Pyrimidine Residues Research Articles

Localized chemical reactivity in double-stranded DNA associated with the intercalative binding of benzo[e]pyridoindole and benzo[g]pyridoindole triple-helix-stabilizing ligands.

Footprinting with methidiumpropyl-EDTA.FeII has been used to map the binding sites on duplex DNA of two closely related benzopyridoindole derivatives which selectively stabilize triple-helical DNA-oligonucleotide complexes. Both ligands bind to many sites, including certain oligopurine.oligopyrimidine tracts, with a weak preference for some (but not all) sequences rich in A.T base pairs. This indifference to primary sequence, with evidence of binding to the commonly disfavoured (A)n.(T)ntracts, may at least partially explain why the ligands stabilize triplex structures composed of T.A.T pairings. Neither 3-methoxy-7H-8-methyl-11- [(3'amino)propylamino]benzo[e]pyrido[4, 3-b]indole (BePI) nor 3- methoxy-7-[3'-diethylamino)propylamino]-10-methyl-11H- benzo[g]pyrido[4,3-b]indole (BgPI) affect the reaction of dimethyl sulphate or potassium tetrachloropalladinate with the N7 of purines in the major groove, but both enhance the reactivity of purines (mostly adenine residues) towards diethylpyrocarbonate, both proximal and distal to their identified binding sites. With potassium permanganate and osmium tetroxide/pyridine, probes for the accessibility of the 5,6 double bond of pyrimidine residues, BgPI has a more potent effect than BePI and, generally, the reaction with KMnO4 is more pronounced than that with OsO4. BgPI conspicuously potentiates the oxidation of pyrimidines in the triplet sequences 3'-ATA, 3'-GTA and 3'-GCA, whereas BePI enhances the reactivity of OsO4 towards thymine in sequences 3'-ATYR, with no effect on cytosine residues. Thus, despite their structural homology and common lack of specific sequence preferences, the two benzopyridoindole derivatives induce distinct conformational changes in duplex DNA, not just within the sites where footprints can be detected.

The relative contributions of various transcription factors to the overall promoter strength of the mouse ribosomal protein L30 gene.

The promoter of the mouse gene encoding ribosomal protein L30 contains binding sites for four transcription factors; alpha (RFX-1), beta (GABP), gamma and delta (YY-1/NF-E1/UCRBP). The relative contributions of these factors to the strength of the rpL30 promoter in vivo and the degree of synergism among the factors was evaluated by transfection experiments using a series of mutant promoters in which one or more of the binding sites was drastically altered to prevent recognition by its cognate factor. Our results indicated that GABP and RFX-1 are the major determinants of the rpL30 promoter strength, acting synergistically to boost activity more than eightfold over that which occurs in their absence. The contributions of gamma and delta became evident only when the promoter was weakened by eliminating the participation of the other factors. Indeed, as the promoter strength was progressively reduced, the contribution of each individual factor increased, implying that the capacity of the general transcription machinery to be stimulated by these factors is saturable. The activity of the rpL30 promoter was significantly diminished when three pyrimidine residues spanning the start site were converted to purines, indicating that the integrity of the oligopyrimidine tract is also a determinant of the transcriptional efficiency. These studies reveal the hierarchy of importance of four transcription factors that govern the expression of the rpL30 gene. Moreover, they define the graduated levels of promoter activity that would result from deficiencies of these factors in any particular cell type. This information may provide a useful paradigm for understanding the transcriptional regulation of other ubiquitously expressed genes.

In vivo definition of an archaeal promoter.

We have used a plasmid-based transcriptional reporter system to examine the transcriptional effects of 33 single point mutations in the box A region (TATA-like sequence) of the Haloferax volcanii tRNA(Lys) promoter. The most pronounced effects on transcriptional efficiency were found when the nucleotides corresponding to the TATA-like region were altered. Promoters with wild-type or higher levels of transcriptional activity conformed to the general archaeal box A consensus, 5'-T/CTTAT/AA-3'. The preference for a pyrimidine residue in the 5' position of this region and the exclusion of guanine and cytosine in the next four positions in the 3' direction are defining characteristics shared by all efficient archaeal promoters. We have also observed that replacement of a 10-nucleotide purine-rich sequence, located 5' of the H. volcanii tRNA(Lys) box A element, completely abolished transcription from this promoter. These data show that the H. volcanii tRNA(Lys) promoter is dependent on two separate, and essential, sequence elements. The possible functions of these sequences, in view of the recent descriptions of eucaryal-like transcription factors for Archaea, are discussed.

