, <10, and ≥10 mg/dL in 2 (5%), 3 (7.5%), 30 (75%), and 5 patients (12.5%), respectively. The cutoff NT-proBNP level was 265 pg/mL. Discrepancy was defined as CRP and NT-proBNP levels of ≥3 or <3 mg/dL, and <265 or ≥265 pg/mL, respectively. Among the 35 patients with adenovirus infection whose CRP levels were ≥3 mg/dL, 29 (82.9%) showed a discrepancy. Conversely, of the 103 patients with KD whose CRP levels were ≥3 mg/dL, 83 (80.6%) showed no discrepancy. Between the groups, a significant difference in discrepancy rate was observed (P=0.000). None of the patients with adenovirus infection had CRP and NT-proBNP levels of <3 mg/dL and ≥265 pg/mL, respectively.ConclusionWith a sensitivity of 82.9% and a specificity of 80.6%, CRP and NT-proBNP levels may differentiate between adenoviral PCF and acute KD.

Associations between nocturnal urinary 6-sulfatoxymelatonin, obstructive sleep apnea severity and glycemic control in type 2 diabetes

ABSTRACTReduced nocturnal secretion of melatonin, a pineal hormone under circadian control, and obstructive sleep apnea have been both identified as risk factors for the development of type 2 diabetes mellitus. Whether they interact to impact glycemic control in patients with existing type 2 diabetes is not known. Therefore, this study explores the relationships between obstructive sleep apnea, melatonin and glycemic control in type 2 diabetes. As diabetic retinopathy may affect melatonin secretion, we also explore the relationship between retinopathy, melatonin and glycemic control. Fifty-six non-shift workers with type 2 diabetes, who were not using beta-blockers, participated. Most recent hemoglobin A1c (HbA1c) levels and the results of ophthalmologic examinations were obtained from medical records. Obstructive sleep apnea was diagnosed using an ambulatory device. Sleep duration and fragmentation were recorded by 7-day wrist actigraphy. The urinary 6-sulfatoxymelatonin/creatinine ratio, an indicator of nocturnal melatonin secretion, was measured in an overnight urine sample. Mediation analyses were applied to explore whether low nocturnal urinary 6-sulfatoxymelatonin/creatinine ratio could be a causal link between increasing obstructive sleep apnea severity [as measured by an Apnea Hypopnea Index (AHI)] and poorer glycemic control, and between the presence of retinopathy and glycemic control. AHI and HbA1c were log-scale (ln) transformed. Obstructive sleep apnea was found in 76.8%, and 25.5% had diabetic retinopathy. The median (interquartile range) of urinary 6-sulfatoxymelatonin/creatinine ratio was 12.3 (6.0, 20.1) ng/mg. Higher lnHbA1c significantly correlated with lower 6-sulfatoxymelatonin/creatinine ratio (p = 0.04) but was not directly associated with OSA severity. More severe obstructive sleep apnea (lnAHI, p = 0.01), longer diabetes duration (p = 0.02), retinopathy (p = 0.01) and insulin use (p = 0.03) correlated with lower urinary 6-sulfatoxymelatonin/creatinine ratio, while habitual sleep duration and fragmentation did not. A mediation analysis revealed that lnAHI negatively correlated with urinary 6-sulfatoxymelatonin/creatinine ratio (coefficient = −2.413, p = 0.03), and urinary 6-sulfatoxymelatonin/creatinine negatively associated with lnHbA1c (coefficient = −0.005, p = 0.02), after adjusting for covariates. Mediation analysis indicated that the effect of lnAHI on lnHbA1c was indirectly mediated by urinary 6-sulfatoxymelatonin/creatinine ratio (B = 0.013, 95% CI: 0.0006, 0.0505). In addition, having retinopathy was significantly associated with reduced nocturnal urinary 6-sulfatoxymelatonin/creatinine ratio, and an increase in HbA1c by 1.013% of its original value (B = −0.013, 95% CI: −0.038, −0.005). In conclusion, the presence and severity of obstructive sleep apnea as well as the presence of diabetic retinopathy were associated with lower nocturnal melatonin secretion, with an indirect adverse effect on glycemic control. Intervention studies are needed to determine whether melatonin supplementation may be beneficial in type 2 diabetes patients with obstructive sleep apnea.

