Priority For Industry Research Articles

Primary assessment of sectoral strategic priorities effectiveness: The Far Eastern gas industry case

Subject. The article addresses strategic priorities of the gas industry of the Far East. Objectives. The aim is the primary assessment of internal strategic priorities effectiveness of the Far East gas industry. Methods. The study rests on particular provisions of sectoral strategizing that are based on the general theory of strategy and methodology of strategizing by V.L. Kvint, a foreign member of the Russian Academy of Sciences. I apply my own extended methodology of primary evaluation of effectiveness of industry strategic priorities, including the process of parametrization of indicators for the estimated effects of industry priorities, modeling and evaluation of the studied effects, the process of ranking industry strategic priorities. Results. I performed a primary assessment of effectiveness of strategic priorities for ensuring the gasification of the Far East regions and developing the gas processing and gas chemical production. Based on the analysis results, I estimated effects on the gross regional product for each of the priorities, calculated intermediate and main indicators of their effectiveness. Conclusions. The findings will enable to make a decision on the priorities implementation for effective preparation of final document of the strategy of the gas industry in the region.

CFD Prediction of a Double Impulse Burner for Glass Furnaces

Recently, growing environmental awareness has radically changed the way the problems and priorities of industry are dealt with. Energy issues have become an issue of primary importance, both in terms of consumption and polluting emissions. However, for the green transition to happen, the first step is to have a deeper knowledge of the phenomena involved in processes with a special focus on combustion. The glass industry is one of the most energy-intensive since a temperature of over 1400 °C is required to keep glass molten, with a large consumption of natural gas used for combustion. A fundamental element to control the process is the burner. In this study, the CFD (Computational Fluid Dynamics) prediction of the internal streams repartition and the velocity profile at the exit, at different geometrical setups and operating conditions, of an industrial burner for glass furnaces is presented, with the aim of developing a surrogate model to provide these two important quantities quickly. The study of the repartition of the mass flow inside a double impulse burner and the subsequential velocity profile outside the burner is a novelty in the glass industry. The CFD prediction of the operating conditions is a crucial aspect because it is an essential boundary condition for the simulation of the reactive process from the diffusive flame found in glass furnaces. Different operating and geometrical conditions of the burner have been tested using Ansys CFX code, and results (velocity profile and mass flow repartition) have been organized in surrogate models. Results showed that the repartition of the fuel streams is mainly influenced by the position of the barrel, while the total flow rate is strongly influenced by the total inlet pressure. The internal flow varies from 20% to 50% of the total mass flow inside the burner, while the velocity magnitude outside the burner varies from 80 to 300 m/s approximately. The reconstruction of velocity profiles at the exit of the burners with surrogate models showed an acceptable match with numerical simulations.

Dietary Wheat Gluten Alters the Gut Microbiome and Plasma Taurine Levels in European Sea Bass (Dicentrarchus labrax)

Incorporating environmentally sustainable plant-based protein sources into aquafeeds is a priority for the aquaculture industry. Wheat gluten as a plant protein source has been successfully integrated into feeds for several fish species. However, unique nutritional requirements and the potential for intolerances necessitate the evaluation of plant-based diets by species. Previous work by our laboratory indicated that wheat gluten at less than 4% inclusion in a compound feed had a negative impact on growth and survival rate in juvenile cobia (Rachycentron canadum). In the current study, we evaluated the effects of wheat gluten inclusion in a plant-based diet in juvenile European sea bass (Dicentrarchus labrax). No major differences were observed in terms of growth rate, plasma biochemical parameters, detectable induction of plasma IgM, IgT, or factors capable of binding gliadin in response to the inclusion of 4% dietary wheat gluten. However, plasma levels of taurine doubled in the fish fed wheat gluten, and there were considerable changes to the intestinal microbiome. Despite these measurable changes, the data suggest that dietary inclusion of 4% wheat gluten is well tolerated by juvenile European sea bass in a plant-based feed formulation.

