Quaternary Ammonium Compounds Resistance Research Articles

Antimicrobial Drug Resistance in Corynebacterium diphtheriae mitis

Antimicrobial Drug Resistance in Corynebacterium diphtheriae mitis

Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment.

The impact of human activity on the selection for antibiotic resistance in the environment is largely unknown, although considerable amounts of antibiotics are introduced through domestic wastewater and farm animal waste. Selection for resistance may occur by exposure to antibiotic residues or by co-selection for mobile genetic elements (MGEs) which carry genes of varying activity. Class 1 integrons are genetic elements that carry antibiotic and quaternary ammonium compound (QAC) resistance genes that confer resistance to detergents and biocides. This study aimed to investigate the prevalence and diversity of class 1 integron and integron-associated QAC resistance genes in bacteria associated with industrial waste, sewage sludge and pig slurry. We show that prevalence of class 1 integrons is higher in bacteria exposed to detergents and/or antibiotic residues, specifically in sewage sludge and pig slurry compared with agricultural soils to which these waste products are amended. We also show that QAC resistance genes are more prevalent in the presence of detergents. Studies of class 1 integron prevalence in sewage sludge amended soil showed measurable differences compared with controls. Insertion sequence elements were discovered in integrons from QAC contaminated sediment, acting as powerful promoters likely to upregulate cassette gene expression. On the basis of this data, >1 × 10(19) bacteria carrying class 1 integrons enter the United Kingdom environment by disposal of sewage sludge each year.

The use of quaternary ammonium disinfectants selects for persisters at high frequency from some species of non-tuberculous mycobacteria and may be associated with outbreaks of soft tissue infections

BackgroundNon-tuberculous mycobacteria (NTM) are increasingly important as opportunistic infections after major and minor surgical procedures, likely because they are ubiquitous and not effectively killed by many commonly used disinfectants. Outbreaks of soft tissue infections with NTM appeared related to the use of commercial disinfectants based on quaternary ammonium compounds (QACs).MethodsWe studied the survival of clinical and environmental isolates of Mycobacterium abscessus, Mycobacterium massiliense, Mycobacterium chelonae and Mycobacterium fortuitum after 20 min, 60 min or 24 h exposures to different QACs, and the surviving bacteria were then re-exposed to QACs to see if the percentage of surviving bacteria had increased. The bacteria were labelled with a dnaA–gfp fusion and their level of QAC resistance monitored as increasing fluorescence. The QAC-resistant bacteria were then serially restreaked onto non-selective medium and retested for QAC survival.ResultsThe frequency of survivors was <1 in 105 bacteria with Mycobacterium smegmatis, but >1 in 100 with the other mycobacteria studied. Different environmental and clinical isolates had similar QAC MICs, but QAC survivors of each strain were resistant. The QAC-surviving strains reverted to the original, non-resistant phenotype after several passages on non-selective medium.ConclusionsQACs should not be used in settings where even minimally invasive procedures are performed, as they select for a non-genetically determined reversible resistant phenotype that appears at high frequency with several rapidly growing mycobacterial species associated with healthcare-related infections. M. smegmatis behaves differently and is not an adequate model for testing the activity of disinfectants against NTM.

Analysis of a novel class 1 integron containing metallo-β-lactamase gene VIM-2 in Pseudomonas aeruginosa

