Quality Reads Research Articles

243 Translating Maternal Vitamin and Mineral Supplementation Effect on Early Developing Fetus Through Hepatic Long Non-Coding Rnas Profile in Beef Heifers

Abstract Maternal nutrition is critical during pregnancy as the fetus relies on the nutrients from the dam. Fetal organogenesis starts during the first trimester. Thus, an appropriate supply of nutrients, including vitamins and minerals, is indispensable. In the field of fetal developmental programming, there is still a lack of knowledge based on appropriate livestock models to explain the role of regulatory factors in translating the effect of maternal minerals and vitamins on fetal development and metabolic function. Therefore, this study was designed to investigate the effect of maternal vitamin and mineral supplementation (VTM -d 71 periconceptual to d 83 of pregnancy) on fetal liver expression of long non-coding RNAs (lncRNAs) and their potential regulatory metabolic pathways. Angus crossbreed beef heifers (n = 16) were supplemented (VTM, n = 8) or not (NoVTM, n = 8) with 113 g· heifer-1· day-1 of mineral premix (Purina Wind & Rain Storm All-Season 7.5 Complete) and all heifers were bred with female sexed semen from a single sire. Transcriptomic profiles were determined with RNA-Seq in fetal livers collected on d 83 ± 0.27 of gestation. After data quality control and read mapping, lncRNAs were predicted using the FEELnc pipeline. Using the DESeq2 software, we identified 50 differentially expressed novel lncRNAs (expression of 32 lncRNAs was upregulated and 18 were downregulated; FDR < 0.05) located either downstream, upstream, or in exonic, or intronic regions of 51 genes (including PFKP, SLC30A10, KCNH8, ZNF451, MINPP1, BCL9, PAH, ITPR2, AHCY, and ABCG8), potentially regulating their expression. These genes could affect pathways (FDR < 0.1) such as PI3K signaling, mineral storage and transport, and amino acids biosynthetic pathways (i.e., cysteine and methionine biosynthesis). Collectively, these results suggest that periconceptual maternal vitamin and mineral supplementation affects the expression of lncRNAs and potentially regulates the expression of genes involved in fetal liver development and function.

Muscle Transcriptome Sequencing Revealed Thermal Stress-Responsive Regulatory Genes in Farmed Rohu, Labeo rohita (Hamilton, 1822).

Rohu, Labeo rohita, is one of the most important aquaculture species in the Indian subcontinent. Understanding the molecular-level physiological responses to thermal stress or climate change is essential. In the present work, transcriptome sequencing was carried out in the muscle tissue of the rohu in response to heat stress (35°C) in comparison with the control (28°C). A total of 125Gb of sequence data was generated, and the raw-reads were filtered and trimmed, which resulted in 484 million quality reads. Reference-based assembly of reads was performed using L. rohita genome, and a total of 90.17% of reads were successfully mapped. A total of 37,462 contigs were assembled with an N50 value of 1854. The differential expression analysis revealed a total of 107 differentially expressed genes (DEGs) (15 up-, 37 down-, and 55 neutrally regulated) as compared to the control group (Log2FC > 2, P < 0.05). Gene enrichment analysis of DEGs indicates that transcripts were associated with molecular, biological, and cellular activities. The randomly selected differentially expressed transcripts were validated by RT-qPCR and found consistent expression patterns in line with the RNA-seq data. Several transcripts such as SERPINE1(HSP47), HSP70, HSP90alpha, Rano class II histocompatibility A beta, PGC-1 and ERR-induced regulator, proto-oncogene c-Fos, myozenin2, alpha-crystallin B chain-like protein, angiopoietin-like protein 8, and acetyl-CoA carboxylases have been identified in muscle tissue of rohu that are associated with stress/immunity. This study identified the key biomarker SERPINE1 (HSP47), which showed significant upregulation (~ 2- to threefold) in muscle tissue of rohu exposed to high temperature. This study can pave a path for the identification of stress-responsive biomarkers linked with thermal adaptations in the farmed carps.

