Primer Annealing Temperature Research Articles

Establishment and application of multiplex PCR for rapid detection of three mink diarrhea-associated viruses

In this report, a multiplex PCR method was developed for the detection of three diarrhea-associated viruses in mink, including circovirus (MCV), bocavirus (MBoV), and enteritis virus (MEV). Three compatible sets of primers specific for each virus were designed respectively based on their conserved sequences. After optimization of the crucial factors such as primer concentration and annealing temperature in single and multiple amplification, three specific fragments were simultaneously amplified with the highest sensitivity and specificity in one PCR reaction. The fragments amplified were 259 bp (MCV)，455 bp (MBoV) and 671 bp (MEV). The sensibility of this one-step multiplex PCR is about 10 times lower than that of regular singleplex PCR. There were no cross-reactions with some relevant pathogens like mink coronavirus, canine distemper virus, and aleutian mink disease virus. In our study we analyzed viral DNA in mink fecal samples by multiplex PCR assay from China, which revealed the occurrence of MCV, MBoV, and MEV as 3.1 %, 5.7 %, and 9.8 %, respectively. The testing results of multiplex PCR agreed with the singleplex PCR results with a coincidence rate of 100 %. These results indicated that the method could provide technical support for rapid detection of the three diarrhea-associated viruses, and epidemiological investigation of mink viral diarrhea.

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

Simultaneous Detection of Three Subgroups of Avian Leukosis Virus Using the Nanoparticle-Assisted PCR Assay.

Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the rapid detection of pathogens. A sensitive and specific multiple nanoPCR assay was developed for simultaneous detection of avian leucosis virus (ALV) subgroups A, B and J. In this study, three pairs of primers were designed, based on the conserved region of the gp85 gene. An exploration of the optimal primer concentration and annealing temperature were carried out, for better performance of the nanoPCR assay. According to the results, the multiple nanoPCR assay amplified 336 pb, 625 bp and 167 bp fragments of ALV-A, -B and -J, respectively, and showed no cross-reactivity with irrelevant pathogens, suggesting the excellent specificity of the assay. The constructed standard DNA templates were used to estimate the limit of detection. As shown by the results, the detection limit of the nanoPCR assay was nearly 10 copies/μL. To further evaluate the detection ability of the assay, 186 clinical samples were detected using the nanoPCR assay, among which, 14 samples were confirmed as ALV positive; the results were further confirmed by sequencing. In conclusion, a highly specific and sensitive nanoPCR assay was successfully developed, which could be a useful tool for clinical diagnosis as well as for the discrimination of ALV-A, -B and -J.

Qualitative and Quantitative Detection of CRISPR-Associated Cas Gene in Gene-Edited Foods.

Effective regulation of gene-edited products and resolution of public concerns are the prerequisites for the industrialization of gene-edited crops and their derived foods. CRISPR-associated protein, the core element of the CRISPR system, requires to be regulated. Thus, there is an urgent need to establish qualitative and quantitative detection methods for the Cas gene. In the present study, the primers and probes were designed and screened for Cas12a (Cpf1), which is the most commonly used target site in gene editing; we performed PCR system optimization, determined the optimal primer concentration and annealing temperature, and established qualitative PCR and quantitative PCR (qPCR) assays for detecting Cpf1 in gene editing by specificity and sensitivity tests. In specificity testing, qualitative PCR and qPCR methods could 100% detect samples containing Cpf1 DNA, while the detection rate of other samples without Cpf1 was 0%. In the assay sensitivity test, the limit of detection of qualitative PCR was 0.1% (approximately 44 copies), and the limit of detection of the qPCR method was 14 copies. In the stability test, both the qualitative PCR and qPCR methods were repeated 60 times at their corresponding lowest detection limit concentrations, and the results were positive. Thus, the qualitative and quantitative assays for Cpf1 are specific, sensitive, and stable. The method provides technical support for the effective monitoring of gene-edited products and their derived foods in the future.

