Progranulin Mutations Research Articles

Progranulin gene mutation of frontotemporal dementia in China: A case report and literature review

AbstractBackgroundProgranulin (GRN) mutations of Frontotemporal dementia (FTD) were rarely reported in China. This study was to report one novel GRN mutation and summarize the genetic and clinical features of patients with GRN mutations in China.MethodComprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58‐year‐old patient who was diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and the clinical and genetic features of patients with Progranulin mutations in China were summarized.ResultMarked lateral atrophy and hypometabolism on the left‐side frontal, temporal and parietal lobes of the patient were found on neuroimages, and amyloid and tau positron emission tomography ruled out pathological protein deposition. A novel heterozygous 45‐bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was identified through Whole Exon Sequencing of the patient’s genomic deoxyribonucleic acid. Nonsense‐mediated messenger ribonucleic acid decay was implicated in the degradation of the mutated messenger ribonucleic acid, and it was defined as pathogenic by American College of Medical Genetics and Genomics guidelines. In the literature review, we found Chinese reports of 13 patients with Progranulin mutations. A 1.2%–2.6% prevalence, an early disease onset and a female predominance were reported in Chinese patients with GRN mutations.ConclusionOur findings expand the mutational profile of Progranulin mutations in China and provide a basis for potential treatments for Progranulin.

Regulation of extracellular progranulin in the medial prefrontal cortex

AbstractBackgroundLoss‐of‐function mutations in progranulin (GRN) are a major genetic cause of frontotemporal dementia (FTD). Progranulin is a secreted protein that is trafficked to lysosomes, where it promotes lysosomal function. Progranulin also exerts neurotrophic and anti‐inflammatory effects, some of which may be mediated by extracellular signaling. Neurons and microglia express progranulin and loss of progranulin from either cell type induces FTD‐like deficits in mice. Both cell types secrete progranulin in culture, but their contribution to extracellular progranulin in the brain is unclear, as are the mechanisms regulating progranulin secretion from each cell type. In this study, we used microdialysis to gain insight into the contribution of neurons and microglia to extracellular progranulin in the medial prefrontal cortex (mPFC), a region that degenerates in FTD and develops impaired dendritic arborization in progranulin‐insufficient mice.MethodPolyethylene probes (2 mm, 1000 kDa cut‐off) were implanted in mouse mPFC and perfused with artificial cerebrospinal fluid containing 4% BSA using a push‐pull pump system (Atmos LM, Amuza). Progranulin levels in interstitial fluid (ISF) were measured by ELISA (Adipogen).ResultGrn+/– mice exhibited a roughly 50% decrease in ISF progranulin versus wild‐type, which was similar to the reduction of progranulin in mPFC tissue. In wild‐type mice, inducing cellular depolarization with KCl (100 mM) increased ISF progranulin, but stimulating synaptic activity with picrotoxin (100 μM) or NMDA (50 μM) did not. Inducing systemic inflammation with LPS (10 mg/kg i.p.) increased ISF progranulin to around 200% of baseline at eight hours after injection. Analysis of ISF progranulin from microglial progranulin knockout mice (Cx3Cr1‐Cre‐ER:Grnfl/fl) revealed a nearly 50% reduction in ISF progranulin compared to Cre– littermates, which was a larger reduction than observed in mPFC tissue. Ongoing studies are analyzing ISF progranulin in neuronal progranulin knockout mice (CamKII‐Cre:Grnfl/fl).ConclusionOur findings indicate that inflammation increases ISF progranulin in the mPFC and that nearly half of the extracellular progranulin in the mPFC may originate from microglia. In contrast, synaptic activity does not significantly increase ISF progranulin in the mPFC. Ongoing studies will investigate the contribution of neurons to extracellular progranulin in the mPFC.

Antisense oligonucleotides targeting the miR-29b binding site in the GRN mRNA increase progranulin translation

Heterozygous GRN (progranulin) mutations cause frontotemporal dementia (FTD) due to haploinsufficiency, and increasing progranulin levels is a major therapeutic goal. Several microRNAs, including miR-29b, negatively regulate progranulin protein levels. Antisense oligonucleotides (ASOs) are emerging as a promising therapeutic modality for neurological diseases, but strategies for increasing target protein levels are limited. Here, we tested the efficacy of ASOs as enhancers of progranulin expression by sterically blocking the miR-29b binding site in the 3' UTR of the human GRN mRNA. We found 16 ASOs that increase progranulin protein in a dose-dependent manner in neuroglioma cells. A subset of these ASOs also increased progranulin protein in iPSC-derived neurons and in a humanized GRN mouse model. In FRET-based assays, the ASOs effectively competed for miR-29b from binding to the GRN 3' UTR RNA. The ASOs increased levels of newly synthesized progranulin protein by increasing its translation, as revealed by polysome profiling. Together, our results demonstrate that ASOs can be used to effectively increase target protein levels by partially blocking miR binding sites. This ASO strategy may be therapeutically feasible for progranulin-deficient FTD as well as other conditions of haploinsufficiency.

