Nrf2 Promoter Region Research Articles

The triterpenoid corosolic acid blocks transformation and epigenetically reactivates Nrf2 in TRAMP-C1 prostate cells.

Corosolic acid (CRA) is found in various plants and has been used as a health food supplement worldwide. Although it has been reported that CRA exhibits significant anticancer activity, the effect of this compound on prostate cancer remains unknown. In this study, we investigated the effect of CRA on cellular transformation and the reactivation of nuclear factor erythroid 2-related factor 2 (Nrf2) through epigenetic regulation in TRAMP-C1 prostate cells. Specifically, we found that CRA inhibited anchorage-independent growth of prostate cancer TRAMP-C1 cells but not Nrf2 knockout prostate cancer TRAMP-C1 cells. Moreover, CRA induced mRNA and protein expression of Nrf2, heme oxygenase-1 (HO-1) and NAD(P)H Quinone Oxidoreductase 1 (NQO1). Bisulfite genomic sequencing and methylated DNA immunoprecipitation results revealed that CRA treatment decreased the level of methylation of the first five CpG sites of the Nrf2 promoter. Histone modification was analyzed using a chromatin immunoprecipitation (ChIP) assay, which revealed that CRA treatment increased the acetylation of histone H3 lysine 27 (H3K27ac) while decreasing the trimethylation of histone H3 lysine 27 (H3K27me3) in the promoter region of Nrf2. Furthermore, CRA treatment attenuated the protein expression of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). These findings indicate that CRA has a significant anticancer effect in TRAMP-C1 cells, which could be partly attributed to epigenetics including its ability to epigenetically restore the expression of Nrf2.

Curcumin Derivative Epigenetically Reactivates Nrf2 Antioxidative Stress Signaling in Mouse Prostate Cancer TRAMP C1 Cells.

The carcinogenesis of prostate cancer (PCa) in TRAMP model is highly correlated with hypermethylation in the promoter region of Nrf2 and the accompanying reduced transcription of Nrf2 and its regulated detoxifying genes. We aimed to investigate the effects of (3E,5E)-3,5-bis-(3,4,5-trimethoxybenzylidene)-tetrahydro-thiopyran-4-one (F10) and (3E,5E)-3,5-bis-(3,4,5-trimethoxy-benzylidene)-tetrahydropyran-4-one (E10), two synthetic curcumin derivatives, on restoring Nrf2 activity in TRAMP C1 cells. HepG2-C8 cells transfected with an antioxidant-response element (ARE)-luciferase vector were treated with F10, E10, curcumin, and sulforaphane (SFN) to compare their effects on Nrf2-ARE pathways. We performed real-time quantitative PCR and Western blotting to investigate the effects of F10 and E10 on Nrf2, correlated phase II detoxification genes. We also measured expression and activity of DNMTand HDAC enzymes. Enrichment of H3K27me3 on the promoter region of Nrf2 was explored with a chromatin immunoprecipitation (ChIP) assay. Methylation of the CpG region in Nrf2 promoter was doubly examined by bisulfite genomic sequencing (BGS) and methylation DNA immunoprecipitation (MeDIP). Compared with curcumin and SFN, F10 is more potent in activating Nrf2-ARE pathways. Both F10 and E10 enhanced level of Nrf2 and the correlated phase II detoxifying genes. BGS and MeDIP assays indicated that F10 but not E10 hypomethylated the Nrf2 promoter. F10 also downregulated the protein level of DNMT1, DNMT3a, DNMT3b, HDAC1, HDAC4, and HDAC7 and the activity of DNMTs and HDACs. F10 but not E10 effectively reduced the accumulation of H3k27me3 on the promoter of Nrf2. F10 and E10 can activate the Nrf2-ARE pathway and increase the level of Nrf2 and correlated phase II detoxification genes. The reactivation effect on Nrf2 by F10 in TRAMP C1 may come from demethylation, decrease of HDACs, and inhibition of H3k27me3 accumulation.

MRTF-A can activate Nrf2 to increase the resistance to doxorubicin.

Chemotherapeutic drugs resistance was considered to be the major obstacle for cancer therapy. MRTF-A, co-activators of serum response factor (SRF), promoted tumor cell invasion and metastasis in cancer. So far there has been no relevant reports about MRTF-A’ role in tumor chemotherapy. Here, we reported that MRTF-A overexpression conferred resistance to doxorubicin mediated apoptosis by significantly increasing the expression of Nrf2 which was an important molecule associated with the resistance of anticancer drugs. If MRTF-A was knocked down, could the corresponding results be obtained? Moreover, we showed that overexpression MRTF-A had no remarkable effect to doxorubicin mediated apoptosis in cancer cells when knocking down Nrf2. Further studies showed that MRTF-A regulated the transcriptional activity of Nrf2 by forming a complex with SRF binding to the CarG box which existed on Nrf2 promoter region. On the whole, our study revealed a novel possible resistant pathway to doxorubicin.