Purification and Characterization of an Estrogen-regulated Xenopus Liver Polysomal Nuclease Involved in the Selective Destabilization of Albumin mRNA

A previous report from this laboratory described an estrogen-regulated endoribonuclease activity on Xenopus liver polysomes which had properties one might expect for a messenger ribonuclease involved in the regulated destabilization of albumin mRNA (Pastori, R. L., Moskaitis, J. E., and Schoenberg, D. R. (1991) Biochemistry 30, 10490-10498). This report describes the purification and properties of this ribonuclease. The purified nuclease fraction contained a doublet of 62 and 64 kDa and a small amount of a 40-kDa peptide. In situ analysis on both denaturing and nondenaturing gels using an albumin transcript as substrate showed all three proteins possess nuclease activity. Peptide mapping and Western blot with a polyclonal antiserum showed the 62- and 64-kDa peptides to be isoforms, and the 40-kDa peptide to be a degradation product of the larger species. Two-dimensional gel electrophoresis further separated the 62- and 64-kDa species into three pairs of proteins, with isoelectric points of 9.6, 9.8, and 9.8. The purified ribonuclease rapidly degraded a full-length albumin transcript, yet had no effect on either a full-length albumin antisense transcript or full-length ferritin transcript. A number of properties of the purified nuclease were characterized, including the effects of salt, divalent cations, EDTA, sulfhydryl reagents, and temperature. Treatment of the polysomal nuclease with micrococcal nuclease had no effect, indicating that this enzyme does not require an RNA cofactor for activity. Finally, primer extension mapped the major cleavage site to an overlapping repeated sequence APyrUGA, with cleavage between and adjacent to the two pyrimidine residues generating fragments with 5'-hydroxyls.

Cleavage of tRNA with imidazole and spermine imidazole constructs: a new approach for probing RNA structure.

Hydrolysis of RNA in imidazole buffer and by spermine-imidazole conjugates has been investigated. The RNA models were yeast tRNA(Asp) and a transcript derived from the 3'-terminal sequence of tobacco mosaic virus RNA representing a minihelix capable of being enzymatically aminoacylated with histidine. Imidazole buffer and spermine-imidazole conjugates in the presence of free imidazole cleave phosphodiester bonds in the folded RNAs in a specific fashion. Imidazole buffer induces cleavages preferentially in single-stranded regions because nucleotides in these regions have more conformational freedom and can assume more easily the geometry needed for formation of the hydrolysis intermediate state. Spermine-imidazole constructs supplemented with free imidazole cleave tRNA(Asp) within single-stranded regions after pyrimidine residues with a marked preference for pyrimidine-A sequences. Hydrolysis patterns suggest a cleavage mechanism involving an attack by the imidazole residue of the electrostatically bound spermine-imidazole and by free imidazole at the most accessible single-stranded regions of the RNA. Cleavages in a viral RNA fragment recapitulating a tRNA-like domain were found in agreement with the model of this molecule that accounts for its functional properties, thus illustrating the potential of the imidazole-derived reagents as structural probes for solution mapping of RNAs. The cleavage reactions are simple to perform, provide information reflecting the state of the ribose-phosphate backbone of RNA and can be used for mapping single- and double-stranded regions in RNAs.

The nature of the nucleotide at the 5' side of the tRNA Su9 anticodon affects UGA suppression in Escherichia coli.

In Escherichia coli a UGA codon can be efficiently suppressed by a suppressor tRNA(Trp) called Su9. Here, we show that the level of UGA suppression is determined by the nature of the nucleotide at the 5' side of the anticodon of the suppressor (position 33). UGA suppression occurs when a pyrimidine residue is located in position 33 of the tRNA, and suppression is more efficient with a U than with a C in this position. On the other hand, when a purine residue is located at this position UGA suppression is extremely low. These results show that in the case of tRNA Su9, the UGA codon context effect does not require base pairing between the nucleotide at the 3' side of the codon and the 5' side of the anticodon.

Solution structure of a pyrimidine.purine.pyrimidine DNA triplex containing T.AT, C+.GC and G.TA triples.

