Replicative Form RNA Research Articles

Plum pox potyvirus RNA replication in a crude membrane fraction from infected Nicotiana clevelandii leaves

In vitro synthesis of plum pox potyvirus (PPV)-specific nucleic acid has been measured in a crude fraction prepared from leaves of PPV-infected Nicotiana clevelandii plants. Using alkali and DNase treatments, the synthesized nucleic acid was shown to be RNA. The electrophoretic mobility and the differing sensitivity to RNase at high and low salt concentrations allowed the identification of in vitro products probably corresponding to replicative form and replicative intermediate RNA, as well as to single-stranded RNA. Most of the PPV-specific RNA synthesized was shown to be of positive polarity. The in vitro RNA synthesis, performed in the presence of actinomycin D, required all four ribonucleoside triphosphates and Mg2+ ions. This enzyme extract contained about 6% of the leaf protein and most of the identified virus-encoded proteins. Altogether, the results presented in this paper suggest that in vitro RNA synthesis was carried out by the PPV replicase complex.

Coronavirus transcription: subgenomic mouse hepatitis virus replicative intermediates function in RNA synthesis

Both genomic and subgenomic replicative intermediates (RIs) and replicative-form (RF) structures were found in 17CL1 mouse cells that had been infected with the A59 strain of mouse hepatitis virus (MHV), a prototypic coronavirus. Seven species of RNase-resistant RF RNAs, whose sizes were consistent with the fact that each was derived from an RI that was engaged in the synthesis of one of the seven MHV positive-strand RNAs, were produced by treatment with RNase A. Because the radiolabeling of the seven RF RNAs was proportional to that of the corresponding seven positive-strand RNAs, the relative rate of synthesis of each of the MHV positive-strand RNAs may be controlled by the relative number of each of the size classes of RIs that are produced. In contrast to alphavirus, which produced its subgenome-length RF RNAs from genome-length RIs, MHV RF RNAs were derived from genome- and subgenome-length RIs. Only the three largest MHV RF RNAs (RFI, RFII, and RFIII) were derived from the RIs that migrated slowest on agarose gels. The four smallest RF RNAs (RFIV, RFV, RFVI, and RFVII) were derived from RIs that migrated in a broad region of the gel that extended from the position of 28S rRNA to the position of the viral single-stranded MHV mRNA-3. Because all seven RIs were labeled during very short pulses with [3H]uridine, we concluded that the subgenome-length RIs are transcriptionally active. These findings, with the recent report of the presence of subgenome-length negative-strand RNAs in cells infected with porcine transmissible gastroenteritis virus (P. B. Sethna, S.-L. Hung, and D. A. Brian, Proc. Natl. Acad. Sci. USA 86: 5626-5630, 1989), strongly suggest that coronaviruses utilize a novel replication strategy that employs the synthesis of subgenomic negative strands to produce subgenomic mRNAs.

Further characterization of Rhopalosiphum padi virus of aphids and comparison of isolates from South Africa and Illinois

A South African isolate of Rhopalosiphum padi virus (RhPV) was directly compared with an isolate from Illinois. Although these viruses were serologically closely related, differences were detected in their capsid protein molecular weights and particle buoyant densities. The South African isolate was further characterized; two additional putative capsid proteins were found, an RNA poly(A) tract was detected, and an RNA size of 10 kb was calculated. Virions were found to degrade quickly below pH 3.0, to be stable between pH 5.0 and 8.4, and to lose RNA when heated to 56°C. From this evidence, and from radioiodination and Western blot reactions of capsid proteins, it is proposed that RhPV be classified as an enterovirus. No serological relationship was detected between RhPV and several other picorna- and picorna-like viruses. Three RhPV-specific double-stranded RNA species were isolated from infected aphids. Although virions could be isolated after long periods from plants on which viruliferous aphids had fed, and clean aphids could become infected by feeding on such plants, no replicative form RNA was detected in these plants.