Epigenetic CpG Methylation of the Promoter and Reactivation of the Expression of GSTP1 by Astaxanthin in Human Prostate LNCaP Cells.

Astaxanthin (AST), a red dietary carotenoid, has synergistic antioxidant effects with polyunsaturated fatty acids at low concentrations via Nuclear factor (erythroid-derived 2)-like 2 (NFE2L2 or Nrf2)/antioxidant response element (ARE) signaling. In addition, chromatin remodeling and DNA methylation-based gene silencing represent a common mechanism in prostate carcinogenesis and tumor progression from normal cells to pre-initiated cells and ultimately to invasive carcinoma. Therefore, the control of epigenetic modification and the transcriptional/translational control of the activation of Nrf2 and Nrf2-target genes, including glutathione S-transferases (GSTs), appear to be an important mechanism that protects cells against injuries from oxidative stress and cancer development. In this study, we aim to investigate the role of AST in reactivating the expression of Nrf2 and GSTP1 through epigenetic modification in human prostate LNCaP cells. Treatment with AST in human LNCaP cells reduced the methylation of 21 CpG sites of the GSTP1 CpG island but did not affect the three CpG sites of the Nrf2 promoter region. AST induced the mRNA expression and protein expression of both Nrf2 and GSTP1. It also increased the mRNA expression of NQO1 in sh-mock LNCaP cells but not in sh-SETD7 LNCaP cells. Furthermore, AST reduced the protein expression of DNMT3b and significantly inhibited DNMT and HDAC activities in vitro. Taken together, these results suggest that AST decreased the methylation status of the GSTP1, and these epigenetic modifying effects may originate from the decreasing activities of epigenetic modification enzymes, contributing to the overall beneficial health effects of AST.

Interaction of DNA demethylase and histone methyltransferase upregulates Nrf2 in 5-fluorouracil-resistant colon cancer cells.

We recently reported that DNA demethylase ten-eleven translocation 1 (TET1) upregulates nuclear factor erythroid 2-related factor 2 (Nrf2) in 5-fluorouracil-resistant colon cancer cells (SNUC5/5-FUR). In the present study, we examined the effect of histone modifications on Nrf2 transcriptional activation. Histone deacetylase (HDAC) and histone acetyltransferase (HAT) were respectively decreased and increased in SNUC5/5-FUR cells as compared to non-resistant parent cells. Mixed-lineage leukemia (MLL), a histone methyltransferase, was upregulated, leading to increased trimethylation of histone H3 lysine 4, while G9a was downregulated, leading to decreased dimethylation of histone H3 lysine 9. siRNA-mediated MLL knockdown decreased levels of Nrf2 and HO-1 to a greater extent than did silencing HAT1. Host cell factor 1 (HCF1) was upregulated in SNUC5/5-FUR cells, and we observed interaction between HCF1 and MLL. Upregulation of O-GlcNAc transferase (OGT), an activator of HCF1, was also associated with HCF1-MLL interaction. In SNUC5/5-FUR cells, a larger fraction of OGT was bound to TET1, which recruits OGT to the Nrf2 promoter region, than in SNUC5 cells. These findings indicate that SNUC5/5-FUR cells are under oxidative stress, which induces expression of histone methylation-related proteins as well as DNA demethylase, leading to upregulation of Nrf2 and 5-FU resistance.

Genetic polymorphism of the Nrf2 promoter region is associated with vitiligo risk in Han Chinese populations.