Carbapenems such as imipenem are stable to most beta-lactamases. Recently, increased numbers of carbapenemase producing Gram-negative bacterial strains have been isolated because of the increased use of cabapenems. In this respect, control of these infectious carbapenemase producing Gram-negative bacteria and understanding their resistance mechanism are becoming more important. These carbapenem-hydrolyzing beta-lactamase genes have been reported to exist mostly as gene cassettes in an integron. This implies that antibiotic resistance genes may be transferred to other bacteria via the integron. In the present study, we identified and analyzed an integron containing VIM-2 type metallo-beta-lactamase gene in a carbapenemase producing Pseudomonas aeruginosa. In addition, the possibility of resistance spread by integron located in a plasmid was tested. Among glucose non-fermenting Gram-negative bacilli with reduced imipenem susceptibility (MIC > or = 8 microg/ml) isolated from Korean patients, P. aeruginosa 1082 showed resistance to most beta-lactams, cephalosporin, and aminoglycoside. We found that P. aeruginosa 1082 was inhibited by EDTA in EDTA double disk synergy test which means that this strain produces metallo-beta-lactamase. Class 1 integron containing bla (VIM-2) (carbapenem resistance gene), qacF (quaternary ammonium compound resistance gene), aacA4 (aminoglycoside resistance gene), catB3 (chloramphenicol resistance gene), bla (oxa-30) (extended-spectrum beta-lactam resistance gene), and aadAl (aminoglycoside resistance gene) gene cassettes was detected in P. aeruginosa 1082. The size of the integron was 5,246 bp and the structure and arrangement of the integron was a novel one in comparison with other integrons found in other P. aeruginosa. The integron could be transferred to Escherichia coli JM109 from P. aeruginosa 1082 possibly via self-transferable plasmid DNA. The integron and a bla (VIM-2) gene were detected in the plasmid DNA of the transconjugants whose imipenem resistance was slightly increased as a result of accepting the integron from the donor strain.

Gene cassettes encoding resistance to quaternary ammonium compounds: a role in the origin of clinical class 1 integrons?

DNA sequencing, phylogenetic and mapping studies suggest that the class 1 integron found in pathogens arose when one member of the diverse family of environmental class 1 integrons became embedded into a Tn402 transposon. However, the timing of this event and the selective forces that first fixed the newly formed element in a bacterial lineage are still unknown. Biocides have a longer use in clinical practice than antibiotics, and a qac (quaternary ammonium compound) resistance gene, or remnant thereof, is a normal feature of class 1 integrons recovered from clinical isolates. Consequently, it is possible that the initial selective advantage was conferred by resistance to biocides, mediated by qac. Here, we show that diverse qac gene cassettes are a dominant feature of cassette arrays from environmental class 1 integrons, and that they occur in the absence of any antibiotic resistance gene cassettes. They are present in arrays that are dynamic, acquiring and rearranging gene cassettes within the arrays. The abundance of qac gene cassettes makes them a likely candidate for participation in the original insertion into Tn402, and as a source of a readily selectable phenotype. More broadly, the increasing use of qac and other biocides at the present time seems likely to promote the fixation of further novel genetic elements, with unpredictable and potentially adverse consequences for human health and agriculture.

Convergent acquisition of antibiotic resistance determinants amongst the &lt;i&gt;Enterobacteriaceae&lt;/i&gt; isolates of the Mhlathuze River, KwaZulu-Natal (RSA)

The Mhlathuze River has become a major reservoir for antibiotic-resistant microbes and a wide pool of antibiotic resistant genes with the environmental isolates exists in this water system. The ability of commensal organisms to carry resistant genes of clinical importance and their ability to transfer such genes to other bacteria are of greater concern than phenotypic measurements. Forty-three Enterobacteriaceae isolates, which were capable of resisting more than 4 different classes of antibiotics, were used for the molecular characterisation of antibiotic resistances. It was found that 58% of these multiple antibiotic-resistant isolates possess the Class 1 integron. Amongst these 25 isolates with positive detection of the Class 1 integron, the beta-lactamase gene (pse) was the most common, being present in 44% of these integrons. The aminoglycoside- resistant gene was detected in 16% of these integrons and 24% of Class 1 integrons contained two genes coding for sulphonamide resistance and for quaternary ammonium compounds resistance. A high degree of genotypic diversity and the lack of correlation between antimicrobial resistance patterns and molecular types of the isolates suggest convergent acquisition of resistance determinants by genetically unrelated strains rather than epidemic spread of resistant isolates in the community. Of the tested environmental isolates, 56% transferred their plasmids as well as their antibiotic resistance profiles to the recipient cells. The possibility of transmission of resistant genes between bacteria (especially pathogenic) which invade human and animal populations within this river poses a health risk to the communities who are dependent on this river for water consumption. Water SA Vol. 31 (2) 2005: pp.257-260

Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia

Sir, This study found that 21% of Stenotrophomonas maltophilia carry a class 1 integron when integrase-specific primers for intI1 or intI2 were used. S. maltophilia is a non-fermentative, Gram-negative bacillus, increasingly identified as a nosocomial pathogen in compromised patients. Trimethoprim/sulfamethoxazole is one of the most potent agents for treating S. maltophilia infection. However, resistance to trimethoprim/sulfamethoxazole is apparently increasing. Integrons capture genes as part of a genetic element known as a gene cassette. Most cassettes within integrons with known functions confer antibiotic or quaternary ammonium compound (QAC) resistance. In an Argentinian study on the correlation between class 1 integrons and increasing MICs of trimethoprim/ sulfamethoxazole for S. maltophilia isolates, Barbolla et al. reported that only 0.9% of S. maltophilia harboured class 1 integrons. In contrast, a higher prevalence of class 1 integrons was revealed in the present study. We decided to look at the relationship between the high prevalence of class 1 integrons and trimethoprim/sulfamethoxazole resistance in S. maltophilia. One hundred and three clinical S. maltophilia isolates were collected from different patients at a southern Taiwan medical centre in 2003. During the isolation period, no infectious outbreaks occurred. Identification was performed with API 20E (bioMerieux, La Balme, France) or the Vitek automated system (bioMerieux, Vitek, Hazelwood, MO, USA). Random amplified polymorphic DNA markers (Operon Technologies, Inc., Alameda, CA, USA) were used to clarify the relationships between isolates. Antimicrobial susceptibility to trimethoprim/sulfamethoxazole was determined by an agar dilution method. S. maltophilia ATCC 13637 was used as a wild-type control strain. All gene cassettes within integrons were amplified with primers specific for the integron 50 and 30 conserved segments and then sequenced. Sequences were compared using the BLAST search programme. Sulfamethoxazole resistance determinants were detected with specific primers for sul1 (F, GGATTTTTCTTGAGCCCCGC; R, CATTGCCGATC GCGTGAAGT) and sul2 (F, CCTGTTTCGTCCGACACAGA; R, GAAGCGCAGCCGCAATTCAT). Statistical calculations included x test and Fisher’s exact test. Twenty-six (25%) isolates revealed resistance to trimethoprim/ sulfamethoxazole. The trimethoprim/sulfamethoxazole-resistant isolates harboured a significantly higher (69%) proportion of class 1 integrons than trimethoprim/sulfamethoxazolesusceptible isolates (P , 0.001, Table 1). Twenty-one of 26 trimethoprim/sulfamethoxazole-resistant isolates had the sul1 gene and 81% were associated with class 1 integrons, which was significantly higher than sul1-negative isolates (P 1⁄4 0.0192). The identified gene cassettes within class 1 integrons included aminoglycoside resistance genes aacA4, aadA2, aadB and aac(6)-Ib0; chloramphenicol resistance gene cmlA and QAC resistance genes smr, qacF and qacH. Two isolates carried multigene cassettes: qacH-aadB-cmlA-aadA2 and aac(6)-Ib0/aacA4, respectively. The incidence of trimethoprim/sulfamethoxazole resistance was significantly associated with the presence of QAC resistance genes, e.g. smr, qacF and qacH, carried on class 1 integrons (P , 0.001, Table 1). Increasing proportions of isolates containing class 1 integrons were detected in S. maltophilia. However, no class 2 integrons were found. Although trimethoprim/sulfamethoxazole resistance was significantly associated with class 1 integrons, the trimethoprim resistance gene was not encoded by integrons. Recent studies indicate that resistance genes are linked to insertion sequence common region (ISCR) elements, which are DNA sequences found beyond and close to the 30 conserved sequences of class 1 integrons. These ISCR elements have been identified in numerous Gram-negative bacteria and a few Gram-positive bacteria and are responsible for the mobility and dissemination of many antibiotic resistance genes, including extendedspectrum b-lactamase and carbapenemase genes and aminoglycoside, chloramphenicol, quinolone as well as trimethoprim resistance genes. A previous study by Toleman et al. examined