Regulation of extracellular progranulin in medial prefrontal cortex

Progranulin is a secreted pro-protein that has anti-inflammatory and neurotrophic effects and is necessary for maintaining lysosomal function. Mutations in progranulin (GRN) are a major cause of frontotemporal dementia. Most pathogenic GRN mutations cause progranulin haploinsufficiency, so boosting progranulin levels is a promising therapeutic strategy. Progranulin is constitutively secreted, then taken up and trafficked to lysosomes. Before being taken up from the extracellular space, progranulin interacts with receptors that may mediate anti-inflammatory and growth factor-like effects. Modifying progranulin trafficking is a viable approach to boosting progranulin, but progranulin secretion and uptake by cells in the brain is poorly understood and may involve distinct mechanisms from other parts of the body. Understanding the cell types and processes that regulate extracellular progranulin in the brain could provide insight into progranulin's mechanism of action and inform design of progranulin-boosting therapies. To address this question we used microdialysis to measure progranulin in interstitial fluid (ISF) of mouse medial prefrontal cortex (mPFC). Grn+/− mice had approximately 50% lower ISF progranulin than wild-type mice, matching the reduction of progranulin in cortical tissue. Fluorescent in situ hybridization and immunofluorescence confirmed that microglia and neurons are the major progranulin-expressing cell types in the mPFC. Studies of conditional microglial (Mg-KO) and neuronal (N-KO) Grn knockout mice revealed that loss of progranulin from either cell type results in approximately 50% reduction in ISF progranulin. LPS injection (i.p.) produced an acute increase in ISF progranulin in mPFC. Depolarizing cells with KCl increased ISF progranulin, but this response was not altered in N-KO mice, indicating progranulin secretion by non-neuronal cells. Increasing neuronal activity with picrotoxin did not increase ISF progranulin. These data indicate that microglia and neurons are the source of most ISF progranulin in mPFC, with microglia likely secreting more progranulin per cell than neurons. The acute increase in ISF progranulin after LPS treatment is consistent with a role for extracellular progranulin in regulating inflammation, and may have been driven by microglia or peripheral immune cells. Finally, these data indicate that mPFC neurons engage in constitutive progranulin secretion that is not acutely changed by neuronal activity.

Progression of white matter signal abnormalities in predementia frontotemporal dementia mutation carriers

AbstractBackgroundWhite matter signal abnormalities (WMSA) are frequently observed on magnetic resonance imaging (MRI) scans of people with frontotemporal dementia (FTD). We hypothesized that carriers of mutations in progranulin (GRN+), chromosome 9 open reading frame 72 (C9orf72+) and microtubule associated protein tau (MAPT+) have increased rates of progression of WMSA compared to non‐carrier individuals prior to onset of dementia, and that different mutations may have different rates of WMSA accumulation.MethodParticipants were recruited through the ARTFL‐LEFFTDS Longitudinal Frontotemporal Lobar Degeneration (ALLFTD) Study. We selected participants with Clinical Dementia Rating scale (CDR) scores of 0 and 0.5. If a participant developed FTD during the follow‐up, we only analyzed observations collected before the conversion. WMSA were defined as hyperintensities on FLAIR MRI. Total WMSA volumes were normalized to the respective intracranial volumes. We used a linear mixed effects model, with random intercepts and slopes, to compare the baseline burden and the longitudinal progression of total WMSA volumes between mutation carriers and controls. The model was adjusted for baseline age, sex, education, baseline Montreal Cognitive Assessment (MoCA) scores, and MRI acquisition sites.ResultWe analyzed MRI data from 199 participants who had at least two MRI visits (46 C9orf72+, 17 GRN+, 35 MAPT+, 101 non‐carrier controls; up to five years of follow‐up). We did not find significant group differences in baseline demographic features, except that MAPT+ was younger than non‐carrier controls (average age: C9orf72+ = 47, GRN+ = 56, MAPT+ = 40, controls = 47). Baseline WMSA volumes were not significantly different between mutation carriers and controls. Longitudinally, the rates of WMSA volume increase in C9orf72+ and MAPT+ were comparable to controls; whereas, GRN+ had higher rates of WMSA volume increases compared to controls (p = 0.01).ConclusionWMSA may accumulate at higher rates in GRN+ prior to the onset of FTD, which is consistent with the frequent presence of white matter diseases observed in symptomatic FTD patients with GRN mutations. Future work is warranted to investigate the association between white matter structural changes and cognitive/psychiatric changes in FTD mutation carriers.