The nuclear factor erythroid‐derived two‐like 2‐antioxidant response element (Nrf2‐ARE) pathway and its downstream antioxidant enzyme heme oxygenase‐1 (HMOX1 or HO‐1) play essential roles in H2O2‐induced oxidative damage in human melanocytes. However, the link between Nrf2 promoter polymorphisms and susceptibility to oxidative stress‐related diseases such as vitiligo is unknown. This study evaluated the association of the Nrf2 and HO‐1 genes polymorphisms with vitiligo susceptibility. In this case–control study of 1136 Han Chinese vitiligo patients and 1200 controls, Nrf2 (rs35652124 and rs6721961) and HO‐1 (rs2071746) genes were genotyped by PCR‐restriction fragment length polymorphism analysis. Overall, a significantly decreased risk of vitiligo was found to be associated with Nrf2 rs35652124 CC and combined (CT+CC) genotypes [odds ratio (OR) 0.64, 95% confidence interval (CI) 0.50–0.83 and OR, 0.84, 95% CI 0.71–0.99, respectively], as well as among subgroups: female, onset age ≤20 and never smoker. We subsequently found that Nrf2 rs35652124 C allele had higher transcriptional activity in the luciferase reporter assay compared with Nrf2 rs35652124 T allele. Furthermore, we investigated serum HO‐1 activity was associated with the rs35652124 CT+CC genotype and lower in patients than in controls (P = 0.024). Logistic regression analysis showed a dose–response relationship between lower vitiligo risk and increased HO‐1 activity in rs35652124 CT+CC genotype carriers (P trend < 0.05). These findings indicate that the C allele of rs35652124 located in the promoter region of Nrf2 gene is associated with protective effect on vitiligo in a Han Chinese population.

Epigenetic modifications of triterpenoid ursolic acid in activating Nrf2 and blocking cellular transformation of mouse epidermal cells

Ursolic acid (UA), a well-known natural triterpenoid found in abundance in blueberries, cranberries and apple peels, has been reported to possess many beneficial health effects. These effects include anticancer activity in various cancers, such as skin cancer. Skin cancer is the most common cancer in the world. Nuclear factor E2-related factor 2 (Nrf2) is a master regulator of antioxidative stress response with anticarcinogenic activity against UV- and chemical-induced tumor formation in the skin. Recent studies show that epigenetic modifications of Nrf2 play an important role in cancer prevention. However, the epigenetic impact of UA on Nrf2 signaling remains poorly understood in skin cancer. In this study, we investigated the epigenetic effects of UA on mouse epidermal JB6 P+ cells. UA inhibited cellular transformation by 12-O-tetradecanoylphorbol-13-acetate at a concentration at which the cytotoxicity was no more than 25%. Under this condition, UA induced the expression of the Nrf2-mediated detoxifying/antioxidant enzymes heme oxygenase-1, NAD(P)H:quinone oxidoreductase 1 and UDP-glucuronosyltransferase 1A1. DNA methylation analysis revealed that UA demethylated the first 15 CpG sites of the Nrf2 promoter region, which correlated with the reexpression of Nrf2. Furthermore, UA reduced the expression of epigenetic modifying enzymes, including the DNA methyltransferases DNMT1 and DNMT3a and the histone deacetylases (HDACs) HDAC1, HDAC2, HDAC3 and HDAC8 (Class I) and HDAC6 and HDAC7 (Class II), and HDAC activity. Taken together, these results suggest that the epigenetic effects of the triterpenoid UA could potentially contribute to its beneficial effects, including the prevention of skin cancer.

The trancriptional factor, Nrf2 is critical for the protection against pneumococcal pneumonia. (INM3P.400)

Abstract Pneumonia is one of the major clinical complications of pneumococcal disease. Innate immunity provides an immediate response to S. pneumoniae that can be protective, but if not controlled, can also lead to deleterious inflammation, extensive tissue damage and mortality. A complete understanding of the regulation of innate immunity and attendant inflammatory responses are critical for clinical control of respiratory bacterial infections. To better comprehend this dynamic process during pneumococcal infection, we specifically focused on the transcriptional factor, Nrf2, which can be both induced by inflammation and critically regulates inflammatory responses. Of interest, acute lung injury (ALI) in humans is correlated with functional polymorphisms in the Nrf2 promoter region. Our studies showed that mice deficient in Nrf2 were highly susceptible to in vivo pneumococcal pneumonia. Nrf2 deficiency was associated with enhanced production of pro-inflammatory cytokines and infiltration of neutrophils into the lungs following infection. However, immunization with the polysaccharide conjugate vaccine completely protected both Nrf2-/- and Nrf2+/- mice against pneumococcal challenge. This study provides evidence that Nrf2 is critical for protection against pneumococcal pneumonia by suppressing deleterious inflammation. In addition, the results suggest that pneumococcal vaccination should be performed to protect humans who have an Nrf2-associated genetic predisposition to develop ALI &amp;lt;!--EndFragment--&amp;gt;

Abstract 17436: STAT3 Inhibition Protects Against Cardiomyocyte Hypertrophy Through a Novel NF-kB p65/Nrf2/HO-1 Pathway