Clinical Characterization of CNGB1-Related Autosomal Recessive Retinitis Pigmentosa

There are limited published data on the phenotype of retinitis pigmentosa (RP) related to CNGB1 variants. These data are needed both for prognostic counseling of patients and for understanding potential treatment windows. To describe the detailed clinical and molecular genetic findings in a series of patients with RP with likely pathogenic variants in CNGB1. In this case series, 10 patients from 9 families underwent full ophthalmologic examination. Molecular investigations included whole-exome analysis in 6 patients. The study was conducted from April 17, 2013, to March 3, 2016, with final follow-up completed on March 2, 2016, and data were analyzed from October 27, 2014, to March 29, 2016. Results of ophthalmologic examination and molecular genetic analysis of CNGB1. In this case series, 7 women and 3 men from 9 families with a mean (SD) age of 47.4 (13.2) years identified as having CNGB1 variants were included in this study; there was a mean (SD) follow-up length of 3.7 (2.8) years. The first clinical presentation was with nyctalopia in childhood with visual field loss documented later at a mean (SD) age of 33.2 (8.0) years. All patients had preserved best-corrected visual acuity into adulthood, with a mean of 0.1 logMAR (Snellen equivalent, 20/25) in each eye (logMAR range, 0.0 to 0.3 [Snellen 20/20 to 20/40] in the right eye and -0.1 to 0.3 [Snellen 20/16 to 20/40] in the left eye). Fundus examination revealed midperipheral retinal pigment epithelial atrophy and intraretinal pigment migration. Optical coherence tomography of the macula demonstrated complete preservation of the inner segment ellipsoid band in 1 patient, with variable lateral extent in the other patients corresponding to the diameter of a paracentral ring of increased fundus autofluorescence. Electrophysiologic testing in 6 patients confirmed a rod-cone dystrophy phenotype. Molecular investigations identified a previously reported missense variant (p.[N986I]) and 7 variants not previously reported in disease including 4 nonsense (p.[(Q88*], p.[Q222*], p.[Q318*], and p.[R729*]), 2 frameshift (p.[A1048fs*13], p.[L849Afs*3]), and a splice site variant (c.761 + 2T>A). The data from this study suggest that visual acuity and foveal structure in patients with RP are preserved into adult life such that a lengthy window of opportunity should exist for intervention with novel therapies.

Effect of small head tilt on ocular fundus image: Consideration of proper head positioning for ocular fundus scanning.

Head tilt and resultant ocular cyclotorsion can influence the results of ophthalmologic examinations. Thus, proper head positioning during fundus scanning has been emphasized. However, there is no perfect method to control the head tilt and little is known about the effect of small head tilts. In this study, we investigated the effect of minimal head tilt on the ocular cyclotorsion which we cannot easily detect.Forty-seven participants without ophthalmologic or vestibular abnormalities were recruited as normal subjects. Their faces were positioned at the desired head tilt using a customized adjustable head tilter and facial and fundus photographs of both the left and right eyes were taken in the upright neutral position; as well as at rightward and leftward head tilts of 2°, 4°, and 6°. The actual head tilt was determined using the facial photographs by measuring the slope of a line that intersected the corneal reflexes of both eyes. Rotational changes in the fundus images were recorded and the correlation of these changes with the degree of head tilt was determined.The degree of head tilt was significantly correlated with rotational changes in the fundus images from both the right and left eyes (P < 0.001; right eye: R2 = 0.897, left eye: R2 = 0.899). The mean relative compensations for head tilt, mediated by the ocular counterrolling reflex, were 0.376 ± 0.255 in the right eye (range: −0.02 to 1.0), and 0.350 ± 0.263 in the left eye (range: −0.03 to 1.0), and exhibited a significant negative correlation with head tilt (P < 0.05). The mean relative compensation of the right eye did not differ significantly from that of the left eye (P = 0.380), but the value did vary widely among individuals and within individuals.Even very small head tilt was partially and variably compensated for, and caused significant rotation in the fundus image. We concluded that proper head positioning does not guarantee the minimal ocular cyclotorsion change of the eyes and image-adjusting technique would be a better solution for minimizing errors from ocular cyclotorsion changes.