Studies on the Infectivity of Foot-and-Mouth Disease Virus RNA using Microinjection

Foot-and-mouth disease virus (FMDV) RNA, isolated as virion RNA from purified virus particles or as total RNA from infected cells, has been microinjected into nuclei and cytoplasms of BHK cells. When injected directly into the nucleus FMDV RNA was not infectious, whereas cytoplasmic injection resulted in a high proportion of productive infections. Infectivity microinjection assays on dilution series of various FMDV RNAs showed that both single-stranded positive sense 35S RNA and double-stranded replicative form (Rf) RNA have an infectivity close to 1 p.f.u. per molecule, although only a minor fraction of BHK cells appeared able to support plaque formation following microinjection of Rf FMDV RNA. The infectivity of Rf FMDV RNA was not sensitive to inhibition by actinomycin D. The results are discussed in relation to the high virus particle to p.f.u. ratios observed for FMDV.

Characterization of West Nile virus RNA-dependent RNA polymerase and cellular terminal adenylyl and uridylyl transferases in cell-free extracts.

To facilitate further studies of flavivirus transcription, cell extraction methods and in vitro reaction conditions which increased West Nile virus (WNV) RNA-dependent RNA polymerase activity were determined. Subcellular fractions from WNV-infected BHK-21/W12 cells were characterized with regard to their protein and RNA content and in vitro polymerase activity. In both a cytoplasmic fraction, designated S1, and a fraction enriched for outer nuclear membranes, designated S2, seven virus-specific proteins, NS5 (96 kilodaltons [kDa]), NS3 (67 kDa), E (48 kDa), NS1 (47 kDa), ns4a (26 kDa), ns2a (17 kDa), and ns2b (14.5 kDa), were detected. The fractions also contained virus-specific RNA and cellular rRNA and mRNA. Polymerase activity in S1 and S2 fractions from WNV-infected cells was concentrated by pelleting and consisted of two types of enzyme activities: the WNV RNA-dependent RNA polymerase and terminal transferases of cellular origin. Enhanced levels of WNV polymerase activity were obtained from these cell fractions by altering several of the in vitro reaction conditions. Although Mg2+ was the divalent cation preferred by WNV polymerase, virus-specific in vitro transcription was detected at reduced levels when Mn2+ (0.05 or 0.5 mM) was present as the sole divalent cation. Product analysis revealed that the viral polymerase incorporated radiolabeled ribonucleotides into three distinct RNA species. Free single-stranded genome-sized RNA which was LiCl insoluble and RNase sensitive was found by fingerprint analysis to have an oligonucleotide pattern similar to that of WNV genomic RNA. RNA molecules which comigrated as a broad band near the top of the gel were separable into LiCl-insoluble, partially RNase-sensitive replicative-intermediate RNA and LiCl-soluble, RNase-resistant replicative-form RNA. The cellular transferases added UMP or AMP residues to the 3'-termini of cellular mRNA, tRNA, and 18S and 28S rRNA. Although a cellular terminal transferase has been reported to function in initiation of poliovirus transcription, no labeling of the WNV RNA by either of these cellular enzymes was detected. Therefore, they appear to play no specific role in flavivirus RNA synthesis.

The structure of cowpea mosaic virus replicative form RNA

The structure of Cowpea mosaic virus (CPMV) replicative form (RF) RNA has been investigated by in vitro labelling at the 5′ and 3′ termini. The results indicate that the 3′ termini of the minus (−) strands of the RFs from both M and B RNA (RF-M and RF-B) are exact complements of the corresponding 5′ sequences of the virion RNAs. The 5′-labelling studies revealed that both RF-M and RF-B have VPg linked to poly(U) at the 5′ ends of the (−) strands and also show that there is heterogeneity in the lengths of the VPg-linked RNAse T1 products derived from the 5′ ends of the plus (+) strands. In addition it appears that not all of the 5' ends in RF molecules are linked to the VPg. The results enable us to draw an overall structure common to both RF-M and RF-B.