Introduction: Left ventricular hypertrophy is the end-result of diverse cardiovascular pathologies. STAT3 signaling has been implicated in cardiomyocyte hypertrophy, although the precise mechanism remains incompletely understood. Hypothesis: We hypothesized that STAT3 induces myocyte hypertrophy via NF-kB/Nrf2 pathway. Methods and Results: Treatment of H9c2 cells with 1 μM Angiotensin II for 48 h induced a 2.4-fold increase in cell size compared with controls. This cellular hypertrophy was significantly inhibited in the presence of STAT3 inhibitor WP1066 (Figure). The levels of heme oxygenase-1 (HO-1), a key molecule in cardioprotective signaling, were increased by WP1066 treatment and decreased by STAT3 overexpression. Further investigation of the underlying mechanism revealed that WP1066 blocks the inhibitory effect of NF-kB p65 on Nrf2, leading to an upregulation of HO-1 (Figure). By using chromosome-IP and bioinformatics analysis, we identified that p65 suppresses Nrf2 expression by directly binding to the promoter region of Nrf2. The p65/Nrf2/HO-1 signaling pathway was further confirmed by using both p65 transient overexpression and NF-kB inhibitor pyrrolidine dithiocarbamate (PDTC). Conclusions: We conclude that angiotensin II-induced cardiomyocyte hypertrophy involves STAT3 signaling and downstream components include p65, Nrf2, and HO-1. These novel molecular insights may lead to development of new therapy to prevent and treat cardiac hypertrophy.

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K+ ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Nuclear factor erythroid 2-related factor gene variants and susceptibility of arsenic-related skin lesions

Inorganic arsenic (iAs) is an important pollutant associated with various chronic-degenerative diseases. The cytoprotective protein nuclear factor erythroid 2-related factor (NRF2) has been proposed as an important responsive mechanism against iAs exposure. The aim of this study was to determine whether the risk of skin lesions in people exposed to iAs-contaminated water could be modified by the presence of single nucleotide polymorphisms in the NRF2 coding gene. We studied 117 individuals with long-term iAs exposure and 120 nonexposed individuals. Total As was determined in water, meanwhile iAs and its metabolites were measured in urine. The iAs-induced skin lesion status was evaluated by expert dermatologists. We sequenced the promoter region of NRF2 in a sample of 120 healthy donors. We found four polymorphisms previously reported and one novel polymorphism in the 5' regulatory region of the NRF2. In this study, we did not find allelic and genotype association of NRF2 polymorphisms with iAs-related skin lesion. However, the analysis of haplotypes composed by -653GA, and -617CA NRF2 single nucleotide polymorphisms showed a significant association with protection against skin lesions in the low-As exposure group. This is the first report studying the association between NRF2 polymorphisms and susceptibility of As-related skin lesions. Increasing the sample size will allow us to confirm this data.

Epigenetic Modifications of Nrf2 by 3,3′-diindolylmethane In Vitro in TRAMP C1 Cell Line and In Vivo TRAMP Prostate Tumors

3,3'-diindolylmethane (DIM) is currently being investigated in many clinical trials including prostate, breast, and cervical cancers and has been shown to possess anticancer effects in several in vivo and in vitro models. Previously, DIM has been reported to possess cancer chemopreventive effects in prostate carcinogenesis in TRAMP mice; however, the in vivo mechanism is unclear. The present study aims to investigate the in vitro and in vivo epigenetics modulation of DIM in TRAMP-C1 cells and in TRAMP mouse model. In vitro study utilizing TRAMP-C1 cells showed that DIM suppressed DNMT expression and reversed CpG methylation status of Nrf2 resulting in enhanced expression of Nrf2 and Nrf2-target gene NQO1. In vivo study, TRAMP mice fed with DIM-supplemented diet showed much lower incidence of tumorigenesis and metastasis than the untreated control group similar to what was reported previously. DIM increased apoptosis, decreased cell proliferation and enhanced Nrf2 and Nrf2-target gene NQO1 expression in prostate tissues. Importantly, immunohistochemical analysis showed that DIM reduced the global CpG 5-methylcytosine methylation. Focusing on one of the early cancer chemopreventive target gene Nrf2, bisulfite genomic sequencing showed that DIM decreased the methylation status of the first five CpGs of the Nrf2 promoter region, corroborating with the results of in vitro TRAMP-C1 cells. In summary, our current study shows that DIM is a potent cancer chemopreventive agent for prostate cancer and epigenetic modifications of the CpG including Nrf2 could be a potential mechanism by which DIM exerts its chemopreventive effects.