Transcriptome analysis of digestive diverticula of Hong Kong oyster (Crassostrea hongkongesis) infected with Vibrio harveyi

The Hong Kong oyster (Crassostrea hongkongesis), as the main marine aquaculture shellfish in the South China Sea, not only has high economic and ecological value, but also is an ideal model for conducting research on pathogen host interaction. However, diseases caused by Vibrio pose a serious impediment to the culture of C. hongkongesis. In this study, we performed transcriptome analysis of digestive diverticula of C. hongkongesis infected with V. harveyi. A total of 977, 689, 912 high quality reads and 955, 208, 562 valid reads were obtained. At 12, 24, 48 and 72 h post-infection, 1402, 2168, 2727 and 1398 differentially expressed genes (DEGs) were captured, respectively. GO enrichment analysis showed that DEGs were significantly enriched in cellular processes, catalytic activity, cell part and other terms. KEGG enrichment analysis revealed that these DEGs were mainly closely related to Necroptosis, RIG-I-like receptor signaling pathway, NF-kappa B signaling pathway, Toll-like receptor signaling pathway and other pathways are related. The results of WGCNA analysis indicated that THBS1, CA10, Trpm2, THAP12, PTPRT, HSPA12A, and ADAM10 were the hub genes in the gene co-expression network. This study will provide new ideas at the transcriptome level for the immune regulatory mechanisms and adaptability of the C. hongkongesis to V. infection, as well as for achieving selective breeding for Vibrio resistance in the C. hongkongesis.

Developing quality reading instruction through a contextual approach in the English Language Education

The problems discussed in this study are related to the development of the quality Reading instruction through a contextual approach for students of English language program. The purpose of the study is to improve the quality of Reading learning through a contextual approach to students of the English Language Education Study Program, FKIP, University of Lampung. This research employed Class Action Research (CAR) which is intended to provide information on how to take appropriate actions to improve student activities in the learning process with a contextual learning approach that has an impact on increasing student learning achievement. The results showed that the quality of Reading learning increased through a contextual approach in the English Language Education Study Program students. In cycle I the average value is 62.4. In cycle II the average value increases to 68.7. In cycle III the average value is 77.2. This proves that the use of a contextual approach is able to improve the quality of reading learning for English Language Education Study Program students, FKIP, University of Lampung.

Ceftriaxone-resistant Salmonella Typhi isolated from paediatric patients in north India: Insights into genetic profiles and antibiotic resistance mechanisms

PurposeTo investigate the antibiotic resistance and genetic profile of ceftriaxone-resistant Salmonella Typhi isolated from the blood culture of two paediatric cases of typhoid fever and one from the stool culture of their household contact, in North India. MethodsIn this study, whole-genome sequencing was carried out with paired-end 2 ​× ​150 bp reads on Illumina MiSeq (Illumina, USA) employing v2 and v3 chemistry. To check data quality, adapters and low-quality sequences were removed through Trimmomatic-v0.36. High quality reads were then assembled de novo using A5-miseq pipeline. For further refinement, reference-guided contig ordering and orienting were performed on the scaffold assemblies using ABACAS (http://abacas.sourceforge.net/). The assembled genome was annotated using Prokka v1.12 to identify and annotate the gene content. Plasmid replicons in bacterial isolates were identified by PlasmidFinder, whereas mobile genetic elements were predicted using Mobile Element Finder. Referenced-based SNP tree with maximum likelihood method was built with CSI phylogeny v1.4. ResultsAll three isolates exhibited resistance to ceftriaxone, cefixime, ciprofloxacin, ampicillin, and co-trimoxazole, while demonstrating sensitivity to azithromycin and chloramphenicol. The whole-genome sequencing of these strains revealed the presence of blaCTX-M-15 gene for cephalosporin resistance in addition to gyrA, qnr and IncY plasmid replicon. A 5 ​kb IS91 Sbo1 gene cassette (IncY plasmid) was identified which carried extended spectrum β-lactamase blaCTX-M-15, blaTEM-1D (resistance to ampicillin and cephalosporin), sul2, dfrA14 (resistant to trimethoprim-sulfamethoxazole) and qnrS (resistant to ciprofloxacin). These isolates belong to H58 lineage and grouped as sequence type 1 (ST1) on multilocus sequence typing (MLST) analysis. ConclusionIn the present study we report the isolation of blaCTX-M-15 positive S. Typhi from two paediatric patients presenting with fever and one from stool culture of their contact from North India and highlight the need for further investigations to understand the different factors contributing to ceftriaxone resistance in Salmonella Typhi.