Preferential Ganglion Cell Loss in the Nasal Hemiretina in Patients With Pituitary Tumor

Analysis of retinal nerve fiber layer thickness and macular ganglion cell layer loss provides a noninvasive method to assess optic chiasmal compression. These techniques may provide valuable data for patient evaluation and management when combined with findings on clinical examination and neuroimaging results. Data from 20 eyes of 10 patients with pituitary tumor treated at Inha University Hospital from 2011 to 2013 were collected. This included results of ophthalmologic examination, fundus photography, spectral domain optical coherence tomography (SD-OCT), automated visual field testing, and brain magnetic resonance imaging (MRI). Abnormal color patterns on thickness and deviation maps obtained by macular ganglion cell analysis (GCA) were evaluated and compared with visual field defects. Patients with pituitary tumor showed preferential ganglion cell loss in the nasal hemiretina and characteristic vertical midline-respecting perimacular ganglion cell-inner plexiform layer defects, which anatomically matched the visual field defects. Macular GCA using SD-OCT can be used to complement visual field assessment and brain MRI findings during evaluation of patients with pituitary tumor.

Long-term results of viscocanalostomy and phacoviscocanalostomy: a twelve-year follow-up study.

To evaluate the long-term efficacy and safety results of viscocanalostomy and phacoviscocanalostomy. The charts of 49 glaucoma patients who underwent viscocanalostomy or phacoviscocanalostomy surgery between February 1999 and August 2004 were reviewed retrospectively. Thirty-one eyes of 21 glaucoma patients who underwent filtering procedure with a postoperative follow-up of at least 5y were included in the study. Results of complete ophthalmologic examinations were recorded and statistically analyzed. Long-term surgical outcome was defined as an overall success when intraocular pressure (IOP) was found as ≤20 mm Hg with or without antiglaucomatous medication at the last follow-up visit, while it was defined as a complete success when IOP was measured ≤20 mm Hg without antiglaucomatous medication. Mean age was 68.1±9.6y (range: 32-81y). Mean follow-up time was 101.5±27.3mo (range: 60-144mo). Viscocanalostomy was performed in 8 eyes (25.8%) and phacoviscocanalostomy was performed in 23 eyes (74.2%). The mean preoperative IOP was 23.1±7.6 mm Hg with 2.1±1.0 medications, while mean IOP was 16.8±3.8 mm Hg with 0.9±1.1 medication at the last follow-up visit. Both the IOP decrease and the reduction in the antiglaucomatous medication were statistically significant (P<0.001 and P<0.001). No case required further glaucoma surgery. Overall success and complete success were found as 87.1% and 51.6%, respectively. Complete success rate was statistically higher in phacoviscocanalostomy group compared with the viscocanalostomy group (P=0.031), however there was no significant difference in overall success rate between two groups (P=0.072). Both viscocanalostomy and phacoviscocanalostomy provide good IOP reduction in the long-term period.

Strabismus in patients with neurofibromatosis type 1-associated optic pathway glioma.