Diagnosis of avian metapneumovirus infection using multiplex PCR

Avian metapneumovirus infection causes significant economic damage to poultry farming, which consists of losses from a decrease in safety and productivity, as well as the cost of health and preventive measures.The causative agent of the disease is avian metapneumovirus family Paramyxoviridae subfamily Pneumovirinae genus Metapneumovirus. The viral genome consists of 8 genes encoding 9 proteins: N-nucleoprotein, P-phosphoprotein, Mmatrix protein, F-fusion protein, M2 (M2-1,M2-2) - elongation/transcription factor, SH-(small) hydrophobic protein, Gglycoprotein, L-(large) polymerase. The virus lacks non-structural NS1 and NS2 proteins that counteract interferon.Based on the nucleotide seguence of the variable glycoprotein G gene, avian metapneumovirus was classified into four 4 subtypes of MPV are officially known, although recent publications have reported of two new pneumoviruses, GuMPV and AMPV PAR-05 isolated from the seagull and parrot in North America.The diversity of pathogen subtypes and differences in virulence properties of metapneumovirus create difficulties both in the prevention of this disease and in its diagnosis.The complexity of isolating the metapneumovirus from the test material is due to the short period of persistence of the virus in the organs of birds. It is possible to isolate the RNA of the causative agent of MPVI by the molecular biological method within 17-19 days after infection. The aim of our work was development and testing of primers and probes for the simultaneous detection and differentiation of avian metapneumovirus subtypes A and B by PCR with real-time fluorescence detection, with high specificity.Using vaccine strains 8544 and VC-03, the conditions for PCR were selected according to the composition of the PCR mixture and the annealing temperature of primers and probes. During PCR, we recorded the fluorescence signal through the FAM channel for cDNA obtained from the 8544 vaccine strain, and through the HEX channel for the VC-03 vaccine strain. The specificity of the developed primers and probes was also tested in studies with heterogeneous viruses such as Newcastle disease, classical and variant strains of chicken infectious bronchitis virus, and with bird DNA.The studies conducted to determine the specificity of the primers selected by us for multiplex PCR diagnostics make it possible to simultaneously specifically detect subtypes A and B of the causative agent of MPVI in birds in real time using different fluorescence channels, while other non-target respiratory pathogens were not observed.

Optimization of the Detection Method for Xanthomonas axonopodis on Chili Pepper Seeds Using Polymerase Chain Reaction with Two Difference Primers

The detection of Xanthomonas axonopodis pv vesicatoria (XAV) from chili seeds was carried out to avoid spreading XAV through seed. Detection of XAV in chili seeds through Polymerase Chain Reaction (PCR) using XAVF/XAVR and RST65/RST69 primers sometimes got unclear electrophoresis results. This research was conducted to determine the optimal time and temperature of primer annealing, and primer concentration to detect XAV on chili pepper seeds. Optimization was conducted in three phases, (1) optimization of primer annealing temperature, (2) optimization of annealing time, and (3) determinate primer concentration. The results show that XAVF/XAVR primer is optimal at 60°C for 30 seconds on the primer concentration of 10 pmol, and primer RST65/RST69 is optimal at 58°C for 20 seconds on the primer concentration of 10 pmol. The optimal time, temperature of primer annealing, and primer concentration were validated by three repetitions using positive and negative control. The validation test result shows that optimal time and temperature of primer annealing, and primer concentration consistently produce clear electrophoresis results without smear.

Rapid and Accurate Detection of Gnomoniopsis smithogilvyi the Causal Agent of Chestnut Rot, through an Internally Controlled Multiplex PCR Assay.

The fungus Gnomoniopsis smithogilvyi is a significant threat to the production of sweet chestnut (Castanea sativa) nuts in Australia and worldwide. The pathogen causes nut rot, which leads to substantial production losses. Early and accurate diagnosis of the disease is essential to delineate and implement control strategies. A specific and sensitive multiplex PCR was developed based on the amplification of three barcode sequences of G. smithogilvyi. The assay reliability was enhanced by including the amplification of a host gene as an internal control. Primers were thoroughly evaluated in silico before assessing them in vitro. Primer annealing temperature and concentration were optimised to enhance the assay sensitivity and specificity. The assay detection limit ranged between 0.1 and 1.0 pg (5 and 50 fg/μL) of genomic DNA per reaction. No cross-reactivity was observed with genomic DNA from closely and distantly related fungal species. We also characterised Australian G. smithogilvyi isolates phenotypically and genotypically and found significant differences in morphologic and virulence traits of the isolates. An understanding of the virulence of G. smithogilvyi and the availability of a reliable and accurate diagnostic technique will enable earlier detection of the pathogen, which will contribute to effective control strategies for the disease.