More important than ever before? Assessing readers’ willingness to pay for local news as a constituent for sustainable business models

ABSTRACT In our study we explore sustainable business models for local newspapers by combining data from content analysis with data from a choice-based conjoint analysis and survey data from 160 readers of a German regional newspaper. Drawing from news value theory, we try to answer which content matters most to consumers of local newspapers, thus supporting local publishers’ development of marketable value propositions. Based on multivariate regression analysis, our results suggest that consumers value articles covering local topics the most. We also find evidence for interaction effects of quality perception and reading behaviour on the willingness to pay.

Increasing Studentss’ Effetive Reading Speed Competence by Using The Klos Method at SMP Negeri 02 Rumbia, Indonesia Sitti Jumarni Maduha

The effective speed of reading has a very important role, because with fast reading accompanied by the ability to understand quality reading one can master science and technology. However, the habit of reading Indonesian that is not good has a negative impact on a person's level of readability, especially a student. To overcome this much needed effort and creativity of the teacher. One of them is through the application of the klos method in learning to read. This study aims to increase the Effective Reading Speed (KEM) using the clos method for Class VIII students of SMP Negeri 02 Rumbia. This classroom action research took place at SMP Negeri 02 Rumbia grade VIII, with a total of 30 students. Implementation of activities carried out through three cycles. Data from the three cycles are in the form of student and teacher observations during the learning process. The entire data was analyzed qualitatively. While the data on the results of the Effective Reading Speed (KEM) test for students using the KLOS method were analyzed quantitatively. The results of the data analysis show that learning speed reading activities using the KLOS method can increase students' Effective Reading Speed (KEM).

Early gastrointestinal tumour detection using cfDNA fragmentomes based on low-pass whole-genome sequencing (lp-WGS).

e15511 Background: As one of the most concerning world public health issue, cancer accounted for 21% of all deaths. Early cancer detection methods help reduce the chance of dying from cancer. The fragmentation patterns of plasma circulating cell-free DNA (cfDNA) in tumor patients and healthy people are different, which reflects aberrant gene-regulation in cancer patients. Measure cfDNA fragmentomics not only identify the biomarkers to detect cancer early, but also contribute to revealing the biological regulatory mechanism of cancer. In this study, a novel method, i.e. multi-fragmentomics early tumor detection method (METD) was developed, which combined multiple cfDNA fragmentation features and effectively predicted early stage cancer patients. Methods: Adapter sequences were removed from raw data which are then aligned to hg19 reference genome. Duplicated reads, low quality reads and reads aligned to sex chromosomes were removed. Fragment length were normalized through z-score and GC content were regressed out from each bin using GBM (Gradient Boosting Machine) regression tree. Using data from 100 healthy samples, the baseline were calculated. Six fragmentation features including FSD (fragment size distribution) that is a ratio of short/long fragment numbers, EM (end motif) which represent the frequency of 5’end 2-6bp sequence patterns, BPM (break-point motifs) that is the frequency of 5’ end break-point sequences, TFAS (transcription factor accessibility score) that is the rank of coverage at transcription factor binding sites, CFS (co-fragmentation score) which calculate the first principle component of the free-C correlation matrix, GES (gene expression score) that measures the predicted gene expression from cfDNA lp-WGS data were calculated for each sample. Then these 6 fragmentation features were fitted in a penalized logistic regression for cancer prediction. Data of each sample was also downsampled to 0.1x, 0.5x, 1x, 3x and 5x to test the minimum amount of data needed for this prediction model. Results: In training data set, 208 samples from gastrointestinal cancer patients and 100 samples from healthy individuals, our method METD detect tumor patients with a AUC of 0.98. The AUC is 0.95 when the training data were downsampled to 0.1x. This method was then tested in a validation data set containing 32 cancer patients and 32 healthy individuals, which showed a specificity of 0.9 and sensitivity of 0.88. Conclusions: In this study, we develop a new method for early cancer detection integrating different fragmentomics features and demonstrated that lp-WGS data even with 0.1x data can be used to distinguish cancer and healthy groups. Studies with larger cohorts is warranted to verify the performance of this method in future.