To characterize the incidence, type, natural history, and treatment outcomes of strabismus in pediatric patients with neurofibromatosis type 1 (NF1) and optic pathway glioma (OPG). The medical records of consecutive patients diagnosed with NF1 and OPG at our neurofibromatosis clinic since 1985 were reviewed retrospectively. We noted age at diagnosis, reason for referral to our clinic, ophthalmologic examination results, presence or absence of strabismus, strabismus type and treatment, and final results of treatment. A total of 76 patients were included. Of these, 22 (28.9%) had strabismus: 5 (22.7%) had esotropia and 17 (77.2%) had exotropia; of those with exotropia, 10 (45%) also had hypotropia. In 12 patients (54.5%), strabismus was present at the first ophthalmologic examination. The development of strabismus preceded the diagnosis of both NF1 and OPG in 4 (5.3%) patients and the diagnosis of OPG in another 2 (2.6%) patients with known NF1. In 16 (76%) patients, the strabismus was sensory. Five patients (22.7%) underwent surgery, which resulted in a deviation angle of <10(Δ) in 1 patient, <20(Δ) in 2 patients, and >20(Δ) in 2 patients. Strabismus was the presenting symptom and led to the diagnosis of OPG in a subset of patients, including those who did not have a previous diagnosis of NF1. Exotropia, especially associated with a hypotropia, was the most common strabismic deviation seen in these patients. Sensory strabismus was the most common type seen in this population. Deviations of <10(Δ) may be difficult to achieve with strabismus surgery.

Ophthalmological Findings of Turkish Children With Muscular Dystrophies.

To present the results of ophthalmological examinations in children with muscular dystrophies and highlight the importance of their ophthalmological evaluation. Retrospective analysis of the ophthalmological examination records in 74 children with a type of muscular dystrophy, examined between January 2011 and January 2015, was performed. The most common type of muscular dystrophy observed in our patients was Duchenne muscular dystrophy (67.5%), followed by Becker muscular dystrophy (9.4%), myotonic dystrophy (8%), limb-girdle muscular dystrophy (6.7%), merosin-negative muscular dystrophy (4%), and Ullrich muscular dystrophy (4%). Ten cases of Duchenne muscular dystrophy had both macular and retinal pigmentary changes (20%) and 9 had abnormal electroretinographies with decreased photopic and scotopic responses. Ptosis was the most common finding (83.3%). No abnormalities of light reflexes, pupil size, or saccadic and smooth pursuit movements were seen among cases with myotonic dystrophy. Ophthalmological problems are commonly seen in children with muscular dystrophies. Simple ophthalmological screening and early intervention can improve their communication skills by way of increasing their visual talents.

Is there an association between pseudoexfoliation syndrome and knee osteoarthritis?

The purpose of this study was to investigate whether there is an association between pseudoexfoliation (PEX) syndrome and knee osteoarthritis (OA), and compare to compare patients with PEX and OA to a control group without PEX. This observational case-control study examined 254 subjects: 127 cases with PEX in at least one eye and 127 controls without PEX. A full ophthalmic examination including slit lamp biomicroscopy, gonioscopy, applanation tonometry, pupil dilation, and fundus examination was performed for the diagnosis of PEX. Knee pain was evaluated using a visual analogue scale (VAS). Knee OA was diagnosed according to American College of Rheumatology (ACR) criteria and graded according to the Kellgren and Lawrence (KL) grading scale on radiographic examination. Of the 254 subjects, 171 (67.3%) had severe OA and 83 (32.7%) mild OA. Of the 171 patients with severe knee OA, 93 (54.4%) had ocular PEX and the remaining 78 (45.6%) had normal ophthalmologic examination results. Both the PEX and the control groups contained 127 patients; the number of patients with moderate-severe OA was significantly (p = 0.032) higher in the PEX group as compared to controls: 93 patients (73.2%) in the PEX group and 78 (61.5%) in the control group. VAS score (p = 0.037) and KL grade (p = 0.024) were significantly higher in the PEX group than in controls. As evidenced by the odds ratios (ORs) pertaining to the severity of OA, age (OR = 1.112; 95% confidence interval, CI: 1.054-1.173) and PEX (OR = 2.044; 95% CI: 1.164-3.584) had a significant influence, but gender did not. This study suggests a probable relationship between OA and ocular PEX. Further studies are needed to analyze the molecular basis of this association. Patients with severe knee OA should be informed about the possibility of having PEX and may be referred for ophthalmologic examination.