Neuropsychiatric symptom progression in predementia frontotemporal dementia mutation carriers

AbstractBackgroundNeuropsychiatric symptoms (NPS) often occur during the prodromal stage of frontotemporal dementia (FTD), as evidenced by the presence of early psychiatric diagnosis in approximately 50% of bvFTD patients prior to their dementia diagnosis. We hypothesized that carriers of mutations in progranulin (GRN+), chromosome 9 open reading frame 72 (C9orf72+) and microtubule associated protein tau (MAPT+) have increased baseline burden and rates of progression of NPS compared to non‐carrier individuals prior to onset of dementia symptoms based on the Clinical Dementia Rating (CDR) scale.MethodParticipants were recruited through the ARTFL‐LEFFTDS Longitudinal Frontotemporal Lobar Degeneration (ALLFTD) Study. NPS were assessed with Neuropsychiatric Inventory‐Questionnaire (NPI‐Q), Geriatric Depression Scale (GDS), Interpersonal Reactivity Index (IRI), Social Behaviour Checklist (SBOCL), and Behavioral Inhibition Scale (BIS) annually for up to five years. We selected participants with CDR scores of 0 and 0.5. If a participant’s CDR changed to above 0.5 during the follow‐up, we only analyzed observations collected before the conversion. We used mixed effects models to compare the baseline burden and the longitudinal progression of NPS measures between carriers and controls, adjusted for baseline age, sex, education, and baseline Montreal Cognitive Assessment (MoCA) scores.ResultWe analyzed data from 607 participants (111 C9orf72+, 47 GRN+, 67 MAPT+ and 382 non‐carrier controls). There were no significant group differences in baseline demographic features, except that MAPT+ was significantly younger than other groups (average age: C9orf72+ = 45, GRN+ = 53, MAPT+ = 41, controls = 54). Baseline NPS scores were not significantly different between carriers and controls, except that C9orf72+ had significantly lower GDS compared to controls (p = 0.002). Longitudinally, GRN+ (p = 0.02) and MAPT+ (p = 0.009) had significantly higher rates of NPI‐Q increases compared to controls, while the progression of NPI‐Q in C9orf72+ was comparable to controls. The rates of GDS, IRI, SBOCL and BIS progression were not significantly different between carriers and controls.ConclusionPrior to the onset of dementia, GRN+ and MAPT+ have a faster progression of NPS, as measured by NPI‐Q, compared to controls. Future work will investigate whether different mutation carriers are affected by specific type/cluster of symptoms.

Retinal TDP43 pathology in Alzheimer’s disease, Parkinson’s disease and frontotemporal dementia

AbstractBackgroundAs an extension of the brain, the retina displays similarities with the brain in terms of anatomy and functionality. The accessibility of the retina provides a ‘window’ to the brain and a great potential for noninvasive imaging of neurodegenerative changes in patients. TAR DNA binding protein 43 (TDP‐43) is one of the main pathological hallmarks found in frontotemporal lobar degeneration (FTLD). Previously, we identified phosphorylated TDP‐43 (pTDP‐43) aggregation in the retina of FTLD cases with underlying TDP43 (FTLD‐TDP) pathology, including donors with C9orf72 and progranulin (GRN) mutations. The aim of this study is to assess the presence of pTDP‐43 in the retina across various neurodegenerative diseases and controls. This will provide insight in whether the presence of TDP43 pathology in the retina is exclusive for cases with FTLD‐TDP and potentially serve as an in‐vivo biomarker.MethodPost‐mortem eyes were collected by the Netherlands Brain Bank from donors with Alzheimer’s disease (AD), Parkinson’s disease (PD), frontotemporal dementia (FTD) and controls (N = 80). Nasal superior‐temporal quadrants were cut in sections of 10 µm. Immunohistochemical stainings were performed for phosphorylated TDP‐43 (pTDP‐43).ResultFTLD‐TDP cases showed pTDP‐43 immunopositive inclusions in the plexiform layers. Additionally, some AD cases showed sparse pTDP‐43 positive inclusions. Data of the other pathological groups will be available within a couple of months.ConclusionpTDP‐43 is abundantly present in the retina of FTLD‐TDP patients, while only sporadically seen in AD patients. With the advances in ocular imaging techniques, these findings provide a patient friendly retinal biomarker to diagnose FTLD‐TDP. This would be the first FTD specific biomarker, since no other pathology specific biomarkers for the various underlying pathological changes that are known to cause FTD (e.g. tau, FUS, etc), are currently available.

