Purple Discoloration Research Articles

Development of Fournier's gangrene after chemotherapy for the recurrence of testicular cancer despite the absence of anorectal lesions: A case report.

Fournier's gangrene usually occurs when a specific bacterium intrudes into soft tissue, causing a wound or tumor. We encountered a patient with Fournier's gangrene due to severe myelosuppression after chemotherapy, despite the absence of an initial lesion on the anus and rectum. A 54-year-old man with a left testicular cancer recurrence had undergone chemotherapy. He had asymptomatic hepatitis and high hepatitis B virus DNA levels, which were normalized by administering tenofovir alafenamide fumarate. Twelve days after the start of chemotherapy, he complained of severe pain around the anus. The following day, he went into septic shock. Visual inspection showed dark purple skin discoloration on the left side of the anus. Laboratory data revealed severe neutropenia. Computed tomography showed a high density of soft tissue on the left side of the anus and gas bubbles in the left femoral ring. We diagnosed the patient with Fournier's gangrene due to a severe immunosuppressive state resulting from chemotherapy. We emergently removed necrotic tissue to the fullest extent possible. However, because the patient was in severe sepsis status, careful management in the intensive care unit was required for 32 days. After the first emergency operation, we performed several additional excisions. Finally, 391 days after the initial surgery, the patient was discharged from our hospital. The tumor has not recurred, and he is under outpatient observation in the urology department. Fournier's gangrene should be considered in patients who are in a severe myelosuppressive state due to chemotherapy, have normal hepatitis B virus DNA levels but high hepatitis B surface antigen after tenofovir administration, complain of severe pain in the perianal area, and have a dark purple skin discoloration around the anus, despite having no initial anorectal lesions.

Purple Urine Bag Syndrome: Unveiling the Puzzling Discoloration

Abstract Purple urine bag syndrome (PUBS) is a rare entity first described by Barlow and Dickinson in 1978 characterized by purple discoloration of urine in long-term debilitated patients with chronic indwelling urinary catheters. This syndrome is a result of a breakdown of indole into indoxyl sulfate and further metabolic degradation into indigo by the bacteria in the urinary tract resulting in the characteristic purple hue of the urine. We describe the case of a 60-year-old male, bedridden due to traumatic paraplegia, presenting to us with lower abdominal pain and purple discoloration of urine due to Proteus mirabilis.

Nicolau Syndrome with Severe Facial Ischemic Necrosis after Endodontic Treatment: A Case Report

Nicolau syndrome (NS) is a rare complication resulting from intramuscular injections. It is characterized by severe pain at the injection site and the development of purplish discoloration. Only a limited number of case reports have been published documenting the adverse effects associated with the injection of calcium hydroxide (CH) beyond the apex during endodontic treatment. Here, we present the case of a 16-year-old female with NS after the injection of CH during the root canal treatment. The radiography examination revealed distal occlusion of the right maxillary and facial arteries. This caused a substantial area of skin necrosis to develop on the patient's face, resulting in permanent scarring. NS is associated with the displacement of CH beyond the apex. To minimize the risk of NS, dentists should exercise caution by avoiding forced injection of CH during treatment, particularly when the root canal is actively bleeding.

Septicemic salmonellosis in suckling piglets resulting from improper intramuscular administration of an oral vaccine.

We describe an unusual outbreak of mortality in suckling piglets following the misadministration of an oral vaccine against Salmonella Typhimurium and Salmonella Choleraesuis. Within 3-48 h of vaccination of a batch of ~700 piglets, ~300 developed marked swelling in the dorsal neck region, respiratory distress, fever, recumbency, and apathy. In total, ~100 died, and 4 were submitted for autopsy. Gross and microscopic lesions consisted of focally extensive areas of purple discoloration in the skin of the cervical region, associated with edema and hemorrhage in the subcutis and muscles. Additionally, there was interstitial pneumonia with marked interlobular edema and mild fibrinous pleuritis. Aerobic bacterial culture identified Salmonella Typhimurium (3 cases) and Salmonella Choleraesuis (1 case) in samples of skeletal muscle and lung and from pleural swab samples. Marked immunostaining against Salmonella spp. was observed in the skeletal muscle of the cervical region, as well as in blood vessels and macrophages from the lung, liver, spleen, and kidney. We concluded that inappropriate intramuscular administration of an oral vaccine against Salmonella resulted in septicemia and death in a batch of piglets.