Drivers of divergent industry and consumer food waste behaviors: The case of reclosable and resealable packaging

Optimizing packaging to align with consumers' food management needs can improve packaging's potential to reduce household food waste, important for a sustainable food system. This paper provides actionable insights to support the food/beverage–packaging industry, policymakers, and researchers to better understand the factors impeding industry implementation of packaging aligned to consumer needs and the potential flow-on effects on household food waste. To facilitate understanding, a consumer-industry grounded model is presented based in the Australian context, developed through qualitative research using the Gioia method to examine reclosable/resealable packaging, food storage, and household food waste.The results indicate that divergent packaging priorities and needs in industry and consumers impede food waste reduction. Industry concerns for business viability mean prioritizing features to sell products, hence consumer needs are secondary. Consumer needs are framed by individual task goals for managing food storage and the availability of supporting resources, including appropriate packaging. Suggestions to help align consumer and industry priorities include increased industry–consumer communication to better help industry understand consumer needs and validating product-packaging with consumers.

Lossy mode resonance-based optical immunosensor towards detecting gliadin in aqueous solutions

The development of accurate, intuitive, and easy-to-handle devices to detect different types of allergens is on the rise, as these are useful tools to guarantee consumer safety, which should be a priority for any food industry. Gliadin, one of the main proteins present in gluten, is the one responsible for triggering the immune system to produce autoantibodies in celiac disease, the most dangerous pathology related to gluten. Lossy Mode Resonance (LMR) based biosensors are lately known as a promising sensing technology and its implementation on planar waveguides has been shown to result in manageable, sustainable and robust structures. In this work, an LMR based microfluidic biosensor for gliadin detection is proposed, by coating a coverslip with Titanium Dioxide (TiO2) by Atomic Layer Deposition (ALD) to generate the resonance phenomena and functionalizing the sensor surface with anti-gliadin antibody (AGA) through covalent bond. The sensor was exposed to different gliadin concentrations in ultrapure water, in the range of 0.1–100 ppm with an accuracy of ±0.14 ppm, for a sensitivity of 1.35 ppm/ml. The calibration curve was obtained from the experimental data corresponding to three repetitions of the assay and a limit of detection (LOD) of 0.05 ppm was achieved. Moreover, the sensor was exposed to commercial flour samples, some of them labeled as gluten free (GF) and the response agreed with the expected results according to product label. Biosensor specificity to gliadin was demonstrated by injecting chicken egg white albumin without obtaining any significant response.

A systematic review of literature on credit card cyber fraud detection using machine and deep learning

The increasing spread of cyberattacks and crimes makes cyber security a top priority in the banking industry. Credit card cyber fraud is a major security risk worldwide. Conventional anomaly detection and rule-based techniques are two of the most common utilized approaches for detecting cyber fraud, however, they are the most time-consuming, resource-intensive, and inaccurate. Machine learning is one of the techniques gaining popularity and playing a significant role in this field. This study examines and synthesizes previous studies on the credit card cyber fraud detection. This review focuses specifically on exploring machine learning/deep learning approaches. In our review, we identified 181 research articles, published from 2019 to 2021. For the benefit of researchers, review of machine learning/deep learning techniques and their relevance in credit card cyber fraud detection is presented. Our review provides direction for choosing the most suitable techniques. This review also discusses the major problems, gaps, and limits in detecting cyber fraud in credit card and recommend research directions for the future. This comprehensive review enables researchers and banking industry to conduct innovation projects for cyber fraud detection.

Geographies of COVID‐19

Geographies of COVID‐19

Environmental impact assessment and potentials of material efficiency using by-products and waste materials

As sustainability is becoming a priority in the construction industry, concerns associated with the environmental impacts of the production and use of Portland cement (PC) are being raised. To respond to this challenge and among different strategies of material efficiency, the potential of by-products and recycling wastes to produce eco-friendly cement-based or cement-less construction materials is given greater emphasis. This research investigates the environmental assessment and carbon footprint of different building envelope walls using by-product and waste materials of energy-intensive processes including power plants, and steel and glass industries. Four different products that can be used in the concrete as the replacement of Portland cement including fly ash, ground granulated blast-furnace slag (GGBS), Glass powder, and mix design of these materials are compared with the regular concrete mix to be used as an envelope wall. After that, the potentials of production and consumption of these materials in the concrete are assessed in Canada. Results show that GGBS concrete with 287 kg CO2 eq per m3 has the lowest CO2 emissions compared with other by-products/waste-used concrete. The CO2 emissions of fly ash concrete are 37% higher than GGBS and glass powder concrete has 50% higher CO2 emissions compared with GGBS concrete. Also, among different environmental damages that concrete would be responsible for, damage to human health has the highest impact on the environment. Fly ash and glass powder concrete have also the highest environmental damage to human health even than regular mix. GGBS concrete has the lowest environmental impact compared with other products that can be considered as a great replacement for PC. Due to the concrete demand exist in Canada, all studied by-products and waste can be fully used in the concrete industry.