Phylogenetic analysis of the critically endangered Karpathos water frog (Anura, Amphibia): conservation insights from complete mitochondrial genome sequencing

Abstract The Karpathos water frog (Pelophylax cerigensis) is classified as Critically Endangered according to the IUCN Red List and its distribution is restricted on the island of Karpathos, South Aegean Sea. Utilizing a next generation sequencing approach, we obtained whole mitochondrial genomes of P. cerigensis to determine the species phylogenetic position within the genus Pelophylax and to clarify the phylogenetic relationship between the species’ population on Karpathos Island and the population of P. cf. bedriagae from the neighboring Rhodes Island. High-throughput sequencing generated mean ± SD = 227 945 ± 18 306 reads averaged per sample. High quality reads were assembled resulting in the complete mitogenome of P. cerigensis of a total size of 17 922 bp. Mitogenome organization was similar to other Pelophylax species, comprising of 13 Protein Coding Genes (PCGs), 22 tRNAs, two rRNAs and one Control Region. Overall mean genetic distance for the 13 PCGs, within the Ranidae family, ranged from 8.01% (COIII) to 11.6% (ATP8), while ratios of synonymous and non-synonymous substitutions were &lt;1 in all the 13 PCGs, indicating purifying selection. Maximum Likelihood and Bayesian Inference analyses based on the concatenated sequences of 13 PCGs and two rRNAs (12S and 16S), showed that individuals from Karpathos and Rhodes form a well-supported monophyletic group with low genetic distance between them (p-distance = 0.1%). Hence, the Rhodes populations seem to belong to P. cerigensis and not to P. bedriagae as formerly thought, highlighting the need for revision of P. cerigensis current conservation status as well as further examination of the P. bedriagae species group.

ONE DAY ONE ARTICLE (ODOA): HABITUATING READING COMPREHENSION SKILLS

This article explores quality habits that can be taught to non-English department students to improve their reading comprehension skills in English-language scientific literature. By using the theory and practice of reading comprehension, students are expected to be able to get used to reading scientific writings in English at a certain stage and time. This paper was developed using a qualitative approach based on data from grounded research that explores phenomena based on inductive studies which include reading theory, reading activity, and reading habit. This study found that students can increase their knowledge by understanding aspects of activities that become routine. These activities are inherent in the quantity and quality of reading activities. The results of this paper have implications for complex literacy mastery in supporting students' higher-order thinking skills (HOTS) as an academic need in the Society 5.0 era. This article proves that there is no barrier for non-English department students to be able to master reading skills from English texts by making quality reading habits.

The transcriptome of Litopenaeus vannamei in zoea larvae and adults infected by Vibrio parahaemolyticus

IntroductionThe rapid development of the Litopenaeus vannamei industry largely depends on the acquisition of high-quality larvae. Shrimp larval development is a unique metamorphic process that results in mortality due to disease vulnerability. Currently, studies on innate immunity in shrimp are mainly focused on the adult stage, but little has been done on innate immunity in larvae.MethodsIn this study, utilizing a high-throughput Illumina sequencing approach, we compare the transcriptome of L. vannamei Zoea larvae and adults infected by Vibrio parahaemolyticus.ResultsA total of 487,887,650 high quality reads were obtained, assembled, and aggregated into 23,802 genes, among which 3315 were identified as differentially expressed genes. Then GO term enrichment analysis, KEGG pathway enrichment analysis and functional gene analysis were performed. We found that pathways that are involved in the innate immune response, such as mTOR signaling pathway, MAPK signaling pathway, and Notch signaling pathway, were more enriched in the Zoea stage compared to the adult stage, suggesting that innate immunity against Vibrio vulnificus may exist during the Zoea larvae stage.Discussionwere more enriched in the Zoea stage compared to the adult stage, suggesting that innate immunity against Vibrio vulnificus may exist during the Zoea larvae stage. These findings will provide useful information for the study of innate immunity in shrimp larvae.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