Changing trends over the last decade in the aetiology of childhood blindness: a study from a tertiary referral centre

AimsTo discern treatable and preventable causes of childhood blindness by evaluating the aetiologic factors, and to compare the distribution of the most commonly affected anatomic sites of severe visual impairment...

Clinical Features of Patients Complaining of Visual Symptoms and Diagnosed with Migraine

Purpose: To describe the characteristics of patients who visited Korean ophthalmology clinics complaining of visual symptoms and were diagnosed with migraine. Methods: A retrospective study was performed by evaluating the patterns of visual symptoms, timing of headaches, and results of ophthalmologic examinations in 31 migraine patients who were recruited from a neuro-ophthalmology clinic. Results: The patients consisted of 9 men and 22 women, with a mean age of 38.1 years (range, 12-71). The average age of symptom onset was 35.7 years (range, 12-64 years). The most common three visual symptoms were blurred vision (35.5%), blind spots (22.6%), and flashes of bright lights (22.6%). Visual symptoms disappeared within 5 minutes in 16 patients (51.6%) and 13 patients (41.9%) experienced visual symptoms before the onset of a headache. Brain magnetic resonance imaging findings in 14 cases revealed normal results and the remaining three patients showed minimal small vessel disease. Except for one patient who had exotropia, there was no other specific abnormality observed upon ophthalmologic examinations. Conclusions: Most of the migraine patients who first visited an ophthalmology clinic with visual symptoms had no definite ocular abnormalities. Thus, ophthalmologists must be aware that migraines could first present with various visual symptoms in order to make an early diagnosis of migraine. J Korean Ophthalmol Soc 2015;56(12):1933-1938

New Eye Cleansing Product Improves Makeup-Related Ocular Problems.

Purpose. This study evaluated the effects of using a newly developed eye cleansing formulation (Eye Shampoo) to cleanse the eyelids for 4 weeks in a parallel-group comparative study in women with chronic eye discomfort caused by heavy use of eye makeup and poor eye hygiene habits. Methods. Twenty women participants who met the inclusion criteria were randomly allocated to 2 groups comprising 10 participants each. The participants were asked to use either artificial tears alone or artificial tears in conjunction with Eye Shampoo for 4 weeks. The participants answered the questionnaire again and were reexamined, and changes in symptoms within each group and variations of symptoms between the two groups were statistically analyzed. Results. In the group using only artificial tears, improvements in subjective symptoms but not in ophthalmologic examination results were found. In the group using Eye Shampoo together with artificial tears, significant improvements were observed in the subjective symptoms, meibomian orifice obstruction, meibum secretion, tear breakup time, and superficial punctate keratopathy. Conclusion. In patients with chronic eye discomfort thought to be caused by heavy eye makeup, maintaining eyelid hygiene using Eye Shampoo caused a marked improvement in meibomian gland blockage and dry eye symptoms.

Developmental outcomes in young children born to mothers with West Nile illness during pregnancy.