A study on the effectiveness of non-verbal teaching materials in construction accidents prevention education: through an International comparative experiment

ABSTRACT Safety is a top priority in the construction industry; therefore, safety training is essential to prevent construction casualties as the employment of foreign and young workers on construction sites worldwide increases. More studies are necessary to identify the effective training methods among novices and foreign workers. To address the gap, a rigorous comparative study of verbal and non-verbalized materials from two different countries was conducted. Statistically significant differences were found between nationalities in non-verbal materials due to different safety culture and background, and insignificant differences were found between both safety training materials with the same nationality. By comparing the outcomes of both training materials, the non-verbalized materials work effectively among the construction novices to provide visual aid to relate similar attitudes like technical trainees to the scenarios even without field experiences. The non-verbalized materials provide an alternative to passive learning methods to enhance the other safety training activities in the construction industry. The findings provide an initial stage for creating effective teaching materials that can be generally applied in other countries to capture the issues by a heterogeneous workforce personalized to suit the scenario of each country for better outcomes.

Compressed air energy storage (CAES): current status, geomechanical aspects and future opportunities

Abstract A compressed air energy storage (CAES) facility provides value by supporting the reliability of the energy grid through its ability to repeatedly store and dispatch energy on demand. Two main advantages of CAES are its ability to provide grid-scale energy storage and its utilization of compressed air, which yields a low environmental burden, being neither toxic nor flammable. The focus of this review paper is to deliver a general overview of current CAES technology (diabatic, adiabatic and isothermal CAES), storage requirements, site selection and design constraints. We discuss underground storage options suitable for CAES, including submerged bladders, underground mines, salt caverns, porous aquifers, depleted reservoirs, cased wellbores and surface pressure vessels. A geomechanical perspective is provided regarding the pressure limits for these options. The impacts of cyclic injection and withdrawal of compressed air, and the importance of caprock assessments with porous rock CAES, are also discussed. In addition, we provide an overview of the large-scale CAES facilities that are currently active or under development and a cost comparison of the diabatic, adiabatic and isothermal CAES options. Lastly, we outline major challenges and future opportunities for CAES and the top priorities for research, industry and stakeholders.

Pandemi Döneminin Türkiye’deki Havayolu Pilotlarının Performansına Etkisi

The aviation industry is one of the sectors that have been adversely affected by the pandemic, both materially and morally. In the early stages of the pandemic, air transport came to a standstill for a long time. The airline industry's inability to do business has had some consequences. Pilots, who are the last link of flight safety, which is an indispensable priority of the airline industry, have been the professional group that directly confronts the material and moral consequences of interrupted flights. When the importance of the flight performance of the pilots is evaluated, the effect of these results on the aviation sector has become suitable to increase geometrically. In this study, it is aimed to reveal the extent to which the pilots are affected by the pandemic conditions and the main reasons for these effects. The method of the study was determined as a questionnaire and one-to-one interviews with flight instructors. 148 pilots participated in the survey and 3 flight instructors were interviewed. According to the results, it has been seen that the group most affected by the effects of the pandemic is the inexperienced first officers who have just started to work and have not gained enough experience yet. It has been seen that every time they come to the cockpit, they perform as if they are sitting in that seat for the first time. It was observed that the least affected were experienced captains. However, in general, since flight is a team job, it has been observed that the workload of experienced captains increases due to inexperienced first officers, which negatively affects flight performance. However, it is thought that it is not reflected in the statistics due to the decrease in the number of flights.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Time to Think "Meta": A Critical Viewpoint on the Risks and Benefits of Virtual Worlds for Mental Health.