Patients with sporadic FTLD exhibit similar increases in lysosomal proteins and storage material as patients with FTD due to GRN mutations

Loss of function progranulin (GRN) mutations are a major autosomal dominant cause of frontotemporal dementia (FTD). Patients with FTD due to GRN mutations (FTD-GRN) develop frontotemporal lobar degeneration with TDP-43 pathology type A (FTLD-TDP type A) and exhibit elevated levels of lysosomal proteins and storage material in frontal cortex, perhaps indicating lysosomal dysfunction as a mechanism of disease. To investigate whether patients with sporadic FTLD exhibit similar signs of lysosomal dysfunction, we compared lysosomal protein levels, transcript levels, and storage material in patients with FTD-GRN or sporadic FTLD-TDP type A. We analyzed samples from frontal cortex, a degenerated brain region, and occipital cortex, a relatively spared brain region. In frontal cortex, patients with sporadic FTLD-TDP type A exhibited similar increases in lysosomal protein levels, transcript levels, and storage material as patients with FTD-GRN. In occipital cortex of both patient groups, most lysosomal measures did not differ from controls. Frontal cortex from a transgenic mouse model of TDP-opathy had similar increases in cathepsin D and lysosomal storage material, showing that TDP-opathy and neurodegeneration can drive these changes independently of progranulin. To investigate these changes in additional FTLD subtypes, we analyzed frontal cortical samples from patients with sporadic FTLD-TDP type C or Pick’s disease, an FTLD-tau subtype. All sporadic FTLD groups had similar increases in cathepsin D activity, lysosomal membrane proteins, and storage material as FTD-GRN patients. However, patients with FTLD-TDP type C or Pick’s disease did not have similar increases in lysosomal transcripts as patients with FTD-GRN or sporadic FTLD-TDP type A. Based on these data, accumulation of lysosomal proteins and storage material may be a common aspect of end-stage FTLD. However, the unique changes in gene expression in patients with FTD-GRN or sporadic FTLD-TDP type A may indicate distinct underlying lysosomal changes among FTLD subtypes.

C-terminal TMEM106B fragments in human brain correlate with disease-associated TMEM106B haplotypes.

Transmembrane protein 106B (TMEM106B) is a tightly regulated glycoprotein predominantly localized to endosomes and lysosomes. Genetic studies have implicated TMEM106B haplotypes in the development of multiple neurodegenerative diseases with the strongest effect in frontotemporal lobar degeneration with TDP-43 pathology (FTLD-TDP), especially in progranulin (GRN) mutation carriers. Recently, cryo-electron microscopy studies showed that a C-terminal fragment (CTF) of TMEM106B (amino acid residues 120-254) forms amyloid fibrils in the brain of patients with FTLD-TDP, but also in brains with other neurodegenerative conditions and normal ageing brain. The functional implication of these fibrils and their relationship to the disease-associated TMEM106B haplotype remain unknown. We performed immunoblotting using a newly developed antibody to detect TMEM106B CTFs in the sarkosyl-insoluble fraction of post-mortem human brain tissue from patients with different proteinopathies (n = 64) as well as neuropathologically normal individuals (n = 10) and correlated the results with age and TMEM106B haplotype. We further compared the immunoblot results with immunohistochemical analyses performed in the same study population. Immunoblot analysis showed the expected ∼30 kDa band in the sarkosyl-insoluble fraction of frontal cortex tissue in at least some individuals with each of the conditions evaluated. Most patients with GRN mutations showed an intense band representing TMEM106B CTF, whereas in most neurologically normal individuals it was absent or much weaker. In the overall cohort, the presence of TMEM106B CTFs correlated strongly with both age (rs = 0.539, P < 0.001) and the presence of the TMEM106B risk haplotype (rs = 0.469, P < 0.001). Although there was a strong overall correlation between the results of immunoblot and immunohistochemistry (rs = 0.662, P < 0.001), 27 cases (37%) were found to have higher amounts of TMEM106B CTFs detected by immunohistochemistry, including most of the older individuals who were neuropathologically normal and individuals who carried two protective TMEM106B haplotypes. Our findings suggest that the formation of sarkosyl-insoluble TMEM106B CTFs is an age-related feature which is modified by TMEM106B haplotype, potentially underlying its disease-modifying effect. The discrepancies between immunoblot and immunohistochemistry in detecting TMEM106B pathology suggests the existence of multiple species of TMEM106B CTFs with possible biological relevance and disease implications.

Astroglial toxicity promotes synaptic degeneration in the thalamocortical circuit in frontotemporal dementia with GRN mutations.

Mutations in the human progranulin (GRN) gene are a leading cause of frontotemporal lobar degeneration (FTLD). While previous studies implicate aberrant microglial activation as a disease-driving factor in neurodegeneration in the thalamocortical circuit in Grn-/- mice, the exact mechanism for neurodegeneration in FTLD-GRN remains unclear. By performing comparative single-cell transcriptomics in the thalamus and frontal cortex of Grn-/- mice and patients with FTLD-GRN, we have uncovered a highly conserved astroglial pathology characterized by upregulation of gap junction protein GJA1, water channel AQP4, and lipid-binding protein APOE, and downregulation of glutamate transporter SLC1A2 that promoted profound synaptic degeneration across the two species. This astroglial toxicity could be recapitulated in mouse astrocyte-neuron cocultures and by transplanting induced pluripotent stem cell-derived astrocytes to cortical organoids, where progranulin-deficient astrocytes promoted synaptic degeneration, neuronal stress, and TDP-43 proteinopathy. Together, these results reveal a previously unappreciated astroglial pathology as a potential key mechanism in neurodegeneration in FTLD-GRN.