West Nile virus (WNV) infection is associated with acute morbidity and mortality in adults and children. Information on the effects of maternal WNV illness during pregnancy on early childhood development is limited. This study was designed to examine the relationship between maternal WNV illness during pregnancy and birth and developmental outcomes at age 3 years. Mother-child participants were identified using a national surveillance registry for women with WNV illness during pregnancy. Maternal and infant health data and relevant family characteristics were obtained through medical record reviews and maternal questionnaires. All infants received ophthalmologic examinations. Child development was evaluated at age 3 years using the Bayley Scales of Infant and Toddler Development-Third Edition (Bayley-III). As a group, the children's (N = 11) birth weight, head circumference, and infant ophthalmologic examination results were within age expectations; one child was born preterm (gestational age 36 weeks). Mean (SD) age at the time of Bayley-III testing was 36.7 (3.8) months. The group's mean performance on the Bayley-III was at or above age level in all domains, but one child showed a mild delay in the Adaptive domain. The variability observed in this sample (1/53 [1.9%] Domain scores < -2.0 SDs) was consistent with expectations based upon the distribution of Bayley-III Domain scores in the general population. Maternal WNV infection does not appear to be associated with global developmental delays in young children. These results are preliminary, however, and require confirmation in future research.

Ultrasound assessment of ocular vascular effects of repeated intravitreal injections of ranibizumab for wet age-related macular degeneration.

Determine the effect of repeated intravitreal injections of ranibizumab (0.5 mg; 0.05 ml) on retrobulbar blood flow velocities (BFVs) using ultrasound imaging quantification in twenty patients with exudative age-related macular degeneration treated for 6 months. Visual acuity (ETDRS), central macular thickness (OCT), peak-systolic, end-diastolic and mean-BFVs in central retinal (CRA), temporal posterior ciliary (TPCA) and ophthalmic (OA) arteries were measured before, 2 days, 3 weeks and 6 months after the first injection. Patients were examined monthly and received 1-5 additional injections depending on ophthalmologic examination results. Six months after the first injection, a significant increase in visual acuity 50.9 ± 25.9 versus 44.4 ± 21.7 (p < 0.01) and decrease in mean central macular thickness 267 ± 74 versus 377 ± 115 μm (p < 0.001) were observed compared to baseline. Although mean-BFVs decreased by 16%±3% in CRA and 20%±5% in TPCA (p < 0.001) 2 days after the first injection, no significant change was seen thereafter. Mean-BFVs in OA decreased by 19%±5% at week 3 (p < 0.001). However, the smallest number of injections (two injections) was associated with the longest time interval between the last injection and month 6 (20 weeks) and with the best return to baseline levels for mean-BFVs in CRA, suggesting that ranibizumab had reversible effects on native retinal vascular supply after its discontinuation. Moreover, a significant correlation between the number of injections and percentage of changes in mean-BFVs in CRA was observed at month 6 (R = 0.74, p < 0.001) unlike TPCA or OA. Ranibizumab could impair the native choroidal and retinal vascular networks, but its effect seems reversible after its discontinuation.

Changes in the etiology of endophthalmitis from 2003 to 2010 in a large tertiary medical center.

To ascertain the leading causes of endophthalmitis at the Tel Aviv Medical Center between 2003 and 2010. The design of the study is retrospective chart review. The medical records of all patients diagnosed with endophthalmitis in our center between 2003 and 2010 were reviewed for visual acuity and results of ophthalmologic examination at admission, treatment, complications, laboratory investigations, and final visual results. The etiologies of endophthalmitis after cataract surgery were compared for each year from 2003 to 2010, and after intravitreal (IVT) injection from 2006 to 2010. Eighty patients were diagnosed with endophthalmitis between 2003 and 2010: 46 male and 34 female, average age 70.7 years. A total of 27.5% were treated with IVT antibiotic injection only and 68.8% needed pars plana vitrectomy. Final visual acuity was better than counting fingers in 56.3% of cases. Surgery was almost the sole cause of endophthalmitis until 2005, when IVT injection became an important etiology. The incidence of postcataract endophthalmitis decreased significantly after 2007 and that following IVT injection decreased significantly after 2008. The leading etiology of endophthalmitis changed from postoperative endophthalmitis to endophthalmitis after IVT injection from 2003 to 2010, and the incidence of the infection as a complication of those procedures decreased.

Life quality assessment of patients after phacoemulsification or extracapsular cataract extraction.