High-quality single amplicon sequencing method for illumina MiSeq platform using pool of ‘N’ (0–10) spacer-linked target specific primers without PhiX spike-in

BackgroundIllumina sequencing platform requires base diversity in the initial 11 cycles for efficient cluster identification and colour matrix estimation. This limitation yields low-quality data for amplicon libraries having homogeneous base composition. Spike-in of PhiX library ensures base diversity but reduces the overall number of sequencing reads for data analysis. To overcome such low diversity issues during amplicon sequencing on illumina platforms, we developed a high throughput single amplicon sequencing method by introducing ‘N’ (0–10) spacers in target gene amplification primers that are pooled for simple handling.ResultWe evaluated the efficiency of ‘N’ (0–10) spacer-linked primers by targeting bacterial 16S V3-V4 region, demonstrating heterogeneous base library construction. The addition of ‘N’ (0–10) spacers causes sequencing frameshift at every base that leads to base diversity and produces heterogeneous high quality reads within a single amplicon library. We have written a python based command-line software,“MetReTrim”, to trim the ‘N’ (0–10) spacers from the raw reads (https://github.com/Mohak91/MetReTrim). We further demonstrated the accuracy of this method by comparative mock community analysis with standard illumina V3-V4 primer method. The ZymoBIOMICS™ microbial community DNA standard was used as a control for this study. We performed data analysisusing the DADA2 pipeline where taxonomy was assigned using SILVA database as reference. We observed no difference between the communities represented by our method and standard illumina V3-V4 primer method.ConclusionThis method eliminates the need for PhiX spike-in for single amplicon sequencing on illumina MiSeq platform. This allows for sequencing of more number of samples in a run and a reduction in the overall cost. Given that Illumina sequencing works on SBS chemistry irrespective of the platform (such as HiSeq, MiSeq, NextSeq, NovaSeq, etc.) we propose that this strategy of using ‘N’ (0–10) spacer-linked primer design can be adopted for generating high-quality single locus amplicon sequencing in a high throughput manner across the illumina platform subject to further validation.

Functional metagenomics uncovers nitrile-hydrolysing enzymes in a coal metagenome.

Introduction: Nitriles are the most toxic compounds that can lead to serious human illness through inhalation and consumption due to environmental pollution. Nitrilases can highly degrade nitriles isolated from the natural ecosystem. In the current study, we focused on the discovery of novel nitrilases from a coal metagenome using in silico mining. Methods: Coal metagenomic DNA was isolated and sequenced on the Illumina platform. Quality reads were assembled using MEGAHIT, and statistics were checked using QUAST. Annotation was performed using the automated tool SqueezeMeta. The annotated amino acid sequences were mined for nitrilase from the unclassified organism. Sequence alignment and phylogenetic analyses were carried out using ClustalW and MEGA11. Conserved regions of the amino acid sequences were identified using InterProScan and NCBI-CDD servers. The physicochemical properties of the amino acids were measured using ExPASy's ProtParam. Furthermore, NetSurfP was used for 2D structure prediction, while AlphaFold2 in Chimera X 1.4 was used for 3D structure prediction. To check the solvation of the predicted protein, a dynamic simulation was conducted on the WebGRO server. Ligands were extracted from the Protein Data Bank (PDB) for molecular docking upon active site prediction using the CASTp server. Results and discussion: In silico mining of annotated metagenomic data revealed nitrilase from unclassified Alphaproteobacteria. By using the artificial intelligence program AlphaFold2, the 3D structure was predicted with a per-residue confidence statistic score of about 95.8%, and the stability of the predicted model was verified with molecular dynamics for a 100-ns simulation. Molecular docking analysis determined the binding affinity of a novel nitrilase with nitriles. The binding scores produced by the novel nitrilase were approximately similar to those of the other prokaryotic nitrilase crystal structures, with a deviation of ±0.5.