Characterization of two quaternary ammonium chloride-resistant bacteria isolated from papermaking processing water and the biocidal effect on their biofilm formation

Biofilm formation and growth on equipment surfaces is detrimental to papermaking processes. However, a fundamental understanding leading to an optimal control strategy is yet to be found. Quaternary ammonium compounds (QAC) are being increasingly applied in the papermaking processes. Among them, the most frequently applied, N-alkyl-benzyl-dimethyl ammonium chloride, was employed in this study. To foster fundamental understanding of QAC efficacy towards biofilm control, two of the highest QAC-resistant strains of bacteria were isolated from the papermaking processing water and employed as model organisms. By the 16S rRNA gene sequencing technique, two Gram-negative rods with QAC resistance were identified as Morganella morganii (HB22) and the biofilm-forming Pseudomonas putida (HB45). The minimal inhibition concentration (MIC) values were 8 mg L −1 for HB22 and 16 mg L −1 for HB45, respectively, against QAC in basal medium (BM). However, both strains could grow under more than 150 mg L −1 QAC in basal medium at neutral pH. As observed by crystal violet assay and fluorescent confocal microscopy, HB45 formed biofilm more slowly on stainless steel coupon which is the prime material of papermachine than on the surface of polystyrene, the most common material for food packaging and semi-finished/finished products. HB45 formed biofilm more slowly on stainless steel coupons than on polystyrene Petri dish surfaces, as observed by crystal violet assay and fluorescent confocal microscopy. For HB45, there was a marginal increase of inhibition of biofilm formation by increasing QAC concentration from 50 to 75 mg L −1. By comparison of inhibition concentration in liquid state and in biofilm formation, the results implicate that the current practice in papermaking processes of adding biocide to qualitatively control planktonic bacterial communities does not ensure control of biofilm formation.

Widespread Distribution of Disinfectant Resistance Genes among Staphylococci of Bovine and Caprine Origin in Norway

We demonstrate here a widespread distribution of genes mediating efflux-based resistance to quaternary ammonium compounds (QACs) in staphylococci from unpasteurized milk from 127 dairy cattle herds and 70 dairy goat herds. QAC resistance genes were identified in 21% of the cattle herds (qacA/B, smr, qacG, and qacJ) and in 10% of the goat herds (qacA/B and smr). Further examination of 42 QAC-resistant bovine and caprine isolates revealed the following genes: qacA/B (12 isolates) was present in four different species of coagulase-negative staphylococci (CoNS), smr (27 isolates) was detected in eight different CoNS species and in Staphylococcus aureus on a previously reported plasmid (pNVH99), qacG (two isolates) was detected on two plasmids (pST94-like) in Staphylococcus cohnii and Staphylococcus warneri, and qacJ (two isolates) was found in Staphylococcus hominis and Staphylococcus delphini on a plasmid (pNVH01) previously found in equine staphylococci. Isolation of indistinguishable pulsed-field gel electrophoresis (PFGE) CoNS types from tank milk and mammary quarter milk samples in a dairy cattle herd suggested that these QAC-resistant staphylococci were of intramammary origin. Indistinguishable or closely related PFGE types of bovine QAC-resistant CoNS were observed in different herds. One particular bovine S. warneri PFGE type was isolated repeatedly from samples collected during a 30-month period in a herd, showing long-term persistence. In conclusion, it seems that the widespread distribution of staphylococci carrying QAC resistance genes in Norwegian dairy cattle and goat herds is the result of both the intra- and interspecies spread of QAC resistance plasmids and the clonal spread of QAC-resistant strains.

Incidence of Class 1 Integrons in a Quaternary Ammonium Compound-Polluted Environment

Samples of effluent and soil were collected from a reed bed system used to remediate liquid waste from a wool finishing mill with a high use of quaternary ammonium compounds (QACs) and were compared with samples of agricultural soils. Resistance quotients of aerobic gram-negative and gram-positive bacteria to ditallowdimethylammomium chloride (DTDMAC) and cetyltrimethylammonium bromide (CTAB) were established by plating onto nutrient agar containing 5 microg/ml or 50 microg/ml DTDMAC or CTAB. Approximately 500 isolates were obtained and screened for the presence of the intI1 (class 1 integrase), qacE (multidrug efflux), and qacE Delta1 (attenuated qacE) genes. QAC resistance was higher in isolates from reed bed samples, and class 1 integron incidence was significantly higher for populations that were preexposed to QACs. This is the first study to demonstrate that QAC selection in the natural environment has the potential to coselect for antibiotic resistance, as class 1 integrons are well-established vectors for cassette genes encoding antibiotic resistance.