Development of a SYBR Green real-time PCR-based assay system for detection of Neisseria gonorrhoeae

Diagnosis of Neisseria gonorrhoeae infection is needed for patient therapy and for reducing this bacterial transmission in the population. The culture method is a gold standard method for N. gonorrhoeae detection, however it has low sensitivity. Among molecular methods with high sensitivity and specificity, SYBR Green real-time PCR is the potential method for N. gonorrhoeae detection. In this study, we developed an SYBR Green real-time PCR-based system assay for N. gonorrhoeae detection. Several PCR conditions were optimized and analyzed including primer annealing temperature, DNA template volume, the limit of detection (LoD), cross-reaction with others (bacteria, viruses, fungus, protozoa), and quality assurance. The results showed that the annealing temperature and DNA template volume were 60oC and 5 µL, respectively. The LoD was 29 DNA copies corresponding to 3 bacterial cells per reaction. No cross-reaction was detected for other bacteria, viruses, fungus and protozoa. The external quality assurances enrolled in 2019 and 2021 showed 100% concordance. The preliminary testing for clinical samples was also 100% concordance. In conclusion, the SYBR Green real-time PCR-based system assay developed in this study is promising for application in clinical laboratories.

Optimization of qRT-PCR Annealing Temperature of WRKY45 Gene for Detection of Resistance Genes Against Xanthomonas oryzae pv. oryzae on Black Rice Cempo Ireng

Plant pathogens constrain the development of black rice farming. One of these pathogens is Xanthomonas oryzae pv. oryzae (Xoo), causing a bacterial leaf blight disease. The disease disrupts crop growth and reducing yields. Cempo ireng is a local pigmented rice cultivar from Yogyakarta, Indonesia, which is reported for its high resistance to Xoo. One of the rice resistance mechanisms to Xoo infection is a molecular defense employing plant resistance genes such as WRKY45. Comparing the expression of resistance-related genes of the resistant cultivar to the susceptible ones is needed to elucidate the resistance mechanism of the black rice to Xoo. For this purpose, the expression of WRKY45 gene at the level of mRNA can be performed using qRT-PCR. The success of qPCR analysis is greatly influenced by the accuracy of the annealing primer temperature of the corresponding gene. This study aimed to optimize the primer's annealing temperature for WRKY45 gene. The optimization was done by a temperature gradient PCR. Determination of the optimal annealing temperature was selected based on the profile of the amplification curve, melt curve, melt temperature and the Ct value obtained. The annealing temperature gradient used in this study was ranging from 52°C to 60°C. The results showed that the best annealing temperature for WRKY45 gene primers is 58.3°C based on the amplification curve, melt curve, melt peak and Ct value of 29.21.

Development of a Dual PCR Method for Detection of Pasteurella Multocida and Haemophilus Parasuis


 Pasteurella multocida and Haemophilus parasuis are the main pathogens of porcine respiratory disease syndrome, and often are the common pathogens of porcine pulmonary disease in collectivized pig farms. It has brought great influence on the pig industry and seriously hampered the healthy development of pigs. Therefore, the rapid detection method for Pasteurella multocida and Haemophilus parasuis is the key to its successful prevention and control. In the process of diagnosis, we need to conduct laboratory tests for confirming of preliminary diagnosis, that can be made based on the history, clinical symptoms, pathological changes of necropsy and epidemiological characteristics of the disease. Traditional diagnostic techniques, such as bacterial isolation and immunological test, are time-consuming and laborious, and are not suitable for rapid clinical diagnosis, nor for large-scale epidemiological investigation. Therefore, it is necessary to establish an accurate and rapid method to identify the two common respiratory pathogens in pigs. 
 In this paper, Pasteurella multocida and Haemophilus parasuis were used as research objects to establish a dual PCR detection method. The main research contents are as follows: A dual PCR assay was established to detect Pasteurella multocida and Haemophilus parasuis simultaneously. By using Pasteurella multocida and Haemophilus parasuis specific primers, and adjusting primer concentration and annealing temperature, a dual PCR method for detecting Pasteurella multocida and Haemophilus parasuis was established.
 The rapid detection method for Pasteurella multocida and Haemophilus parasuis established in this study has high specificity and sensitivity, and can realize rapid and accurate identification of pathogenic bacteria in a relatively short period of time, providing a new technical means for rapid detection in clinical and grassroots laboratories