A Peculiar Manifestation of Urinary Tract Infection in a 76-year-old Female

Purple Urine Bag Syndrome (PUBS) is a rare and benign clinical phenomenon associated with urinary tract infections, characterized by the distinctive purple discoloration of a urinary catheter bag. The underlying cause of PUBS is related to bacterial activity involved in the breakdown of tryptophan, mainly in individuals with predisposing factors such as long-term catheterization, constipation, alkaline urine, and being female. We present the case of a 76-year-old female patient with a history of tuberculous spondylitis who developed PUBS during her hospital stay. The patient had been bedridden for three years and had been given a urinary catheter, which was routinely replaced by a non-medical family member and without a proper antiseptic procedure. A urine culture revealed the presence of Proteus mirabilis, and the patient was treated with intravenous antibiotics while also replacing the urinary catheter and bag. After five days of treatment, the urine bag and catheter remained clear, and the patient was discharged. PUBS is a significant indicator of urinary tract infection, necessitating prompt medical intervention to prevent complications. Healthcare professionals should be aware of this syndrome to enable early detection and appropriate management.

Diagnostic criteria for Buerger's disease: International Consensus of VAS - European Independent Foundation in Angiology/Vascular Medicine.

Buerger's disease (BD) remains a debilitating condition and early diagnosis is paramount for its effective management. Despite many published diagnostic criteria for BD, selective criteria have been utilized in different vascular centers to manage patients with BD worldwide. A recent international Delphi Consensus Study on the diagnostic criteria of BD showed that none of these published diagnostic criteria have been universally accepted as a gold standard. Apart from the presence of smoking, these published diagnostic criteria have distinct differences between them, rendering the direct comparison of patient outcomes difficult. Hence, the expert committees from the Working Group of the VAS-European Independent Foundation in Angiology/Vascular Medicine critically reviewed the findings from the Delphi study and provided practical recommendations on the diagnostic criteria for BD, facilitating its universal use. We recommend that the 'definitive' diagnosis of BD must require the presence of three features (history of smoking, typical angiographic features and typical histopathological features) and the use of a combination of major and minor criteria for the 'suspected' diagnosis of BD. The major criterion is the history of active tobacco smoking. The five minor criteria are disease onset at age less than 45 years, ischemic involvement of the lower limbs, ischemic involvement of one or both of the upper limbs, thrombophlebitis migrans and red-blue shade of purple discoloration on edematous toes or fingers. We recommend that a 'suspected' diagnosis of BD is confirmed in the presence of a major criterion plus four or more minor criteria. In the absence of the major criterion or in cases of fewer than four minor criteria, imaging and laboratory data could facilitate the diagnosis. Validation studies on the use of these major and minor criteria are underway.

FRI364 A Case Of Carcinoid Syndrome Symptoms Masked By Niacin Use

Abstract Disclosure: S. Yang: None. R. Sharag Eldin: None. D. Teves Qualler: None. Case Presentation: A 72 male presented with worsening of facial flushing and diarrhea for 10 years. The patient described episodic feeling of hotness in the face associated with red- purplish discoloration of his facial skin lasting for 2 to 3 minutes. He has had 5 to 6 episodes per day. The patient reported the use of Niacin in the past and it was believed that it was the cause of his flushing episodes despite its persistence for years after stopping it. The patient also suffered from long standing diarrhea which started around the same time of the flushing. Diarrhea has been watery or loose and he has 5 to 6 bowel movements a day. His symptoms were concerning for Carcinoid syndrome and a 24-hour urine collection for HIAA showed elevated HIAA to 108.7 mg/24 hour (<6 mg/24 hour). A CT scan of the abdomen revealed a 1.8 cm wall thickness in the cecum and a 3.6 cm spiculated mesenteric mass with central calcification with multiple hypervascular masses in the liver concerning for a metastatic neuroendocrine tumor. Core biopsy of one of the liver masses showed a well differentiated neuroendocrine tumor. He was also found to have tricuspid valve regurgitation as well as a Glycohemoglobin of 9%. The patient was treated medically with octreotide rather than surgery due to the significant disease burden. Interestingly, he was initially started on Lanreotide but developed foreign body granulomas at the injection sites. Discussion: Carcinoid-syndrome is a category of well-differentiated neuroendocrine neoplasms. The overproduction of serotonin is most used to assess the presence of carcinoid syndrome via its breakdown product 5- HIAA in the urine. Symptoms from niacin supplementation are variable and may include flushing and constipation. Patient’s flushing presented for years after discontinuing niacin supplementation. However, clinicians continued to attribute it to its use despite typical resolution of symptoms within 3 hours of discontinuing use. Niacin exposure may have been a mimicker of his underlying neuro endocrine neoplasia (NEN) as diarrhea is also an overlapping feature as seen in our patient’s presentation. DM as seen in our patient is not well documented in relation to carcinoid syndrome. One study (n=10) of the patients with functionally active NENs, 70% had borderline to diabetic-level blood glucose. Of the patients with carcinoid syndrome, there was no significant difference in fasting plasma glucose concentration or fasting plasma insulin concentration when compared to age-matched normal volunteers. Conclusion: Clinicians should have low level of suspicion in diagnosing carcinoid syndrome in the presence of typical symptoms of flushing and diarrhea. Due to the past use of niacin, our patient’s diagnosis was delayed despite the persistence of flushing years after stopping it. Presentation: Friday, June 16, 2023