Plasmid pB8 is closely related to the prototype IncP-1β plasmid R751 but transfers poorly to Escherichia coli and carries a new transposon encoding a small multidrug resistance efflux protein

The IncP-1β plasmid pB8, which confers resistance to amoxicillin, spectinomycin, streptomycin, and sulfonamides, was previously isolated from a sewage treatment plant. It was found to possess abnormal conjugative transfer properties, i.e., transfer to Escherichia coli by conjugation or electroporation could not be detected. We showed in this study that plasmid pB8 is transferable to E. coli by conjugation, but only at low frequencies and under specific experimental conditions, a phenomenon that is very unusual for IncP-1 plasmids. Determination of the complete 57,198 bp pB8 nucleotide sequence revealed that the backbone of the plasmid consists of a complete set of IncP-1β-specific genes for replication initiation, conjugative plasmid transfer, stable inheritance, and plasmid control with an organisation identical to that of the prototype IncP-1β plasmid R751. All of the minor differences in the pB8 backbone sequence compared to that of R751 were also found in other IncP-1β plasmids known to transfer to and replicate in E. coli. Plasmids pB8 and R751 can be distinguished with respect to their accessory genetic elements. First, the pB8 region downstream of the replication initiation gene trfA contains two transposable elements one of which is similar to Tn 5501. The latter transposon encodes a putative post-segregational-killing system and the small multidrug resistance (SMR) protein QacF, mediating quaternary ammonium compound resistance. The accessory genes in this region are not responsible for the poor plasmid transfer to E. coli since a pB8 deletion derivative devoid of all genes in that region showed the same conjugative transfer properties as pB8. A Tn 5090/Tn 402 derivative carrying a class 1 integron is located between the conjugative transfer modules. The Tn 5090/Tn 402 integration-sites are exactly identical on pB8 and R751 but in contrast to R751 the pB8 element carries the resistance gene cassettes oxa-2 for amoxicillin resistance and aadA4 for streptomycin/spectinomycin resistance, the integron-specific conserved segment consisting of the genes qacEΔ1, sul1, and orf5, and a truncated tni transposition module ( tniAB). Although future work will have to determine the molecular basis for the poor transfer of pB8 to E. coli, our findings demonstrate that the host-range of typical IncP-1 plasmids may be less broad than expected.

Molecular epidemiology and disinfectant susceptibility of Listeria monocytogenes from meat processing plants and human infections

We have investigated the molecular epidemiology of Listeria monocytogenes from the meat processing industry producing cold cuts and from cases of human listeriosis by discriminative pulsed-field gel electrophoresis (PFGE). A subset of the isolates was also investigated for susceptibility to a disinfectant based on quaternary ammonium compounds (QAC) frequently used in the meat processing industry. The purpose of this investigation was to obtain knowledge of sources, routes of contamination and genetic types of L. monocytogenes present along the production line in the meat processing industry, and to compare meat industry isolates and human isolates. Of the 222 isolates from four meat-processing plants, 200 were from two plants responsible for nearly 50% of the production of cold cuts in the Norwegian market. The strain collection included historical routinely sampled isolates (1989–2002) and isolates systematically sampled through a one year period (November 2001 to November 2002) from fresh meat and production environments in three plants. No isolates were obtained in samples from employees (throat, faeces). Human strains included all available reported isolates from Norwegian patients in selected time periods. The L. monocytogenes PFGE data showed a large genetic heterogeneity, with isolates separated into two genetic lineages and further subdivided into 56 different PFGE profiles. Certain profiles were observed on both sides of production (before and after heat treatment) indicating contamination of end products by fresh meat or fresh meat environments. While fresh meat isolates almost exclusively grouped within lineage I, isolates from end products showed a more balanced distribution between lineages I and II. Ten profiles were common among isolates from human and meat industry. Typing of human isolates identified a previously unrecognised outbreak. Generally, a higher QAC resistance incidence was observed among isolates from the meat processing industry than among human isolates although large plant to plant differences were indicated. No correlation between resistance and PFGE profile or resistance and persistence was observed.