Characterization of the eukaryotic microbial communities in the chicken ileum in cage-free and conventional commercial housing systems

The current shift from conventional cage (CC) hen housing facilities towards cage-free (CF) hen housing in the egg industry has left many questions regarding how level of fecal exposure and exposure to other hens may influence the hen intestinal microbiota. In a previous publication we reported differences in the bacterial ileal communities and ileal morphology between hens in CC and CF production environments at a single commercial site. Here, we present the first 18S rRNA gene amplicon sequencing-based characterization of the eukaryotic ileal microbiota of adult layer hens, and their associations with intestinal health parameters and the bacterial microbiota. DNA was extracted from the ileal digesta of hens (n=32 CC, n=48 CF) using the Qiagen Powerlyzer Powersoil kit, followed by amplification of the V9 region of the 18S rRNA gene. Paired end sequencing was performed with the Illumina MiSeq platform, and the resulting reads were processed according to the Mothur MiSeq protocol in Mothur v1.43.0. De novo operational taxonomic unit (OTU) clustering was performed in mothur with a 99% similarity threshold, and OTUs were taxonomically classified with the SILVA SSU v138 reference database. OTUs classified as vertebrate, plant, or arthropod were removed, resulting in 3,136,400 high quality reads and 1,370 OTUs. Associations between OTUs and intestinal parameters were calculated using PROC GLIMMIX. PERMANOVA over Bray-Curtis distances revealed differences between CC and CF eukaryotic ileal microbiota at the whole community level, but no OTUs were differentially abundant after correcting for false discovery (P > 0.05; q > 0.1). Kazachstania and Saccharomyces, closely related genera of yeast, represented 77.1% and 9.7% of sequences respectively. Two Kazachstania OTUs and 1 Saccharomycetaceae OTU were positively correlated with intestinal permeability (r2 ≥ 0.35). Eimeria accounted for 7.6% of sequences across all samples. Intriguingly, 15 OTUs classified as Eimeria were inversely associated with intestinal permeability (r2 ≤ -0.35), suggesting Eimeria may play a more complex role in the microbiota of healthy birds than has been observed in disease challenges.

Long amplicon HiFi sequencing for mitochondrial DNA genomes.

Long-read sequencing technology is a powerful approach with application in various genetic and genomic research. Herein, we developed the pipeline for long amplicon high-fidelity (HiFi) sequencing and then applied it for sequencing mitochondrial DNA (mtDNA) genomes from pools of 79 Tibetan Mastiffs. We amplified the mtDNA genome with long-range PCR using two pairs of primers. Two rounds of circular consensus sequencing (CCS) were conducted and their accuracy was evaluated. The results indicate that the second round of CCS can improve the accuracy of HiFi reads. In addition, the analysis of 79 high-quality mtDNA genomes shows the Tibetan Mastiffs from outside of the Tibetan Plateau experienced hybridization with other dogs. The high quality reads generator (HQGR) software is provided to facilitate data analyses, which is publicly accessible on GitHub (https://github.com/Caizf-script/HQGR). Our long amplicon HiFi sequencing pipeline can also be applied in various target enrichment strategies for small genomes and candidate genes.

When Plaquing Is Not Possible: Computational Methods for Detecting Induced Phages.

High-throughput sequencing of microbial communities has uncovered a large, diverse population of phages. Frequently, phages found are integrated into their bacterial host genome. Distinguishing between phages in their integrated (lysogenic) and unintegrated (lytic) stage can provide insight into how phages shape bacterial communities. Here we present the Prophage Induction Estimator (PIE) to identify induced phages in genomic and metagenomic sequences. PIE takes raw sequencing reads and phage sequence predictions, performs read quality control, read assembly, and calculation of phage and non-phage sequence abundance and completeness. The distribution of abundances for non-phage sequences is used to predict induced phages with statistical confidence. In silico tests were conducted to benchmark this tool finding that PIE can detect induction events as well as phages with a relatively small burst size (10×). We then examined isolate genome sequencing data as well as a mock community and urinary metagenome data sets and found instances of induced phages in all three data sets. The flexibility of this software enables users to easily include phage predictions from their preferred tool of choice or phage sequences of interest. Thus, genomic and metagenomic sequencing now not only provides a means for discovering and identifying phage sequences but also the detection of induced prophages.