Double-stranded, Replicative Form RNA Molecules of Cowpea Mosaic Virus Are Not Infectious

SUMMARY Virus-specific double-stranded replicative form (RF) RNA was isolated from cowpeas infected with cowpea mosaic virus. The RF was assayed for infectivity in a local lesion host and a systemic host. In neither host was undenatured RF infectious, although infectivity was restored upon denaturation.

Replication strategy of Kunjin Virus: Evidence for recycling role of replicative form RNA as template in semiconservative and asymmetric replication

Only three forms of Kunjin virus-specified RNA were isolated from cytoplasm early after the latent period (about 15 hr) viz., 44 S genomic-sized single-stranded RNA, 20 S double-stranded “replicative form” (RF), and 20–28 S partially ribonuclease-resistant (about 70%) “replicative intermediate” (RI). The RF and RI were resolved by electrophoresis in aqueous-agarose gel only following LiCl fractionation. The RI did not enter urea-polyacrylamide gels. After denaturation of untreated or RNase-treated RI and RF, only 44 S RNA was present in electropherograms. RNA polymerase activity at 8 hr postinfection was detected by in vitro assays of cytoplasmic extracts and reached a maximum at 24 hr, the only major labeled product being RF; a trace amount of free 44 S RNA was also produced. These results, and the kinetics of incorporation of [ 3H]uridine into RI, RF, and 44 S RNA in pulse and pulse-chase experiments, formed the basis of a model in which flavivirus RF functions as a recycling template for semiconservative and (mainly) asymmetric replication, on which only one nascent strand is synthesized per cycle.

Persistent and acute central nervous system infections are caused by Theiler's murine encephalomyelitis viruses which differ in RNA composition but code for only slightly different proteins.

The RNA and proteins for four representatives of the two subgroups of Theiler's murine encephalomyelitis viruses were studied. The large RNase T1-resistant oligonucleotides, when mapped along the RNA molecules, were found to be differently distributed in the two subgroups. Replicative form RNAs of two representatives were partially denatured, and the denaturation maps obtained were found to be similar but not identical. In addition, the analysis of the tryptic maps of the capsid proteins of all four isolates revealed that only small differences in the peptide map patterns exist among these viruses. The correlation of these findings with the pathogenicity of Theiler's viruses is discussed.

Examination of the Mode of Action of Ribavirin against Tobacco Mosaic Virus

Ribavirin inhibited a specific step of tobacco mosaic virus (TMV) replication. Time-courses of sensitivity of TMV multiplication in asynchronous and synchronous infections demonstrated that ribavirin inhibited an early function that occurs prior to the period of viral RNA and protein synthesis. In the synchronous infection, ribavirin inhibited the synthesis of both single-stranded genomic RNA and double-stranded replicative form RNA when treatment began during the first 4 h, but there was no inhibition when treatment began at 12 h or later, even though most RNA synthesis occurred after 12 h. Viral protein synthesis also was inhibited when treatment began during the first 4 h and not when treatment began later. Unlike the mechanisms proposed against animal viruses, ribavirin appears to inhibit TMV replication by preventing an early function that is necessary to initiate viral RNA synthesis.

Use of micrococcal nuclease in the purification of highly template dependent RNA-dependent RNA polymerase from brome mosaic virus-infected barley

The template dependence of RNA-dependent RNA polymerase from brome mosaic virus (BMV)-infected barley was greatly increased by micrococcal nuclease digestion of the endogenous RNA. [ 32P]UMP incorporation by the nuclease-treated enzyme was stimulated 20-fold when BMV RNA was added as template, while incorporation by the untreated enzyme was stimulated only 5-fold by the addition of BMV RNA. Other properties of BMV polymerase were not changed significantly by nuclease digestion. The extract remained highly active and template specific. Analysis of the products of the reaction showed that separated BMV RNA components could be replicated independently to yield full-length replicative-form RNAs. These data provide strong evidence that the extract is capable of initiating RNA synthesis and that it includes the intact viral replicase. This method should be of general use, allowing the study of cell-free replication of any viral nucleic acid without requiring purification or solubilization of the replicase.