Molecular epidemiology and disinfectant susceptibility of Listeria monocytogenes from meat processing plants and human infections

We have investigated the molecular epidemiology of Listeria monocytogenes from the meat processing industry producing cold cuts and from cases of human listeriosis by discriminative pulsed-field gel electrophoresis (PFGE). A subset of the isolates was also investigated for susceptibility to a disinfectant based on quaternary ammonium compounds (QAC) frequently used in the meat processing industry. The purpose of this investigation was to obtain knowledge of sources, routes of contamination and genetic types of L. monocytogenes present along the production line in the meat processing industry, and to compare meat industry isolates and human isolates. Of the 222 isolates from four meat-processing plants, 200 were from two plants responsible for nearly 50% of the production of cold cuts in the Norwegian market. The strain collection included historical routinely sampled isolates (1989–2002) and isolates systematically sampled through a one year period (November 2001 to November 2002) from fresh meat and production environments in three plants. No isolates were obtained in samples from employees (throat, faeces). Human strains included all available reported isolates from Norwegian patients in selected time periods. The L. monocytogenes PFGE data showed a large genetic heterogeneity, with isolates separated into two genetic lineages and further subdivided into 56 different PFGE profiles. Certain profiles were observed on both sides of production (before and after heat treatment) indicating contamination of end products by fresh meat or fresh meat environments. While fresh meat isolates almost exclusively grouped within lineage I, isolates from end products showed a more balanced distribution between lineages I and II. Ten profiles were common among isolates from human and meat industry. Typing of human isolates identified a previously unrecognised outbreak. Generally, a higher QAC resistance incidence was observed among isolates from the meat processing industry than among human isolates although large plant to plant differences were indicated. No correlation between resistance and PFGE profile or resistance and persistence was observed.

Novel Plasmid-Borne Gene qacJ Mediates Resistance to Quaternary Ammonium Compounds in Equine Staphylococcus aureus , Staphylococcus simulans , and Staphylococcus intermedius

We identified a novel plasmid-borne gene (designated qacJ) encoding resistance to quaternary ammonium compounds (QACs) in three staphylococcal species associated with chronic infections in four horses. qacJ was located on a 2,650-bp plasmid (designated pNVH01), a new member of the pC194 family of rolling-circle replication plasmids. The 107-amino-acid protein, QacJ, showed similarities to known proteins of the small multidrug resistance family: Smr/QacC (72.5%), QacG (82.6%), and QacH (73.4%). The benzalkonium chloride MIC for a qacJ-containing recombinant was higher than those for otherwise isogenic recombinants expressing Smr, QacG, or QacH. Molecular epidemiological analyses by pulsed-field gel electrophoresis suggested both the clonal spread of a qacJ-harboring Staphylococcus aureus strain and the horizontal transfer of pNVH01 within and between different equine staphylococcal species. The presence of pNVH01 of identical nucleotide sequence in different staphylococcal species suggests that recent transfer has occurred. In three of the horses, a skin preparation containing cetyltrimethylammonium bromide had been used extensively for several years; this might explain the selection of staphylococci harboring the novel QAC resistance gene.