Depletion and activation of microglia impact metabolic connectivity of the mouse brain

AimWe aimed to investigate the impact of microglial activity and microglial FDG uptake on metabolic connectivity, since microglial activation states determine FDG–PET alterations. Metabolic connectivity refers to a concept of interacting metabolic brain regions and receives growing interest in approaching complex cerebral metabolic networks in neurodegenerative diseases. However, underlying sources of metabolic connectivity remain to be elucidated.Materials and methodsWe analyzed metabolic networks measured by interregional correlation coefficients (ICCs) of FDG–PET scans in WT mice and in mice with mutations in progranulin (Grn) or triggering receptor expressed on myeloid cells 2 (Trem2) knockouts (−/−) as well as in double mutant Grn−/−/Trem2−/− mice. We selected those rodent models as they represent opposite microglial signatures with disease associated microglia in Grn−/− mice and microglia locked in a homeostatic state in Trem2−/− mice; however, both resulting in lower glucose uptake of the brain. The direct influence of microglia on metabolic networks was further determined by microglia depletion using a CSF1R inhibitor in WT mice at two different ages. Within maps of global mean scaled regional FDG uptake, 24 pre-established volumes of interest were applied and assigned to either cortical or subcortical networks. ICCs of all region pairs were calculated and z-transformed prior to group comparisons. FDG uptake of neurons, microglia, and astrocytes was determined in Grn−/− and WT mice via assessment of single cell tracer uptake (scRadiotracing).ResultsMicroglia depletion by CSF1R inhibition resulted in a strong decrease of metabolic connectivity defined by decrease of mean cortical ICCs in WT mice at both ages studied (6–7 m; p = 0.0148, 9–10 m; p = 0.0191), when compared to vehicle-treated age-matched WT mice. Grn−/−, Trem2−/− and Grn−/−/Trem2−/− mice all displayed reduced FDG–PET signals when compared to WT mice. However, when analyzing metabolic networks, a distinct increase of ICCs was observed in Grn−/− mice when compared to WT mice in cortical (p < 0.0001) and hippocampal (p < 0.0001) networks. In contrast, Trem2−/− mice did not show significant alterations in metabolic connectivity when compared to WT. Furthermore, the increased metabolic connectivity in Grn−/− mice was completely suppressed in Grn−/−/Trem2−/− mice. Grn−/− mice exhibited a severe loss of neuronal FDG uptake (− 61%, p < 0.0001) which shifted allocation of cellular brain FDG uptake to microglia (42% in Grn−/− vs. 22% in WT).ConclusionsPresence, absence, and activation of microglia have a strong impact on metabolic connectivity of the mouse brain. Enhanced metabolic connectivity is associated with increased microglial FDG allocation.

Lack of a protective effect of the Tmem106b “protective SNP” in the Grn knockout mouse model for frontotemporal lobar degeneration

Genetic variants in TMEM106B are a common risk factor for frontotemporal lobar degeneration and the most important modifier of disease risk in patients with progranulin (GRN) mutations (FTLD-GRN). TMEM106B is encoding a lysosomal transmembrane protein of unknown molecular function. How it mediates its disease-modifying function remains enigmatic. Several TMEM106B single nucleotide polymorphisms (SNPs) are significantly associated with disease risk in FTLD-GRN carriers, of which all except one are within intronic sequences of TMEM106B. Of note, the non-coding SNPs are in high linkage disequilibrium with the coding SNP rs3173615 located in exon six of TMEM106B, resulting in a threonine to serine change at amino acid 185 in the minor allele, which is protective in FTLD-GRN carriers. To investigate the functional consequences of this variant in vivo, we generated and characterized a knockin mouse model harboring the Tmem106bT186S variant. We analyzed the effect of this protective variant on FTLD pathology by crossing Tmem106bT186S mice with Grn−/− knockout mice, a model for GRN-mediated FTLD. We did not observe the amelioration of any of the investigated Grn−/− knockout phenotypes, including transcriptomic changes, lipid alterations, or microgliosis in Tmem106bT186S/T186S × Grn−/− mice, indicating that the Tmem106bT186S variant is not protective in the Grn−/− knockout mouse model. These data suggest that effects of the associated SNPs not directly linked to the amino acid exchange in TMEM106B are critical for the modifying effect.

