Progranulin gene mutation of frontotemporal dementia in China: A case report and literature review

Abstract

AbstractBackgroundProgranulin (GRN) mutations of Frontotemporal dementia (FTD) were rarely reported in China. This study was to report one novel GRN mutation and summarize the genetic and clinical features of patients with GRN mutations in China.MethodComprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58‐year‐old patient who was diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and the clinical and genetic features of patients with Progranulin mutations in China were summarized.ResultMarked lateral atrophy and hypometabolism on the left‐side frontal, temporal and parietal lobes of the patient were found on neuroimages, and amyloid and tau positron emission tomography ruled out pathological protein deposition. A novel heterozygous 45‐bp deletion (c.141414_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was identified through Whole Exon Sequencing of the patient’s genomic deoxyribonucleic acid. Nonsense‐mediated messenger ribonucleic acid decay was implicated in the degradation of the mutated messenger ribonucleic acid, and it was defined as pathogenic by American College of Medical Genetics and Genomics guidelines. In the literature review, we found Chinese reports of 13 patients with Progranulin mutations. A 1.2%–2.6% prevalence, an early disease onset and a female predominance were reported in Chinese patients with GRN mutations.ConclusionOur findings expand the mutational profile of Progranulin mutations in China and provide a basis for potential treatments for Progranulin.