Under certain conditions, homopyrimidine oligonucleotides can bind to complementary homopurine sequences in homopurine-homopyrimidine segments of duplex DNA to form triple helical structures. Besides having biological implications in vivo, this property has been exploited in molecular biology applications. This approach is limited by a lack of knowledge about the recognition by the third strand of pyrimidine residues in Watson-Crick base pairs. We have therefore determined the solution structure of a pyrimidine.purine.pyrimidine (Y.RY) DNA triple helix containing a guanine residue in the third strand which was postulated to specifically recognize a thymine residue in a Watson-Crick TA base pair. The structure was solved by combining NMR-derived restraints with molecular dynamics simulations conducted in the presence of explicit solvent and counter ions. The guanine of the G-TA triple is tilted out of the plane of its target TA base pair towards the 3'-direction, to avoid a steric clash with the thymine methyl group. This allows the guanine amino protons to participate in hydrogen bonds with separate carbonyls, forming one strong bond within the G-TA triple and a weak bond to an adjacent T.AT triple. Dramatic variations in helical twist around the guanine residue lead to a novel stacking interaction. At the global level, the Y.RY DNA triplex shares several structural features with the recently solved solution structure of the R.RY DNA triplex. The formation of a G.TA triple within an otherwise pyrimidine.purine.pyrimidine DNA triplex causes conformational realignments in and around the G.TA triple. These highlight new aspects of molecular recognition that could be useful in triplex-based approaches to inhibition of gene expression and site-specific cleavage of genomic DNA.

RNA priming coupled with DNA synthesis on natural template by calf thymus DNA polymerase alpha-primase.

A bovine genomic DNA library was surveyed with respect to the template activity for RNA-primed DNA synthesis by calf thymus DNA polymerase alpha-primase complex. About 7% of the single-stranded DNA clones contained distinct initiation sites consisting of pyrimidine clusters of pyrimidine-rich sequences. The initiation sites were located at or near the 3'-end of the pyrimidine clusters. One of these sequences, containing a 10-mer pyrimidine cluster with major initiation sites, was analyzed in detail. By the successive substitutions of pyrimidines in the cluster with oligodeoxydenylate [(dA)n] in the 5' to 3' direction, the minimum length of the initiation sequence was estimated to be as long as the 7-mer. In contrast, when one or three pyrimidines at the 3'-end of the cluster were replaced with (dA)n, the priming activity was largely lost, indicating that these pyrimidine residues were indispensable for priming. Furthermore, base substitutions of upstream or downstream sequences outside the pyrimidine cluster also decreased the total priming frequencies. Interestingly, the base substitutions inside or outside of the pyrimidine cluster sometimes caused a shift in the major priming sites. These results indicate that the minimum priming unit of the CTPPS1 template for RNA-primed DNA synthesis consists of a pyrimidine cluster (6-mer) with one purine at its 3'-border and that both the 3'-downstream 6-bases and the 5'-upstream 17-bases modulate the priming by enhancing the priming frequency and/or slightly shifting the sites of initiation of primer synthesis. It was also revealed that the lengths of the product RNA primers became shorter as the length of pyrimidine cluster was shortened by substitution with (dA)n. The gel retardation assay further showed that the complex formation between DNA polymerase alpha-primase and the DNA templates was strongly in competition with poly(dC), poly(dG), and poly(dT) but not with poly(dA). Furthermore, template activities as well as the pyrimidine contents of a series of base-substituted DNA correlated well with their affinities to the enzyme, as measured by both gel retardation assay and their Km values for the priming reaction. Apparently, DNA polymerase alpha-primase primarily recognizes the minimum priming unit consisting of a pyrimidine cluster with a purine at the 3'-boundary of purine, but the initiation of primer RNA synthesis can be modified by pyrimidine residues outside of the minimum priming unit.

4-Thiouridine incorporation into the RNA of monkey kidney cells (CV-1) triggers near-UV light long-term inhibition of DNA, RNA and protein synthesis.