Clinical significance of abdominal computed tomography and colonoscopy in the evaluation of phlebosclerotic colitis.

Clinical manifestations of phlebosclerotic colitis (PC) exhibit significant variability, necessitating diverse treatment strategies depending on disease severity. However, there is limited research exploring the relationship between imaging findings and disease severity. Hence, this retrospective study aimed to analyze the correlation between computed tomography (CT) findings, colonoscopic features, and disease severity. This study compared the abdominal CT characteristics, colonoscopy findings, and treatment modalities of 45 PC patients. CT images were assessed for the severity of mesenteric venous calcification, maximum colonic wall thickness, number of involved colonic segments, and presence of pericolic inflammation. Colonoscopic images were assessed for dark purple discoloration mucosa, erosive and ulcerative lesions, mucosal edema, luminal narrowing, and the number of involved colonic segments. In addition, patients were categorized into three groups: the observation (n = 15), medical treatment (n = 19), and operation (n = 11) groups. In CT images, a significant difference in pericolic inflammation (p = 0.039) was observed among groups. Further, significant differences in dark purple discoloration mucosa (p = 0.033), erosive or ulcerative lesions (p < 0.001), mucosal edema (p < 0.001), luminal narrowing (p = 0.012), and the number of involved colonic segments (p = 0.001) were observed in colonoscopy. Moreover, we found positive correlations between CT and colonoscopy features. In conclusion, CT manifestations and colonoscopy findings exhibited correlation with disease severity in PC. When limited to one diagnostic tool, observations from that tool can infer potential manifestations of the alternative tool.

Purple urine bag syndrome: An unusual presentation of urinary tract infection

Introduction: Purple urine bag syndrome is a rare clinical entity characterized by purple discoloration of the urinary catheter and urinary drainage bag in chronically catheterized patients. Though it can be alarming to patients and clinicians, it is considered benign but can indicate an underlying urinary tract infection. Case Series: The first case was a 68-year-old woman with multiple comorbidities who was admitted to the orthopedic ward with a close fracture of the neck of the right femur. She was bedridden and had an indwelling urethral catheter. Her urine bag was noticed to stain purplish 22 days after bladder catheterization. Urine culture showed a heavy mixed growth. A change of urinary catheter and drainage bag led to a resolution of the condition. The second case was a 58-year-old male who was admitted on account of decompensated liver cirrhosis from chronic hepatitis C virus infection. He also had quadriparesis due to a traumatic cervical spine injury, urine retention, and constipation. On day 24 of his admission, his urine bag was stained with a purplish hue. A urine culture grew Klebsiella oxytoca. The urine bag remained clear and contained amber-colored urine after catheter changes and antibiotic treatment for cystitis. Conclusion: Purple urine bag syndrome can be alarming to the patient and caregiver who need to be reassured of its benign nature. Urine culture would identify any associated infection. Good catheter care, control of risk factors including constipation and antibiotic treatment for symptomatic urinary tract infection leads to the resolution of the discoloration.

Genotypic effects on the response of soybean (Glycine max (L.) Merrill) to sulfonylurea herbicides

AbstractSulfonylurea (SU) herbicides registered for use in other crops in Australia may leave residues in the soil interrupting rotations involving soybean. However, two unlinked genes (ALS1 and ALS2) confer SU tolerance in soybean. Here, we report experiments that explored the effectiveness of these ALS genes in Australian soybean germplasm. The first two experiments assessed the tolerance to halosulfuron‐methyl or metsulfuron‐methyl of lines with either zero ALS gene (ALS1) or both ALS1 and ALS2 in five different Australian genetic backgrounds. The presence of both ALS1 and ALS2 conferred strong SU tolerance at herbicide application rates as high as four times (4×) the recommended field rate, with evidence of interaction with the genetic background; lines carrying only ALS1 also performed well but demonstrated less tolerance. For the third experiment, the five lines homozygous for both ALS genes were intercrossed in a half‐diallel mating design. The resulting F2 population were screened for tolerance to metsulfuron‐methyl herbicide. In all instances, the presence of the two ALS genes provided absolute protection for the growth tip. Analyses of seedling dry weight and purple leaf discoloration demonstrated significant differences among the crosses. For dry weight, high and significant heritability estimates indicated significant additional genetic variation for SU tolerance in five of the 10 F2 crosses (p ≤ 0.05). The results of these three studies confirm that two ALS genes confer tolerance to SU herbicides when crossed into Australian soybean germplasm, but suggest possible epistatic effects within different backgrounds, and the possibility of other (minor) genes conferring additional SU tolerance.