The metaverse is gaining traction in the general population and has become a priority of the technological industry. Defined as persistent virtual worlds that exist in virtual or augmented reality, the metaverse proposes to afford a range of activities of daily life, from socializing and relaxing to gaming, shopping, and working. Because of its scope, its projected popularity, and its immersivity, the metaverse may pose unique opportunities and risks for mental health. In this viewpoint article, we integrate existing evidence on the mental health impacts of video games, social media, and virtual reality to anticipate how the metaverse could influence mental health. We outline 2 categories of mechanisms related to mental health: experiences or behaviors afforded by the metaverse and experiences or behaviors displaced by it. The metaverse may benefit mental health by affording control (over an avatar and its virtual environment), cognitive activation, physical activity, social connections, and a sense of autonomy and competence. However, repetitive rewarding experiences may lead to addiction-like behaviors, and high engagement in virtual worlds may facilitate and perpetuate the avoidance of challenges in the offline environment. Further, time spent in virtual worlds may displace (reduce) other determinants of mental health, such as sleep rhythms and offline social capital. Importantly, individuals will differ in their uses of and psychological responses to the metaverse, resulting in heterogeneous impacts on their mental health. Their technological motivations, developmental stage, sociodemographic context, and prior mental health problems are some of the factors that may modify and frame the positive and negative effects of the metaverse on their mental health. In conclusion, as the metaverse is being scaffolded by the industry and by its users, there is a window of opportunity for researchers, clinicians, and people with lived experience to coproduce knowledge on its possible impacts on mental health and illness, with the hope of influencing policy-making, technological development, and counseling of patients.

Identifying Tourists as Stakeholders in Destination Marketing Cooperation: A Case Study in China

Recent studies began to notice the significance of taking tourists into destination stakeholders, because the essence of destination is the primary place for tourist consumption. With empirical experience from a case study in Jing-Jin-Ji region, China, this paper classifies tourists’ stakeholder type as Dominant Stakeholders in destination marketing cooperation within Mitchell’s salience theory’ typology according to their salience attributes of legitimacy and urgency. Then, to explore factors influencing the success of cooperation from tourist stakeholder’s perspective, this paper analyzes tourist flow changes responding to the progress of destination marketing cooperation, and further understands these factors with the support of interviews with tourist’s group and other critical stakeholders. Finally, three major factors are found including the priority of tourism industry to destination governments, the priority of tourism cooperation to destination marketing organizations, and involvement of tourism enterprises in cooperation.

Prediction of human error probabilitiy for officers during watchkeeping process under SLIM approach

ABSTRACT Safety is the first priority for the maritime industry as it relates to the environment, human life, and the cargo carried. The human factor is vital as it critically impacts increasing safety on board. The human factor also has an essential place in watchkeeping operations on the bridge. At the same time, estimating human error has always been difficult, as data are difficult to obtain in the maritime industry. The Success Likelihood Index Method (SLIM) is often used in human error (HE) evaluation in the maritime industry, where it is difficult to obtain human error data. Therefore, this study aims to evaluate the human error (HE) probabilities in watchkeeping operations on the bridge by using the SLIM. In this study, the findings obtained from the SLIM method can also be used as a decision-making tool by all ship crews and ship management companies to minimise the possibility of human error occurring during the watchkeeping and increase the safety level on the board.

Development of a safety performance-based model for assessing the civil aviation organization's risk

Ensuring safety is always the first priority in the civil aviation industry because accidents will result in serious casualties and property losses. In order to implement safety performance management effectively, requirements from ICAO and CAAC are summarized. The research progress of safety performance management from academy and civil aviation industrial field is analyzed. The process of safety performance management and the relationship of safety performance management and other components of safety management system are presented. A model is proposed for assessing operation risk of a civil aviation organization based on established safety performance indicators. A case of three departments in an airport is used to validated the proposed risk assessment model.