Terminal sequences of Sindbis virus-specific nucleic acids: Identity in molecules synthesized in vertebrate and insect cells and characteristic properties of the replicative form RNA

The terminal sequences of the virus-specific nucleic acids synthesized in BHK vertebrate cells and in Aedes albopictus insect cells infected with the alphavirus Sindbis virus have been analyzed. The 26 S and 42 S plus-strand RNA molecules have the 5′-terminal sequences m 7GpppAUAG and m 7GpppAUAGGCGGCGUAGUACACAC, respectively. A 22 S replicative form (RF) RNA which contains an infectious 42 S plus-strand genome RNA molecule and a complementary 42 S negative-strand RNA accumulates in infected cells. The 5′-terminal sequence of the 42 S plus-strand RNA component of the RF is identical to that of the single-stranded plus-strand 42 S RNA molecule except for the absence of a 5′-terminal cap in the constituent of the RF RNA. The identification of a poly(U) sequence at the 5′-terminus of the 42 S minus strand RNA in our experiments is in accordance with earlier results obtained in other laboratories ( Sawicki and Gomatos, 1976; Frey and Strauss, 1978). Analogous to our data concerning the structure of the RF RNA of the alphavirus Semliki Forest virus ( Wengler et al., 1979) the 3′-terminus of the 42 S minus strand RNA component of the Sindbis virus-specific RF RNA is complementary to the 5′-terminus of the 42 S plus strand RNA molecule but in addition contains a 3′-terminal extra unpaired guanosine residue. The 3′-terminal sequence of the 42 S minus strand is strongly conserved between the two alphaviruses, Sindbis virus and Semliki Forest virus. The terminal sequences of the RF RNA synthesized in BHK and Aedes albopictus cells are identical. Analyses of the capped oligonucleotides derived from virus-specific single-stranded 42 S plus-strand RNA and from 26 S RNA strongly indicate that no base sequence differences exists between the corresponding molecules synthesized in either vertebrate or insect cells. Possible implications of these findings concerning the structure of alphavirus RF RNA and the synthesis of alphavirus-specific nucleic acids are discussed.

Replication of mouse hepatitis virus: negative-stranded RNA and replicative form RNA are of genome length.

There are seven virus-specific mRNA species in mouse hepatitis virus-infected cells (Lai et al., J. Virol. 39:823-834, 1981). In this study, we examined virus-specific negative-stranded RNA to determine whether there are corresponding multiple negative-stranded RNAs. Intracellular RNA from mouse hepatitis virus-infected cells was separated by agarose gel electrophoresis, transferred to nitrocellulose membranes, and hybridized to positive-stranded genomic 60S [32P]RNA. Only a single RNA species of genomic size was detected under these conditions. This RNA was negative stranded. No negative-stranded subgenomic RNA was detected. We also studied double-stranded replicative-form RNA in the infected cells. Only one replicative-form of genomic size was detected. When the double-stranded RNA isolated without RNase treatment was analyzed, again only one RNA species of genomic size was detectable. Furthermore, most of the virus-specific mRNAs could be released from this RNA species upon heating. These results suggest that all of the mouse hepatitis virus-specific RNAs are transcribed from a single species of negative-stranded RNA template of genomic size.

Novel circular forms of mengovirus-specific double-stranded RNA detected by electron microscopy