An interaction between Nrf2 polymorphisms and smoking status affects annual decline in FEV1: a longitudinal retrospective cohort study

BackgroundAn Nrf2-dependent response is a central protective mechanism against oxidative stress. We propose that particular genetic variants of the Nrf2 gene may be associated with a rapid forced expiratory volume in one second (FEV1) decline induced by cigarette smoking.MethodsWe conducted a retrospective cohort study of 915 Japanese from a general population. Values of annual decline in FEV1 were computed for each individual using a linear mixed-effect model. Multiple clinical characteristics were assessed to identify associations with annual FEV1 decline. Tag single-nucleotide polymorphisms (SNPs) in the Nrf2 gene (rs2001350, rs6726395, rs1962142, rs2364722) and one functional SNP (rs6721961) in the Nrf2 promoter region were genotyped to assess interactions between the Nrf2 polymorphisms and smoking status on annual FEV1 decline.ResultsAnnual FEV1 decline was associated with smoking behavior and inversely correlated with FEV1/FVC and FEV1 % predicted. The mean annual FEV1 declines in individuals with rs6726395 G/G, G/A, or A/A were 26.2, 22.3, and 20.8 mL/year, respectively, and differences in these means were statistically significant (pcorr = 0.016). We also found a significant interaction between rs6726395 genotype and smoking status on the FEV1 decline (p for interaction = 0.011). The haplotype rs2001350T/rs6726395A/rs1962142A/rs2364722A/rs6721961T was associated with lower annual decline in FEV1 (p = 0.004).ConclusionsThis study indicated that an Nrf2-dependent response to exogenous stimuli may affect annual FEV1 decline in the general population. It appears that the genetic influence of Nrf2 is modified by smoking status, suggesting the presence of a gene-environment interaction in accelerated decline in FEV1.

Functional haplotypes in the promoter region of transcription factor Nrf2 in chronic obstructive pulmonary disease.

Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) protects against oxidative stress which is important in the pathogenesis of chronic obstructive pulmonary disease (COPD). Three single nucleotide polymorphisms and 1 triplet repeat polymorphism are found in the promoter region of the Nrf2 gene. Molecular haplotyping of the Nrf2 promoter region was performed using DNA obtained from the peripheral blood of 69 COPD patients. The luciferase activities of Nrf2 promoter constructs containing all possible combinations of the 4 polymorphisms were determined and found to differ among the 16 haplotypes.The haplotypes isolated from the subjects were divided into 3 groups (L: low; M: medium; H: high) on the basis of luciferase activities. The proportions of subjects belonging to global initiative for chronic obstructive lung disease stage 3 or 4 decreased from the group with the LL haplotype to that with the HH haplotype. Presence of the LH or MM haplotype (hazard ratio, 3.36; 95% confidence interval, 1.16–9.69), gender (0.13; 0.02–0.67), and post-bronchodilator FEV1 value of predicted (0.95; 0.91–0.99) are significant predictors of respiratory failure development.The haplotype of the Nrf2 gene promoter affects its activity, and is associated with the severity and the development of respiratory failure in COPD.

Association of single nucleotide polymorphisms of Nrf2 promoter region with susceptibility to vitiligo

To investigate the association of the single nucleotide polymorphisms (SNPs) in Nrf2 promoter region with the susceptibility to risk of vitiligo. Samples of peripheral blood were collected from 300 vitiligo patients and 300 healthy persons. The genotypes of -686A/G, -684G/A, and -650C/A were detected by direct-sequencing. Genotyping of variable number of tandem repeat (VNTR) was performed by gene scan analysis with an ABI 310 Sequencer. Genetic and allelic frequencies were analyzed by Chi-square test and the risk was evaluated by calculating OR and 95% CI. There was statistical significant difference in genotypic and allelic frequencies of -650C/A between the vitiligo group and healthy control group (P < 0.05), and A -650 allele was associated with risk for vitiligo statistically significantly (OR = 1.724, 95% CI: 1.345-2.211, chi2 = 18.096, P < 0.01). Homozygote of A allele increased the risk for vitiligo obviously (OR = 2.902, 95% CI: 1.624-5.188, P < 0.01). No significant difference was found in other three polymorphisms between the two groups. polymorphism of Nrf2 promoter region -650C/A was associated with the development of vitiligo and A -650 allele may be one of risk factors for vitiligo.