Similar lysosomal abnormalities in cortex of patients with sporadic FTLD‐TDP type A and patients with FTD‐GRN

AbstractBackgroundLoss‐of‐function mutations in progranulin (GRN) are an autosomal dominant cause of frontotemporal dementia (FTD). Progranulin is critical for maintenance of lysosomal function. Patients with FTD due to GRN mutations (FTD‐GRN) exhibit signs of lysosomal dysfunction, which may contribute to FTD‐GRN pathogenesis. To assess the potential involvement of lysosomal dysfunction in FTD of sporadic origin, we investigated whether the lysosomal abnormalities of FTD‐GRN are also present in patients with sporadic frontotemporal lobar degeneration with TDP‐43 pathology (FTLD‐TDP) type A, the same FTLD subtype found in patients with FTD‐GRN.MethodWe used enzyme activity assays, western blot, immunostaining, and Nanostring analysis to assess changes in lysosomal protein and gene expression in orbital and occipital cortex of patients with FTD‐GRN, sporadic FTLD‐TDP type A, or controls. We measured lipofuscin using autofluorescence and staining with Sudan Black B. In follow‐up studies, we assessed these lysosomal markers in a transgenic mouse line expressing wild‐type human TDP‐43 under the Thy1 promoter.ResultWe found similar lysosomal abnormalities in orbital cortex of patients with FTD‐GRN or sporadic FTLD‐TDP type A. Both FTD patient groups exhibited elevated levels of lysosomal enzymes and membrane proteins, higher expression of many lysosomal genes, and greater lipofuscin accumulation than controls. These changes were largely absent in occipital cortex from both groups. Analysis of frontal cortex from a transgenic mouse model of TDP‐opathy also revealed elevated levels of some lysosomal proteins and elevated lipofuscin levels.ConclusionThese studies indicate that the lysosomal abnormalities of patients with FTD‐GRN may be more closely associated with TDP‐opathy or neurodegeneration than with progranulin insufficiency. Orbital cortex, an affected brain region in FTD‐GRN, exhibited elevated lysosomal protein levels and lipofuscin accumulation, which were also found in patients with sporadic FTLD‐TDP type A. In contrast, the occipital cortex, a relatively spared brain region in FTD‐GRN, exhibited much milder lysosomal abnormalities. Future studies will assess signs of lysosomal dysfunction in patients with other classes of FTLD pathology to determine whether these changes are limited to patients with FTLD‐TDP or may be found throughout the FTLD spectrum.

Progression of white matter signal abnormalities in predementia frontotemporal dementia mutation carriers

AbstractBackgroundWhite matter signal abnormalities (WMSA) are frequently observed on magnetic resonance imaging (MRI) scans of people with frontotemporal dementia (FTD). We hypothesized that carriers of mutations in progranulin (GRN+), chromosome 9 open reading frame 72 (C9orf72+) and microtubule associated protein tau (MAPT+) have increased rates of progression of WMSA compared to non‐carrier individuals prior to onset of dementia, and that different mutations may have different rates of WMSA accumulation.MethodParticipants were recruited through the ARTFL‐LEFFTDS Longitudinal Frontotemporal Lobar Degeneration (ALLFTD) Study. We selected participants with Clinical Dementia Rating scale (CDR) scores of 0 and 0.5. If a participant developed FTD during the follow‐up, we only analyzed observations collected before the conversion. WMSA were defined as hyperintensities on FLAIR MRI. Total WMSA volumes were normalized to the respective intracranial volumes. We used a linear mixed effects model, with random intercepts and slopes, to compare the baseline burden and the longitudinal progression of total WMSA volumes between mutation carriers and controls. The model was adjusted for baseline age, sex, education, baseline Montreal Cognitive Assessment (MoCA) scores, and MRI acquisition sites.ResultWe analyzed MRI data from 199 participants who had at least two MRI visits (46 C9orf72+, 17 GRN+, 35 MAPT+, 101 non‐carrier controls; up to five years of follow‐up). We did not find significant group differences in baseline demographic features, except that MAPT+ was younger than non‐carrier controls (average age: C9orf72+=47, GRN+=56, MAPT+=40, controls=47). Baseline WMSA volumes were not significantly different between mutation carriers and controls. Longitudinally, the rates of WMSA volume increase in C9orf72+ and MAPT+ were comparable to controls; whereas, GRN+ had higher rates of WMSA volume increases compared to controls (p=0.01).ConclusionWMSA may accumulate at higher rates in GRN+ prior to the onset of FTD, which is consistent with the frequent presence of white matter diseases observed in symptomatic FTD patients with GRN mutations. Future work is warranted to investigate the association between white matter structural changes and cognitive/psychiatric changes in FTD mutation carriers.