Disinfectant resistance mechanisms, cross-resistance, and co-resistance

Six major classes of disinfectants and sanitizers are iodophors, quaternary ammonium compounds (QAC), peroxides, phenols, chlorine, and glutaraldehyde. Bacterial resistance to each of these classes has been reported in literature, and anecdotal reports within the biocide industry are common. Resistance to disinfectants and sanitizers can have significant impact on human health as well as serious economic consequences. The mechanisms associated with resistance have received uneven attention; in the case of resistance to QAC disinfectants and peroxides our knowledge extends to the genetic level while for the other classes the literature consists of largely phenomenological descriptions of its occurrence. Even less is known about the frequency with which resistance develops and the impact of environmental factors on resistance development. Amongst environmental factors the role of biofilms is of interest particularly as they relate to the exposure of bacteria to sublethal concentrations of disinfectant. In industrial systems the selective pressure from preservative usage has been postulated to play a role in disinfectant resistance development through mechanisms of cross-resistance; some isothiazolone and formaldehyde resistant bacteria are cross-resistant to QAC and/or peroxide disinfectants. Mechanism-based cross-resistance of disinfectant-resistant bacteria to antibiotics is of great interest recently, but remains a ripe area for systematic investigation. Co-resistance of disinfectant-resistant bacteria to antibiotics occurs as a result of QAC resistance genes being located on transmissible plasmids and within conserved regions of integrons, each of which has been shown to carry multiple antibiotic resistance genes.

Genetic linkage between resistance to quaternary ammonium compounds and beta-lactam antibiotics in food-related Staphylococcus spp.

Little is known about the occurrence of antimicrobial resistance determinants in staphylococci isolated from food and food processing industries. Quaternary ammonium compound (QAC)-resistant coagulase-negative staphylococci (CNS) isolated from food and food-processing industries were investigated for the presence of genetic determinants (qacA/B and qacC/smr) encoding resistance to the QAC benzalkonium chloride (BC), several antibiotic resistance genes, and staphylococcal insertion sequences IS257 and IS256. Six qacA/B-harboring strains were resistant to penicillin and hybridized to a blaZ probe. The qacA/B and blaZ probes hybridized to plasmids of similar size in three isolates. Molecular and genetic characterization of the 23-kb plasmid (pST6) of Staphylococcus epidermidis St.6 revealed the presence of qacB adjacent to an incomplete beta-lactamase transposon Tn552 encoding the gene cluster blaZ, blaR, and blaI. Sequence analysis of flanking regions and the intergenic region between blaZ and qacB revealed the presence of IS257 downstream of blaZ as well as sin and binR between blaZ and qacB. In the three other BC and penicillin-resistant strains, the qacA/B and blaZ genes were located on separate plasmids. A qacC harboring S. epidermidis strain (St.17) also hybridized to tetK (tetracycline resistance) and ermB (erythromycin resistance) genes. The individual genes were located on separate plasmids, suggesting no linkage between QAC and antibiotic resistance determinants. Plasmid-free Staphylococcus aureus RN4220 allowed uptake of the pST6 plasmid DNA, indicating that the resistance genes could potentially be transferred to pathogens under selective stress. In conclusion, presence of both resistance determinants could lead to co-selection during antimicrobial therapy or disinfection in hospitals or in food industries.

Plasmid-borne smr gene causes resistance to quaternary ammonium compounds in bovine Staphylococcus aureus.

Resistance to quaternary ammonium compounds (QAC) in staphylococci is common in hospital environments and has been described in the food industry. Little is known about staphylococcal QAC resistance associated with animal disease, although such disinfectants are widely used in veterinary medicine. In order to investigate the occurrence of QAC resistance in staphylococci isolated from QAC-exposed animals, 32 penicillin- and tetracycline-resistant and 23 penicillin- and tetracycline-susceptible Staphylococcus aureus isolates collected from milk from cows with mastitis during a 4-year period were selected for QAC susceptibility studies and genetic characterization. The isolates originated from four different herds that used a common pasture with a joint milking parlor in the summer. During the pasture season, a teat cream containing the QAC cetyltrimethylammonium bromide had been used daily for more than 10 years for mastitis control. Three of the penicillin- and tetracycline-resistant isolates, which were recovered from three different cows during a 20-month period, were resistant to QAC. Plasmid analysis, PCR, and DNA sequencing revealed a novel plasmid of 2,239 bp containing the smr gene. The plasmid, designated pNVH99, has similarities to small, smr-containing staphylococcal plasmids previously found in human and food isolates. pNVH99 is a new member of the pC194 family of rolling-circle replication plasmids. The three QAC-resistant isolates, as well as 28 of the 29 remaining penicillin- and tetracycline-resistant isolates, were indistinguishable by pulsed-field gel electrophoresis. The study indicates that the occurrence and spread of QAC-resistant S. aureus among dairy cows may be a problem that needs further investigation.