Examination of mengovirus replicative form (RF) RNA by electron microscopy has revealed a substantial frequency of circular double-stranded RNAs which have an unusual projection on their circular contour. Circular structures comprised 14–16% of the genome-length double-stranded RNA in different preparations and have a contour length of 2.25 ± 0.08 μm corresponding to 8840 ± 310 nucleotide pairs in the A-form nucleic acid. The projection from the circular contour was typically found on more than 98% of the molecules and has an average heterogeneous length of 0.08 ± 0.02 μm (300 ± 80 nucleotide pairs). Linear duplex molecules with opposed ends were also detected at frequencies of 5–9% in different preparations and appear to be derived from dissociation of circular structures at the site of the projection. These linear duplexes had a length 2.32 ± 0.08 μm (9100 ± 310 nucleotide pairs) which is slightly greater than the contour length of circular structures excluding their projection. Linear dimers (3–6% of total), circular dimers (0.3%), and catenanes of two and three circular RF molecules, respectively, have been detected at low frequencies; such molecules usually contained a projection. The integrity of circular structures was destroyed by mild treatment with ribonucleases A, T1, or T2 or by incubation in 50% formamide or 40% formamide plus 2 M urea but was unaltered by treatment with DNase I or proteinase K. When examined by electron microscopy in the presence of formamide or formamide plus urea, approximately 14–17% of the linear duplex molecules were detected which contain one single-strand terminus typically less than 500 nucleotides in length. We suggest that circular structures are formed by noncovalent association of one single-strand terminus and one double-strand terminus of linear duplex molecules and that this association produces circular structures with the projection described at the site of association. A fixed fraction of linear RF RNA molecules in any given preparation contains termini suitable for association into circular structures that may have biological significance in the replication of picornaviruses.

Concomitant methylation and synthesis in vitro of Semliki Forest virus (SFV) ss RNAs by a fraction from infected cells.

Abstract The 42 S and 26 S ss SFV RNAs synthesized in vitro by the SFV RNA polymerase were also methylated in vitro by an enzyme in the mitochondrial pellet fraction, P-15, which had the activity of a guanine-7-methyltransferase. The 22 S ds RF RNA was not methylated in vitro . The methyl - 3 H radioactivity incorporated in vitro from labeled S -adenosyl- l -methionine was at the 5′-terminus of each of the ss RNAs, and none was detectable at an internal site. The 3 H-labeled cap containing oligonucleotide from the RNase T1 digest of 42 S RNA had a charge of about −6 consistent with its known m 7 GpppApUpGp sequence and that from the 26 S RNA had a charge of about −7 consistent with its known terminus of m 7 GpppApUpUpGp. The in vitro -labeled cap of both ss RNAs was m 7 GpppA. The rates of SFV RNA synthesis and methylation in vitro were linear for at least 40 min. In vitro methylation of the SFV ss RNAs absolutely depended on assay conditions which supported synthesis of ss RNAs. In contrast, transcription of 42 S and 26 S SFV RNAs in vitro was not dependent on methylation. The methylating enzyme in the P-15 fractions distributed during equilibrium centrifugation with membranous fractions of different densities in a manner similar to the distribution of the SFV RNA polymerase. It has not yet been established if this methylating activity was catalyzed by a virus-specific protein or a host protein.

Terminal sequences of the genome and replicatioe-form RNA of the flavivirus west nile virus: absence of poly(A) and possible role in RNA replication

The structures of the infectious 42 S genome RNA of the flavivirus West Nile (WN) virus and of the replicative-form (RF) RNA containing 42 S RNA of positive and negative polarity have been investigated. The RF RNA has been labeled in vitro at the 3′ and 5′ termini and the terminal sequences have been determined by the mobility shift method. The results obtained indicate that both RNA molecules are exact complements of each other and that the 3′ terminus of the 42 S plus-strand RNA component of the RF RNA does not contain a poly(A) sequence but terminates with a heteropolymeric AACACAGGAUCU OH sequence. The 3′ terminus of the 42 S minus-strand RNA has the sequence CUCACACAGGCGAACUACU OH. Comparison of these sequences shows that both molecules contain the 3′-terminal dinucleotide CUOH and the heptanucleotide ACACAGG which is separated from the 3′-terminal dinucleotide by two and seven nucleotides in 42 S plus- and minus-strand RNA, respectively. The 42 S viral genome RNA also does not contain a 3′-terminal poly(A) sequence but terminates with the 3′-terminal sequence identified in the 42 S plus-strand RNA of the RF. Analysis of the nucleotides adjacent to the cap at the 5′ terminus of the viral genome RNA together with the 3′-terminal sequence analysis indicates that the nucleotide sequence of the viral genome RNA is identical to that of the 42 S plus-strand RNA component of the virus-specific RF RNA.

Attachment of avidin-coupled spheres to linear and circular forms of mengovirus double-stranded RNA.