Monkey kidney cells (CV-1) grown for 4 h in the presence of 0.1 mM 4-thiouridine (s4Urd) incorporate this photoactivable uridine analog in their RNA. A minor, 5-8%, thiolated RNA fraction can be isolated from bulk RNA by affinity chromatography. This RNA fraction contains 1.5-2.5 s4Urd residues per 100 nucleotides and exhibits a broad chain length distribution ranging from 700 to 7000 nucleotides. It is essentially of nuclear origin and amounts to 30% of the RNA synthesized during exposure of cells to s4Urd. Under the same s4Urd labeling conditions, no thiolated pyrimidine residues have been detected in DNA. Irradiation with 365 nm light (45 kJ/m2) of the cells immediately after s4Urd exposure triggers long-term inhibition of DNA, RNA and protein synthesis accompanied by a linear decline (50% in 2 days) in the total cell mass of cultured cells. In contrast, exposure to s4Urd alone results in moderate but reversible inhibitory effects. The available data suggest that s4Urd-induced photolesions in newly synthesized RNA such as RNA-RNA cross-links as well as RNA-protein bridges are directly involved in impairment of essential cellular functions.

Nuclease properties of two putative zinc finger peptides

We studied the interaction of wheat germ 5S rRNA with synthetic polypeptides whose amino acid sequences were similar to that of the second zinc finger of Xenopus laevis transcriptional factor IIIA (TFIIIA). The results clearly show that in addition to weak 5S rRNA binding activity (data not shown), these two 30 amino acid long polypeptides hydrolyse some phosphodiester bonds of wheat germ 5S rRNA. The cleavage pattern of plant 5S rRNA is very specific and the cuts occur only after the pyrimidine residues. The same properties of these peptides were furthermore observed for E. coli tRNA Phe. We found that the digestion specificity of both the zinc finger peptides is very similar to that of a pancreatic ribonuclease (RNase A).

Purification and characterization of a high molecular weight ribonuclease from human milk.

We have purified a high molecular weight ribonuclease (hmRNase) from human milk by a two-step column chromatographic procedure and characterized the enzyme. The molecular mass of hmRNase is 80 kDa as determined from SDS-polyacrylamide gel electrophoresis. The pH optimum of the enzyme is in the range of 7.5-8.0, similar to other secretory RNases. hmRNase is pyrimidine-specific and cleaves the phosphodiester bond 3' to a pyrimidine residue. It selectively degrades the pyrimidine strand in poly(rA):poly(rU) and poly(dA):poly(rU) double stranded substrates. The extent of degradation for naturally occurring RNAs vary in the order tRNA < rRNA < mRNA at low enzyme concentrations. hmRNase shows allosteric behavior with positive cooperativity in its reaction on polynucleotide substrates. The activity of the enzyme is enhanced in the presence of monoribonucleotides. Antiserum obtained against purified hmRNase did not cross-react with low molecular weight RNase which is also present in milk. In addition, an immunologically cross-reacting species could not be detected in the serum, suggesting the origin of hmRNase in the mammary gland but not blood.

Effect of excess water on the desilylation of oligoribonucleotides using tetrabutylammonium fluoride.

The most commonly available 2' hydroxyl protecting group used in the synthesis of oligoribonucleotides is the tert-butyldimethylsilyl moiety. This protecting group is generally cleaved with 1 M tetrabutylammonium fluoride (TBAF) in tetrahydrofuran (THF). The efficiency of this reaction was tested on ribonucleotidyldeoxythymidine dinucleotides (AT, CT, GT, and UT). We have found that the efficiency of desilylation of uridine and cytidine is greatly dependent on the water content of the TBAF reagent. Conversely, the water content of the TBAF reagent [up to 17% (w/w)] had no detectable effect on the rate of desilylation of adenosine and guanosine. It was concluded that for effective desilylation of pyrimidine nucleosides the water content of the TBAF reagent must be 5% or less, which is readily achieved using molecular sieves. TBAF dried in such a manner was shown to be effective in deprotecting an oligoribonucleotide containing both purine and pyrimidine residues.

Disruption of the SCL gene by a t(1;3) translocation in a patient with T cell acute lymphoblastic leukemia.