ACUTE DIGITAL GANGRENE TRIGGERED BY COVID-19 COAGULOPATHY

ACUTE DIGITAL GANGRENE TRIGGERED BY COVID-19 COAGULOPATHY

The Evolution of Blue Toe Syndrome in a Diabetic Patient

A 62-year-old man was admitted to our hospital because of severe pain and purple discoloration in the first toe of left foot for 2 weeks. He was diagnosed with type 2 diabetes 10 years ago, but his blood glucose was poorly controlled with metformin. He had no history of hypertension or smoking. Physical examination showed that his left great toe was painful and purple with low skin temperature. The dorsalis pedis artery pulse was impalpable.

Purple urine bag syndrome: An unusual manifestation of urinary tract infection, our experience at a tertiary care center.

Purple urine bag syndrome (PUBS) is an unusual condition in which a purple discoloration of urine and bag occurs in people with urinary catheters. People with purple urine usually do not complain of any symptoms. The purple discoloration of the urine bag is often the only finding, frequently noted by caregivers. This prospective observational study was conducted at our tertiary care institute from June 2018 to May 2020. A total of 46 patients with PUBS were included in this study. The objective of our study was to record the prevalence of each predisposing factor and to correlate the pathological mechanism through which the PUBS is manifested. The mean age of PUBS patients was 67.4years and 67.4% were males. Most patients of PUBS (60.9%) had a urethral catheter, while there was percutaneous nephrostomy in 26.1% patients and 13% patients had a percutaneous suprapubic cystostomy catheter. Among the patients, 69.65% were bedridden or in an institutionalized situation, 73.9% were suffering from chronic constipation, 21.7% were associated with dementia, and 47.8% were cerebrovascular accidents with hemiparesis patients. In addition, 93.5% of patients presented with alkaline urine and 3 patients with acidic urine. The most common bacteria isolated in urine culture were E coli and Pseudomonas. Urinary catheter associated urinary tract infection and PUBS is most commonly documented in females, but our study showed that it is more common in males. The appearance of a purple bag does not depend on the material and type of the catheter or the catheterization method. In addition, no correlation was found between the microorganisms isolated from the environment and patients' urine.

Purple Urine Bag Syndrome: A Rare Clinical Entity in a Female Patient with a Long-term Indwelling Urethral Catheter

Background: Discoloration of urine is commonly encountered in clinical practice and this at times may indicate significant pathology. Nevertheless, the majority of instances are benign. Blue and purple dye discoloration of the urinary catheter drainage system israre and can be alarming to both patients and health care workers who are not aware of the condition which is called Purple-Urine-Bag-Syndrome (PUBS). PUBS, is associated with urinary tract infections occurring in catheterised patients, generally elderly females with significant co-morbidities and constipation. The urine is usually alkaline. Gram-negative bacteria that produce sulfatase and phosphatase are involved in the formation of pigment, indigo which gives a blue coloration and indirubin which gives a purple coloration. Tryptophan metabolism is involved in the pathogenesis. Case Report: A 60-year-old lady who had a long-term urethral catheter for four years went to see her General Practitioner on few occasions with a report that her urine has been draining blue dye into her urine bag which was followed by drainage of purple dye into the catheter bag. The General practitioner did not know the cause of the problem but gave the patient antibiotic on each occasion and the blue/purple dye urine discoloration cleared each time she was given empirical antibiotic treatment. Her urine culture grew E coli at the time of the discoloration.Conclusion: PUBS occurs in long-term catheterised patients; is associated with UTI; presents with symptom-less blue/purple discoloration of urine; resolves with appropriate antibiotic treatment.

Lateralized Purplish Skin Discoloration Due to Aortic Dissection.