To study the quality of life, treatment outcomes, and satisfaction in patients who have undergone cataract surgery Methods: This comparative case series study was conducted at the Ophthalmology Service of the Bettina Ferro de Souza University Hospital, Belém, Pará, Brazil. Totally, 60 patients with cataract were included; 50% underwent conventional extracapsular cataract extraction (ECEE) and 50% underwent cataract extraction by phacoemulsification (PHACO). Patients were interviewed using the Visual Function 14 (VF-14) questionnaire to determine the quality of life before and 30 days after surgery. The results of ophthalmological examination were recorded in the patients' files and were available throughout this study. One-way ANOVA, Tukey's post-hoc comparison, and the sign test were used for statistical analyses. The mean VF-14 satisfaction index was 38.0 and 89.4 before and after surgery, respectively, for the ECEE group and 47.0 and 94.1, respectively, for the PHACO group. The improvement in patient quality of life after surgery was significant in both groups (p<0.0001), with a similar amount of improvement in both groups. The observed improvement in quality of life was significant (p<0.0001) and directly related to patient satisfaction with surgical outcomes, which was also significant (p<0.0001) as assessed using the VF-14. Satisfaction and quality of life are individual factors; consequently, patient responses to questions regarding improvements in the ability to perform each activity are subjective and depend uniquely on individual perception.

İş Kazasına Bağlı Göz İçi Yabancı Cisim: Üç Olgu İçin Kader Miydi?

Occupational eye injuries are the leading reasons of ocular traumas that can result in vision loss. To avoid such injuries it is important to increase awareness about work-related accidents. However, even to witness the bad results of the splashing of a foreign body into the eye, may not be enough to encourage people to take precautions. In this study medical records of 3 cases that belong to the same family and working at the same place who admitted to our clinic because of penetrating eye injury and intraocular foreign body, were analyzed in terms of the type of injury, ophthalmologic examination findings, surgical treatment and results. The state of consciousness of the society about the measures to be taken against occupational accidents was questioned, and the prevention methods to avoid vission loss due to such injuries were discussed.

Long-term Visual Outcome of Methylmalonic Aciduria and Homocystinuria, Cobalamin C Type

To describe the long-term ophthalmologic outcomes of patients with methylmalonic aciduria and homocystinuria, cobalamin C type (cblC). Retrospective case series. All patients with cblC referred to the Department of Ophthalmology of the Centre Hospitalier Universitaire Sainte-Justine from 1984 through 2012 were studied. Twelve such patients were identified. Clinical ophthalmic examinations, neuroimaging, electroretinography, and the results of MMACHC mutation analysis were reviewed retrospectively. We examined visual acuity, ocular alignment, presence of maculopathy and peripheral retinopathy, optic atrophy, and nystagmus. Photopic and scotopic electroretinograms were reviewed. We examined and compared mutations in the MMACHC gene. Neuroimaging abnormalities were compiled when available. Twelve cblC patients were followed up from 2 to 23 years (average, 10 years). Eleven of 12 patients were diagnosed before the age of 1 year (range, birth-2 years). An initial ophthalmic examination was performed within the first year of age in 9 of 12 patients. Visual acuity at the time of presentation was variable, ranging from light perception to 20/20. Visual acuity was worse than 20/100 in 75% (9/12) of patients at last follow-up. Eight patients (67%) had obvious maculopathy on fundus examination. Other findings included peripheral retinopathy (8/12 [67%]), nystagmus (8/12 [67%]), strabismus (5/12 [42%]), and optic atrophy (6/12 [50%]). Funduscopic deterioration was documented in 1 patient, whereas electrophysiologic changes occurred in 4 patients. Neuroimaging results were available in 7 of the patients, revealing corpus callosum atrophy (7/7 [100%]) and periventricular white matter loss (6/7 [85%]). Most children in our series had early-onset disease with neurologic manifestations and abnormal ophthalmologic examination results. Despite early treatment, many early-onset cblC patients have poor visual function.