Progranulin upregulation by antisense oligonucleotides targeting regRNAs for treatment of FTD‐GRN

AbstractBackgroundHeterozygous mutations in progranulin (GRN) gene leading to progranulin protein (PGRN) haploinsufficieny are the major genetic cause of GRN‐related frontotemporal dementia (FTD‐GRN)1, 2 and 3. Decreased levels of PGRN disrupt lysosome homeostasis, cause aberrant microglia activation and neuronal cell death resulting in progressive behavioral changes, language deficits and memory impairment4. We hypothesize that upregulation of PGRN in both neuronal cells and microglia would be effective for treating FTD‐GRN patients.MethodRegulatory RNAs (regRNAs) are a class of noncoding RNAs that modulate gene transcription. We have developed an RNA Actuating Platform (RAPTM) that identified regRNAs and enables tunable upregulation of genes by specific targeting of regRNAs with antisense oligonucleotides (ASOs).ResultOur platform identified shared GRN regRNAs in human iPSC‐derived neuron and microglia like cells (iMGLs). ASOs targeting shared regRNAs were screened in a human neuroblastoma cell line to identify lead ASOs that upregulate GRN at least 2‐fold. We showed that the lead ASOs upregulate GRN in both human iPSC‐derived neurons and iMGL cells. Moreover, this level of GRN upregulation was sufficient to rescue staurosporine‐induced toxicity in FTD‐GRN patient iPSC‐derived neurons.Furthermore, we identified mouse Grn regRNA‐targeting ASOs that upregulate Grn transcription 2.5‐fold in mouse neuroblastoma cell lines and primary neurons. We tested these ASOs for efficacy in an FTD‐GRN mouse model (Grn+/tm1.1Far )5 by intracerebroventricular injection. Grn upregulation is observed across disease‐relevant brain regions, including cortex in the Grn haploinsufficient mice.ConclusionHere, we describe the development of oligonucleotide drug candidates that target regRNAs to upregulate GRN expression as a therapeutic approach for FTD‐GRN. We believe that our strategy will restore secreted and lysosomal PGRN levels in both microglia and neurons thereby decreasing neuroinflammation and neurotoxicity. We are developing these oligonucleotides as a disease modifying treatment for patients with FTD‐GRN.

Pathological 25 kDa C-Terminal Fragments of TDP-43 Are Present in Lymphoblastoid Cell Lines and Extracellular Vesicles from Patients Affected by Frontotemporal Lobar Degeneration and Neuronal Ceroidolipofuscinosis Carrying a GRN Mutation.

Frontotemporal lobar degeneration (FTLD) is a complex disease, characterized by progressive degeneration of frontal and temporal lobes. Mutations in progranulin (GRN) gene have been found in up to 50% of patients with familial FTLD. Abnormal deposits of post-translationally-modified TAR DNA-binding protein of 43 kDa (TDP-43) represent one of the main hallmarks of the brain pathology. To investigate in peripheral cells the presence of the different TDP-43 forms, especially the toxic 25 kDa fragments, we analyzed lymphoblastoid cell lines (LCLs) and the derived extracellular vesicles (EVs) from patients carrying a GRN mutation, together with wild-type (WT) healthy controls. After characterizing EV sizes and concentrations by nanoparticle tracking analysis, we investigated the levels of different forms of the TDP-43 protein in LCLs and respective EVs by Western blot. Our results showed a trend of concentration decreasing in EVs derived from GRN-mutated LCLs, although not reaching statistical significance. A general increase in p-TDP-43 levels in GRN-mutated LCLs and EVs was observed. In particular, the toxic 25 kDa fragments of p-TDP-43 were only present in GRN-mutated LCLs and were absent in the WT controls. Furthermore, these fragments appeared to be more concentrated in EVs than in LCLs, suggesting a relevant role of EVs in spreading pathological molecules between cells.

Changing perspectives on frontotemporal dementia: A review.

This article examines the evolution in understanding of frontotemporal dementia (FTD) during the last four decades. A central theme is the recognition of heterogeneity. Originally construed as a disorder of behaviour and executive impairment, FTD is now known also to be associated with alterations in language, conceptual knowledge and praxis. An absence of neurological signs is the hallmark of many FTD patients, but there is also an established association with motor neurone disease (MND), progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD). FTD is commonly defined as an early onset dementia, yet about a quarter of patients present after the age of 65. The underlying pathological protein is tau, TDP-43 or more rarely fused-in-sarcoma (FUS). Distinct genetic mutations have been identified in familial FTD. There are predictable relationships between clinical phenotype, pathological substrate and genetic mutation. For example, a circumscribed semantic disorder predicts TDP-43 pathology, and speech or limb apraxia tau pathology. The co-occurrence of MND predicts TDP-43 pathology, and PSP and CBD tau pathology. FUS pathology is associated with very youthful onset, stereotyped behaviours and caudate atrophy. Non-fluent aphasia is linked to progranulin (GRN) mutations and MND and psychosis to repeat expansions in the C9orf72 gene. Despite striking worldwide consensus in findings there remain some issues of contention, largely related to the classification of FTD and its sub-variants. Understanding the diverse nature of FTD is crucial for effective diagnosis, management and the development of targeted therapies.