Picornavirus-infected cells contain a double-stranded RNA (replicative form [RF] RNA), composed of viral genomic RNA hydrogen bonded to cRNA of similar nucleotide length. Mengovirus RF RNA reacted with a succinimide ester of biotin was shown by electron microscopy to bind avidin-coupled polymethacrylate spheres. These binding sites are taken to indicate the presence of VPg protein molecular by methods previously applied to poliovirus RF RNA (Richards et al., Proc. Natl. Acad. Sci. U.S.A. 76:676-680, 1979). One sphere was bound at or very near one terminus of linear RF molecules while a second sphere was bound at a site which was 1 to 4% of the genome length from the other terminus. Assignment of VPg positions was limited by the physical dimension (ca. 60-nm diameter) of the heavy metal-contrasted sphere observed by electron microscopy. A third site of sphere binding was detected at a lower frequency of occurrence at a site which was 10 to 20% of the genome length from one or the other terminus. Circular RF RNA molecules were also detected with two spheres attached at juxtaposed sites. The termini of the linear RF RNA were located within the circular structures by sphere attachment at sites which were very close to and obscured a nucleic acid projection which we have described to occur on circular mengovirus RF RNA (D. L. Robberson, M. V. Marshall, G. B. Thornton, and R. B. Arlinghaus, manuscript submitted for publication). CsCl gradient fractions of RNA reacted with avidin-coupled spheres were highly enriched in circular structures.

Identification and characterization of type 2 dengue virus replicative intermediate and replicative form RNAs

KB cells infected with dengue type 2 virus synthesize three types of RNA with sedimentation coefficients greater than 18 S. The first is soluble in 2 M LiCl, sediments as a discrete species at about 20 S, and is greater than 95% RNase resistant. The second is a discrete 40 S species, insoluble in 2 M LiCl, and more than 95% sensitive to digestion by RNase. The third, also insoluble in 2 M LiCl, is “heterogeneous” in size, sedimenting between 20 and 28 S, and is 50–70% RNase resistant. Pulse-chase studies demonstrate the “heterogeneous” and 20 S RNAs to be intermediate in the synthesis of the virus 40 S genomic RNA. The data from agarose-formaldehyde gel analysis of these RNAs are in agreement with our identification of the “heterogeneous” and 20 S RNAs as the replicative intermediate (RI) and replicative form (RF) RNAs, respectively.

Comparison of replication complexes synthesizing poliovirus RNA

Poliovirus RNA replication complexes prepared by homogenization or detergent-extraction of infected cells have been used to study RNA replication in vitro. We show that the products are different depending on the method of extraction. Complexes derived from homogenized cells synthesize full-length single-stranded poliovirus RNA, replicative intermediate (RI), and replicative form (RF) RNA species, whereas only RI and RF are made by detergent-extracted complexes. Both complexes synthesize predominantly plus-strand strand RNA in vitro. Detergent treatment of complexes from homogenized cells inhibits synthesis of full-length, single-stranded RNA. The data suggest that the poliovirus replication complex contains several enzymatic activities and that the ability to synthesize full-length single-stranded RNA requires the association of a labile, possibly membrane associated, factor with the core elongation complex. Furthermore, RNase T 1-resistant oligonucleotide fingerprints of the products of detergent-extracted complexes are missing a specific internal oligonucleotide, which has been mapped near, but not identical to, oligonucleotides missing in fingerprints of DI virus genome.

Palindrome-like dimers of double-stranded RNA of encephalomyocarditis virus

Denatured and renatured preparations of dimers of replicative form RNA isolated from encephalomyocarditis virus-infected Krebs II cells have been studied by electron microscopy, sedimentation in sucrose gradients, and assayed for RNase sensitivity; a denaturation map of this double-stranded RNA has been constructed. The results are compatible with a model according to which the dimer represents a palindrome-like molecule composed of two complementary single-stranded dimers each containing a “+” and a “−” viral RNA strand covalently linked. The dimers appear to be noninfectious or to possess a very low infectivity.