SCL gene disruptions are the most common chromosomal abnormality associated with the development of T cell acute lymphoblastic leukemia (ALL). Such disruptions can be the result of t(1;14) and t(1;7) translocations, as well as a cytogenetically undetectable interstitial deletion of chromosome 1. We present here a case of T cell ALL with a t(1;3)(p34;p21) translocation that also disrupts the SCL locus and leads to dysregulated SCL gene expression. This translocation, similar to previously reported SCL gene disruptions, appears to have been mediated, at least in part, by the V(D)J recombinase complex, since cryptic heptamer recognition sequences, as well as nontemplated N region nucleotide addition, are present at the breakpoints. The t(1;3) also disrupts a region on chromosome 3 characterized by alternating purine and pyrimidine residues, which can form a Z-DNA structure, reported to be prone to recombination events. A previously undescribed, evolutionarily conserved transcript unit is detected within 8 kb of the breakpoint on chromosome 3. This report extends the spectrum of recognized SCL translocations associated with T cell ALL, and underscores the contention that dysregulated SCL expression may be a causal event in T cell ALL.

Conformational rigidity of specific pyrimidine residues in tRNA arises from posttranscriptional modifications that enhance steric interaction between the base and the 2'-hydroxyl group.

In order to elucidate roles of the 2'-O-methylation of pyrimidine nucleotide residues of tRNAs, conformations of 2'-O-methyluridylyl(3'----5')uridine (UmpU), 2'-O-methyluridine 3'-monophosphate (Ump), and 2'-O-methyluridine (Um) in 2H2O solution were analyzed by one- and two-dimensional proton NMR spectroscopy and compared with those of related nucleotides and nucleoside. As for UpU and UmpU, the 2'-O-methylation was found to stabilize the C3'-endo form of the 3'-nucleotidyl unit (Up-/Ump-moiety). This stabilization of the C3'-endo form is primarily due to an intraresidue effect, since the conformation of the 5'-nucleotidyl unit (-pU moiety) was only slightly affected by the 2'-O-methylation of the 3'-nucleotide unit. In fact even for Up and Ump, the 2'-O-methylation significantly stabilizes the C3'-endo form by 0.8 kcal/.mol-1. By contrast, for nucleosides (U and Um), the C3'-endo form is slightly stabilized by 0.1 kcal/.mol-1. Accordingly, the stabilization of the C3'-endo form by the 2'-O-methylation is primarily due to the steric repulsion among the 2-carbonyl group, the 2'-O-methyl group and the 3'-phosphate group in the C2'-endo form. For some tRNA species, 2-thiolation of pyrimidine residues is found in positions where the 2'-O-methylation is found for other tRNA species.(ABSTRACT TRUNCATED AT 250 WORDS)

A pyrimidine-guanine sequence-specific ribonuclease from Rana catesbeiana (bullfrog) oocytes.

A pyrimidine-guanine sequence-specific ribonuclease (RC-RNase) was purified from Rana catesbeiana (bullfrog) oocytes by sequential phosphocellulose, Sephadex G75, heparin Sepharose CL 6B and CM-Sepharose CL 6B column chromatography. The purified enzyme with molecular weight of 13,000 daltons gave a single band on SDS-polyacrylamide gel. One CNBr-cleaved fragment has a sequence of NVLSTTRFQLNT/TRTSITPR, which is identical to residues 59-79 of a sialic acid binding lectin from R. catesbeiana eggs, and is 71% homologous to residues 60-80 of an RNase from R. catesbeaina liver. The RC-RNase preferentially cleaved RNA at pyrimidine residues with a 3' flanking guanine under various conditions. The sequence specificity of RC-RNase was further confirmed with dinucleotide as substrates, which were analyzed by thin layer chromatography after enzyme digestion. The values of kcat/km for pCpG, pUpG and pUpU were 2.66 x 10(7) M-1s-1, 2.50 x 10(7) M-1s-1 and 2.44 x 10(6) M-1s-1 respectively, however, those for other phosphorylated dinucleotides were less than 2% of pCpG and pUpG. As compared to single strand RNA, double strand RNA was relatively resistant to RC-RNase. Besides poly (A) and poly (G), most of synthetic homo- and heteropolynucleotides were also susceptible to RC-RNase. The RC-RNase was stable in the acidic (pH 2) and alkaline (pH 12) condition, but could be inactivated by heating to 80 degrees C for 15 min. No divalent cation was required for its activity. Furthermore, the enzyme activity could be enhanced by 2 M urea, and inhibited to 50% by 0.12 M NaCl or 0.02% SDS.

The orotidine-5'-monophosphate decarboxylase gene of Myxococcus xanthus. Comparison to the OMP decarboxylase gene family.