A novel phenotype in an Italian family with a rare progranulin mutation

IntroductionProgranulin (PGRN) is a secreted glycoprotein encoded in humans by the GRN gene, located on chromosome 17q21. Several nonsense and missense pathogenetic GRN mutations have been described.ObjectiveWe herein describe two sisters carrying a rare GRN mutation with extremely different clinical features and family history of dementia and behavioral disorders, with a novel presentation with stridor and dysphonia.MethodsPatients underwent a multidimensional assessment including neurological and neuropsychological evaluation, structural and functional imaging, and genetic screening.ResultsThe younger sister presented at the age of 64 with inspiratory stridor, dysphonia and exercise-induced dyspnea. Transnasal fiberoptic laryngoscopy showed bilateral adduction of the vocal cords at rest and paradoxical further adduction of the vocal cords during forced inspiration, suggesting the hypothesis of an adductor laryngeal dystonia. The older sister presented at the age of 63 with a rapidly progressive corticobasal syndrome. The only clinical feature common to both sisters was a dysexecutive syndrome. The c.893G > A mutation in exon 9 of GRN was found in heterozygosis in both sisters, causing a missense Arginine to Histidine substitution in position 298 of the protein (p.R298H).ConclusionsOur report supports the pathogenicity of the GRN p.R298H mutation, which is first detected in two members from the same family, showing an extremely different phenotypes. Moreover, we report the first case of an FTD-associated mutation presenting with inspiratory stridor and dysphonia linked to adductor laryngeal dystonia, thus expanding the clinical spectrum of GRN-related disorders.

Progranulin mutations in clinical and neuropathological Alzheimer's disease.

Progranulin (GRN) mutations occur in frontotemporal lobar degeneration (FTLD) and in Alzheimer's disease (AD), often with TDP-43 pathology. We determined the frequency of rs5848 and rare, pathogenic GRN mutations in two autopsy and one family cohort. We compared Braak stage, β-amyloid load, hyperphosphorylated tau (PHFtau) tangle density and TDP-43 pathology in GRN carriers and non-carriers. Pathogenic GRN mutations were more frequent in all cohorts compared to the Genome Aggregation Database (gnomAD), but there was no evidence for association with AD. Pathogenic GRN carriers had significantly higher PHFtau tangle density adjusting for age, sex and APOE ε4 genotype. AD patients with rs5848 had higher frequencies of hippocampal sclerosis and TDP-43 deposits. Twenty-two rare, pathogenic GRN variants were observed in the family cohort. GRN mutations in clinical and neuropathological AD increase the burden of tau-related brain pathology but show no specific association with β-amyloid load or AD.

Eye‐tracking task detects early executive function deficits in presymptomatic frontotemporal dementia

AbstractBackgroundAs research moves from understanding the natural history of frontotemporal dementia (FTD) to therapeutic trials, reliable and valid psychological measures are required to assess the efficacy of treatments. Current psychometric tests have only been able to identify subtle changes in genetic FTD around 5 years before the onset of symptoms suggesting more sensitive tasks are required.MethodThe aim of this study was to investigate whether an anti‐saccade eye‐tracking task could detect impaired executive function in a cohort of individuals that are at‐risk of developing genetic FTD. A total of 18 mutation carriers (MCs) and 20 mutation negative control participants completed the task, being instructed to look in the opposite direction to the red dot when it appeared on the screen. There were eight trials in the horizontal direction at 5 and 8 degrees of visual angle (°VA) and four trials in the vertical condition at 5°VA. The number of correct and self‐corrected anti‐saccades was calculated and a linear regression, covarying for sex, was used to assess performance between mutation carriers and controls.ResultOf the 18 mutation carriers, 8 had expansions in chromosome 9 open reading frame 72, 6 had progranulin mutations and 5 had mutations in microtubule‐associated protein tau. The mean age for the mutation carriers group overall was 33.2 years, and 34.3 for the control group. The mutation carriers had significantly fewer correct anti‐saccades than the control group when the stimuli was presented in the vertical direction (MCs: mean = 1.44, SD = 1.29; controls: 2.32, 0.95; p = 0.016). There were no significant differences observed in the number of correct anti‐saccades in the horizontal direction, nor in the number of self‐corrected anti‐saccades made in either direction.ConclusionThis preliminary study suggests that early executive function deficits can be detected presymptomatically in FTD using an anti‐saccade eye‐tracking task. It is possible that tasks like this, using eye‐tracking with very simple instructions, may be able to help assess the efficacy of therapeutic trials in the near future.