Disinfectant and antibiotic resistance of lactic acid bacteria isolated from the food industry.

Quaternary ammonium compounds (QACs) are widely used as disinfectant in medical and food environments. There is a growing concern about the increasing incidence of disinfectant-resistant microorganisms from food. Disinfectant-resistant lactic acid bacteria (LAB) may survive disinfection and cause spoilage problems. Moreover, resistant LAB may potentially act as a reservoir for resistance genes. A total number of 320 LAB from food industry and meat were screened for resistance to the QAC benzalkonium chloride (BC). Out of 320 strains, five strains (1.5%) were considered to be resistant and 56 (17.5%) were tolerant to BC. The resistant strains were isolated from food processing equipment after disinfection. The resistant, tolerant, and some sensitive control bacteria were examined for susceptibility to 18 different antibiotics, disinfectants, and dyes using disc agar diffusion test and microdilution method. Little systematic cross-resistance between BC and any of the antimicrobial agents tested were detected except for gentamycin and chlorhexidine. A BC-tolerant strain was much easier to adapt to higher levels of BC as compared to a BC-sensitive strain. No known gram-positive QAC resistance genes (qacA/B, qacC, qacG, and qacH) were detected in the BC-resistant strains. Identification to species level of the BC-resistant isolates was carried out by comparative analysis of 16S-rDNA sequencing. In conclusion, resistance to BC is not frequent in LAB isolated from food and food environments. Resistance may occur after exposure to BC. The BC resistant isolates showed no cross-resistance with other antimicrobial compounds, except for gentamycin and chlorhexidine. Nevertheless, BC-resistant LAB may be isolated after disinfection and may contribute to the dissemination of resistance.

Bacterial resistance to disinfectants containing quaternary ammonium compounds

Quaternary ammonium compounds (QAC) are widely used as disinfectants in both medical and food environments. Microbial contaminants are, therefore, regularly exposed to their action and the isolation from clinical and food sources of resistant bacteria continues to be reported in many countries. Resistance to QAC in clinical strains of staphylococci is encoded by one of at least three resistance genes, designated qacA, qacB and qacC. Using hybridisation analysis, we have shown that these QAC resistance genes are also distributed among staphylococcal strains in the food industry. In addition, we have discovered two new resistance determinants in these food isolates, which are now being characterised and sequenced. Although the general level of resistance of pure cultures is low, the resistant strains have originally been isolated after exposure to the recommended user concentration of a commercial brand of QAC. We have also studied resistance to QAC in pseudomonads isolated from the food industry. Their level of resistance is much higher than that found in staphylococci. About 30% of the collected strains were able to grow in 200 μg·ml −1 benzalkonium chloride, the lowest recommended use concentration for this commonly used type of QAC.

Resistance to quaternary ammonium compounds in Staphylococcus spp. isolated from the food industry and nucleotide sequence of the resistance plasmid pST827

The complete nucleotide sequence of the 2.8 kb plasmid pST827 involved in resistance to the quaternary ammonium compound (QAC) benzalkonium chloride in meat-associated staphylococci was determined. An open reading frame (ORF) similar to the QAC resistance genes qacC, ebr and smr previously reported from clinical staphylococcal strains was identified (qacC'). In addition an ORF coding for a protein (Rep827) showing extensive homology to reported replication proteins of Gram-positive organisms was found. The occurrence of known QAC resistance gene (qacA-C) among staphylococcal strains isolated from food processing plants was studied by hybridization analysis. Of 191 isolates, 25 were resistant to benzalkonium chloride. Five of these gave no hybridization signals to probes specific for qacA-C. Further hybridization analysis indicated that pST827 or closely related plasmids are widespread among QAC-resistant staphylococcal strains. The finding of resistant staphylococci in different areas of the food processing industry indicates that QAC resistance is a potential problem in the food processing industry.