Student achievement trajectories in Ontario: Creating and validating a province-wide, multi-cohort and longitudinal database.

Longitudinal data that tracks student achievement over many years are crucial for understanding children's learning and for guiding effective policies and interventions. Despite being Canada's most populous province, Ontario lacks such large-scale and longitudinal data on student learning. Linking datasets across cohorts requires rigorous linkage protocols, flexible handling of complex cohort structures, methods to validate linked datasets, and viable organizational partnerships. We linked administrative data on early child development and educational achievement and merged two datasets on characteristics of students' neighborhoods and schools. We developed a linkage protocol and validated how the resulting database could be generalized to Ontario's student population. Two main individual-level data sources were linked: 1) the Early Development Instrument (EDI), a school readiness assessment of all Ontario public school kindergartners that is administered in three-year cycles, and 2) Ontario's Educational Quality and Assessment Office's (EQAO) math and reading assessments in grades 3, 6, 9, and 10. To compensate for their lack of a common personal identification number, a deterministic linkage process was developed using several administrative variables. A school-level and a neighborhood-level dataset were also later linked. We examined differences between unlinked and linked cases across several variables. We successfully linked 50% of the EDI's 374,239 cases, 86,778 of which contained all five datapoints, creating a database tracking achievement for multiple cohorts from kindergarten through grade 10, with covariates for their development, demographics, affect, neighborhoods, and schools. Analyses revealed only negligible differences between linked and unlinked cases across several demographic measures, while small differences were detected across a neighborhood socioeconomic index and some measures of child development. In conclusion, we recommend the filling of key voids in sustainable research capacity by creating representative data through linkage protocols and data verification.

Biomarkers of chromosome 17 and their association with acute lymphocytic leukemia.

Acute lymphocytic leukemia (ALL) is a very aggressive form of cancer that develops from immature lymphocytes. Most cases of ALL account for 30% of all pediatric cancers and 25% of adult cases. To identify suitable biomarkers that may help in the early diagnosis of this aggressive disease, single nucleotide polymorphism (SNP) analysis was conducted on an ALL clinical cohort. DNA sequence reads were downloaded, assessed, and trimmed. Quality reads were then mapped to chromosome 17, followed with SNP identification, and then filtered. Our analyses identified 20 SNPs that were common to more than 70% of individuals in our ALL clinical cohort but were not found in any analyzed normal sequences. These data highlight variants with a marked ALL association that may serve as prognostic and predictive ALL biomarkers.

Chinese digestive surgery interns’ learning quality and English reading proficiency during COVID-19 pandemic: Comparison between face-to-face versus WeChat teaching and learning

Gastrointestinal clinical teaching is of vital important for gastrointestinal surgery interns. However, during COVID-19 pandemic, due to frequent lockdowns and essential social distancing policy implemented in China, face-to-face teaching was interrupted significantly. To find a cost-effective way to deliver medical education to ensure that teaching and learning would be continued and uninterrupted, many social media tools and mobile applications have been used in medical teaching and learning. WeChat has been frequently employed in teaching and learning in many disciplines in Chinese universities due to its powerful functions and free cost. This study compared Chinese digestive surgery interns' learning quality, English reading proficiency, and learning satisfaction in two teaching conditions: the traditional face-to-face teaching versus WeChat teaching via an experiment. The study recruited 60 final year clinical medical students, who were randomly and equally assigned into two groups: traditional face-to-face teaching versus WeChat teaching. Interns' learning quality and learning satisfaction were measured by Likert-scale questionnaires; and their English reading proficiency was measured by the reading section in a standardized English test. The results showed that interns in WeChat group had significantly higher learning quality on understanding mechanisms and current knowledge by both self-assessment and peer-assessment. WeChat group also outperformed face-to-face group on inferencing, details, and main ideas in English reading. With regard to learning satisfaction, WeChat group were higher on learning interests, learning objectives, learning format, and English reading proficiency than face-to-face group. However, interns did not differ in terms of their learning satisfaction on medical skills, which might indicate that WeChat had limitations on training interns’ medical practical ability.