The nucleotide sequence of the Myxococcus xanthus orotidine-5'-monophosphate decarboxylase (OMP DCase) gene was determined. The derived protein sequence is not closely related to other prokaryotic OMP DCase sequences; nor is it closely related to any eukaryotic OMP DCase sequences. Progressive multiple alignment of the M. xanthus OMP DCase protein sequence with 19 other OMP DCase sequences revealed four conserved regions present in all 20 sequences. Ten entirely conserved residues were found in these four regions and one region contains a tight cluster of 5 conserved residues, certain of which may be catalytically active residues. A second open reading frame was found upstream of uraA and oriented in the same direction as uraA. A stretch of 21 consecutive pyrimidine (C or T) residues were found in the intercistronic region between the potential ribosome-binding site of uraA and the UGA stop codon of the upstream open reading frame. RNA directly upstream of the pyrimidine run, including the UGA stop codon of the upstream open reading frame, could be folded into a stable hairpin structure resembling Rho-independent terminators of Escherichia coli. Expression of the uraA gene may be regulated by an intercistronic transcription termination mechanism.

The de novo and salvage pathways for the synthesis of pyrimidine residues of RNA predominate in different locations within the mouse duodenal epithelium.

RNA synthesis was examined by radioautography in mouse duodenal epithelium using 3H-uridine as a tracer of the salvage pathway and 3H-orotic acid as a tracer of the de novo pathway. The incorporation of the two precursors was estimated by counting silver grains in light-microscopic and electron-microscopic radioautographs at successive levels of crypt and villus. With both precursors, silver grains were found over all epithelial nuclei, but in numbers varying by location. Thus, after 3H-uridine injection, the number of grains was high over nucleolus and nucleoplasm in the base of the crypt, declined gradually in the middle and top of the crypt, and was low along the villus. After 3H-orotic acid, the number of grains was fairly low throughout, but peaked over the nucleoplasm in lower villus cells. The 3H-uridine reaction over nucleolus and nucleoplasm in crypt cells was interpreted as synthesis by the salvage pathway of ribosomal RNA and heterogeneous RNA, respectively, whereas the 3H-orotic acid reaction over the nucleoplasm of some villus cells indicated that these cells synthesized heterogeneous RNA by the de novo pathway.

Purification and characterization of two ribonucleases from developing tomato fruit

Two neutral ribonucleases have been purified from developing tomato fruit. Their activity is maximal 5 days after anthesis, declines during maturation, and then increases slightly in the mature green through breaker stages. The ribonucleases Tf1 and Tf2 have molecular weights of 59 and 29 K, respectively, based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and are glycoproteins. The reduced and denatured Tf1 is composed of two subunits, 30 and 29 K, of which only the 30-K subunit displays ribonuclease activity after renaturation. Reduced and denatured Tf2 is a single 29-K polypeptide that is renaturable to an active ribonuclease. Only the 30-K, active subunit of Tf1 is immunologically cross-reactive with Tf2. Both ribonucleases are cyclyzing endoribonucleases with a strong preference for cleavage at pyrimidine residues, thus generating oligonucleotide products ending with pyrimidine 2′,3′-cyclic phosphate. These tomato fruit ribonucleases share a number of properties in common with the S-glycoprotein ribonucleases that are involved in self-incompatibility reactions in some solanaceous plants.

Different intrastrand and interstrand contributions to stacking account for roll variations at the alternating purine-pyrimidine sequences in A-DNA and A-RNA

An explanation is suggested for the roll alternation between low and high values in A-type nucleic acid duplexes containing alternating sequences of purine and pyrimidine residues. The explanation combines two points. (1) Roll inevitably occurs in A-type duplexes due to geometrical reasons. (2) Intrastrand base stacking is much more impared by roll than interstrand base stacking in A-type duplexes. Therefore purine-pyrimidine steps, whose bases mainly exhibit an intrastrand stacking, resist roll and decrease it. By contrast, bases at pyrimidine-purine steps exhibit a significant interstrand stacking that is tolerant to roll in A-type nucleic acid duplexes. In consequence, it is favourable if the purine-pyrimidine and pyrimidine-purine steps adopt low and high rolls, respectively in A-conformations of DNA and RNA molecules containing alternating purine-pyrimidine sequences. This is actually observed in the relevant molecular crystal structures.

The solution conformations of a mutant trp operator determined by n.m.r. spectroscopy

The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.