Lateralized Purplish Skin Discoloration Due to Aortic Dissection.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milošević et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

0800 Dozing off is a problem, as is a toe falling off - Methylphenidate induced Raynaud’s phenomenon

Abstract Introduction Narcolepsy is a clinical syndrome characterized by a constellation of symptoms including excessive daytime sleepiness, cataplexy, sleep paralysis and sleep hallucinations. Stimulants are commonly used to treat hypersomolence associated with narcolepsy. Common adverse reactions reviewed with patients prior to initiation of amphetamines include decreased appetite, nausea, xerostomia, headache, insomnia, tachycardia and hypertension. A relatively rare concern with stimulants is development of peripheral vasculopathy including Raynaud’s phenomenon. Report of Cases: A 25-year-old female with past medical history of anxiety, depression and obstructive sleep apnea in childhood was treated with tonsillectomy and adenoidectomy. Over the years, she continued to have persistent hypersomnolence, auditory hypnogogic hallucinations with no symptoms of sleep paralysis or cataplexy. She had a polysomnography (PSG) along with multiple sleep latency test (MSLT). PSG did not show evidence of sleep apnea with an AHI of 0.96 per hour. MSLT confirmed the diagnosis of Narcolepsy, Type 2, with a mean sleep onset latency of 3.6 minutes and five sleep-onset REM periods (SOREMPs). She was started on 400mg daily of Modafinil and 20mg daily of Methylphenidate. After a month of using methylphenidate, she noticed purplish discoloration of her digits, sometimes with exposure to cold, other times with no obvious triggers, consistent with development of Raynaud’s phenomenon. The proposed mechanism is that use of methylphenidate causes excessive release of catecholamines due to inhibition of the reuptake of dopamine and norepinephrine, leading to peripheral vasoconstriction. As the patient’s hypersomnolence persisted, she was started on sodium oxybate and the dosage of methylphenidate was decreased to 10mg daily and eventually discontinued. With reduction in the dosage and discontinuation of methylphenidate, symptoms of Raynaud’s phenomenon improved. Conclusion Dose-related peripheral vasculopathy including Raynaud’s phenomenon has been reported in several case reports with the use of methylphenidate. Awareness of this relatively rare adverse effect is imperative among sleep physicians as it could cause significant delay in the diagnosis, management of Raynaud’s phenomenon and its complications including critical digital ischemia and gangrene. Dose adjustments and discontinuation of methylphenidate should be considered in the treatment course of the patients with such concern. Support (If Any)

Use of Raman Spectroscopy, Scanning Electron Microscopy and Energy Dispersive X-ray Spectroscopy in a Multi-Technique Approach for Physical Characterization of Purple Urine Bag Syndrome

Purple urine bag syndrome (PUBS) is a rare condition characterized by purple discoloration of urine and urine bags. Although it is benign, it represents an alarming symptom to the patients and their relatives because of purple discoloration. We have physically characterized urine and urine bags belonging to a patient suffering from PUBS using an approach that combines Raman spectroscopy (RS) and scanning electron microscopy (SEM) coupled with energy dispersive X-ray (EDX). Five “blue” discolored bags and one sterile urine bag, representing the control, were cut into 1 cm2 square samples and analyzed by using RS and SEM + EDX technique. RS enabled us to identify the presence of indigo, a metabolite of tryptophan, while SEM analysis showed the biofilm deposit, probably due to the presence of microorganisms, and the EDX measurements exhibited the elemental composition of the bags. In particular, urine bags before and after the presence of PUBS urine showed an increase of ~32% of Cl, ~33% of O, ~667% of Ca, ~65% of Al and Mg, while C decreased by about 41%. Our results, to be taken as a proof-of-principle study, are promising for the aim to characterizing the urine bags in a flexible, inexpensive, and comprehensive manner.

Necrosis secondary to cold agglutinin disease.

An 80-year-old man presented to our clinic with a 7-month history of purple discoloration, numbness and pain of the left third and fourth digits ([Figure 1A][1]). His other hand and his feet were unaffected. The discoloration was exacerbated by cold exposure but did not return to normal colour or

Purple Urine Bag Syndrome as the Primary Presenting Feature of a Urinary Tract Infection

Purple urine bag syndrome (PUBS) is a curious condition that manifests with purple discoloration of a urinary catheter bag as a result of a urinary tract infection (UTI). This syndrome is produced through a reaction between urinary by-products and the components of a plastic urinary catheter bag. Predisposing factors include old age, long-term catheterization, chronic constipation, and limited mobility. We describe a case of a UTI in a 90-year-old woman in which the initial presentation was PUBS. Here, late recognition of PUBS led to delayed treatment of the associated UTI. Despite being a simple spot diagnosis, knowledge about this uncommon syndrome is lacking amongst clinicians and this may have implications on patient outcomes.