Optimum insulation thickness in process pipelines

Thermal insulation of pipelines and components is an important step in aerospace, automotive and process industries where the operating fluid is at high temperatures. Thermal insulation is provided to reduce system heat loss, protect humans from burns and injuries, and protect nearby components from damage. Different insulation materials are available in the market with different properties, resulting in different optimum thicknesses of the insulation materials for the least heat loss from the system, and different costs. Insulation material cannot be chosen in an industry based on its cost or thickness alone. A balance of both cost and safety has to be upheld, which are considered top priorities in industries, along with time. In this paper, a significantly easier method of comparing the effects of different insulation materials for a given system is discussed, along with concluding the best material and its thickness for the same. Heat loss at various process temperatures and various insulation materials for different pipe diameters is obtained through simulations in ANSYS. Theoretical calculations are further used to find the optimum thickness of insulation concerning cost and system heat loss, and if required, the outer surface temperature of the system. This is important since too much of insulation can lead to increased costs and too little leads to reduced safety. Stainless steel pipe diameters of 1, 2 and 4 in., and insulation materials EPS, XPS and fiber glass are considered for this study.

Evaluation of In-Field Inoculation Methods for Characterization of Macadamia Germplasm to Husk Spot Incidence and Severity.

Husk spot, a fungal disease of macadamia pericarps (Pseudocercospora macadamiae), induces premature abscission in several major commercial cultivars. Breeding for resistance to husk spot is a priority of the Australian macadamia industry. Due to the large tree size of macadamia and high numbers of progeny in breeding populations, inoculating for resistance screening is laborious and time consuming. Previously utilized methods included direct applications of P. macadamiae suspensions and the hanging of bags of diseased husks above developing fruit in tree canopies. In this study, both methods were modified to allow for efficient application in large-scale breeding populations, and their efficacy was evaluated. Two quantities of diseased husk per bag, 'large' (75 g) and 'small' (30 g), and two concentrations of sprayed P. macadamiae suspensions, 'stock' (5 × 105 propagules/ml) and 'dilute' (2.5 × 105 propagules/ml), were tested across two fruiting seasons. Treatments were compared against a control (sterile water) in commercial cultivars A38 and A4. Husk spot incidence and severity produced by small bags were significantly affected by season. A significant season effect was less common for other treatments. All four treatments infected over 50% of target fruit in each season, but the highest husk spot incidence across both seasons (≥85%) was produced from large bags. Overall, the large bags were the most reliable method for infection of target fruit. Results also demonstrate the importance of considering the effect of season when selecting husk spot inoculation methods.

The Future Of The Global Market For Natural Gas

The article presents an analysis of the current state of the global market for natural gas and some forecasts for its long-term development. Regional and sectoral aspects of gas production and consumption are considered. Particular attention is paid to the development priorities of the gas industry in the countries of East and South Asia. During the period of economic slowdown, the imbalance of supply and demand in the global hydrocarbon market leads to its destabilization. In order to predict such situations, experts from international and Russian organizations (International Energy Agency, BP plc, Energy Re-search Institute of the Russian Academy of Sciences, Institute of Energy Economics of Japan) and consulting companies (IHS Markit) periodically publish works on the evolution of world energy markets and the possible consequences for Russia and other countries. Nevertheless, in the foreseeable future none of the authors is likely to predict the period of peak gas demand even for the world's largest economies (with the exception of the European Union and de-veloped countries of Asia), which gives reason to call the twenty hundreds “the century of natural gas”.

Application of digital marking for confectionery for sustainability life cycle of food products

Currently, one of the priorities of the food industry is to ensure the quality and safety of products. Food industry enterprises produce products that meet the requirements of regulatory and technical documentation and consumer preferences. But often it is at the stages of distribution, storage and sale that quality indicators deteriorate. Failure to comply with the terms and conditions of delivery of products leads to defects, and such products will not be safe for consumption. In this regard, it is necessary to find such methods and means of labeling that would preserve the nutritional value and consumer properties throughout the entire life cycle of products. The work is devoted to the use of modern labeling methods to preserve consumer properties at the stages of product distribution and the economic costs of implementation. It is proposed to use a QR code or radio frequency tags NFC-PASS, which record information about the Internet resource that contains data about this particular product.