False negatives in GBA1 sequencing due to polymerase dependent allelic imbalance

A variant in the GBA1 gene is one of the most common genetic risk factors to develop Parkinson’s disease (PD). Here the serendipitous finding is reported of a polymerase dependent allelic imbalance when using next generation sequencing, potentially resulting in false-negative results when the allele frequency falls below the variant calling threshold (by default commonly at 30%). The full GBA1 gene was sequenced using next generation sequencing on saliva derived DNA from PD patients. Four polymerase chain reaction conditions were varied in twelve samples, to investigate the effect on allelic imbalance: (1) the primers (n = 4); (2) the polymerase enzymes (n = 2); (3) the primer annealing temperature (Ta) specified for the used polymerase; and (4) the amount of DNA input. Initially, 1295 samples were sequenced using Q5 High-Fidelity DNA Polymerase. 112 samples (8.6%) had an exonic variant and an additional 104 samples (8.0%) had an exonic variant that did not pass the variant frequency calling threshold of 30%. After changing the polymerase to TaKaRa LA Taq DNA Polymerase Hot-Start Version: RR042B, all samples had an allele frequency passing the calling threshold. Allele frequency was unaffected by a change in primer, annealing temperature or amount of DNA input. Sequencing of the GBA1 gene using next generation sequencing might be susceptible to a polymerase specific allelic imbalance, which can result in a large amount of flase-negative results. This was resolved in our case by changing the polymerase. Regions displaying low variant calling frequencies in GBA1 sequencing output in previous and future studies might warrant additional scrutiny.

Triplex qRT-PCR with specific probe for synchronously detecting Bovine parvovirus, bovine coronavirus, bovine parainfluenza virus and its applications.

Bovine parvovirus (BPV), bovine coronavirus (BCoV) and bovine parainfluenza virus (BPIV) are common etiologies causing gastrointestinal and respiratory diseases in dairy herds. However, there are few reports on the synchronous detection of BPV, BCoV and BPIV. The present article aimed to develop a quick and accurate RT-PCR assay to synchronously detect BPV, BCoV and BPIV based on their specific probes. One pair universal primers, one pair specific primers and one specific probe was designed and synthesized. After the concentrations of primer and probe and annealing temperature were strictly optimized, the specificity, sensitivity and repeatability of the established triplex probe qRT-PCR were evaluated, respectively. The results showed the recombinant plasmids of pMD18-T-BPV, pMD18-T-BCoV and pMD18-T-BPIV were 554bp, 699bp and 704bp, respectively. The optimal annealing temperature was set at 45.0°C for triplex qRT-PCR. The triplex probe qRT-PCR can only synchronously detect BPV, BCoV and BPIV. Detection sensitivities were 2.0×102, 2.0×102 and 2.0×101 copies/μL for BPV, BCoV and BPIV, being 1000-fold greater than that in the conventional PCR. Detection of clinical samples demonstrated that triplex probe qRT-PCR had a higher sensitivity and specificity. The intra-assay and inter-assay coefficient of variation were lower than 2.0%. Clinical specimens verified that the triplex qRT-PCR had a higher sensitivity and specificity than universal PCR. In conclusion, this triplex probe qRT-PCR could detect only BPV, BCoV and BPIV. Minimum detection limits were 2.0×102 copies/μL for BPV and BCoV, and 2.0×101 copies/μL for BPIV. The sensitivity of this triplex probe qRT-PCR was 1000-fold greater than that in the conventional PCR. The newly qRT-PCR could be used to monitor or differentially diagnose virus infection.

Multiplex polymerase chain reaction for genetically modified potato event AV43-6-G7 quantification. Proof of efficiency

One of the ways to improve the laboratory control methodology of genetically modified organisms of plant origin (GMO) is to use multiplexing - an approach that allows you to increase the number of targets and enlarge the number of simultaneously processed samples, maximizing the potential of polymerase chain reaction in real time (PCR-RT). The aim of the study is to develop a quantitative identification protocol for genetically engineered (GE) potato event AV43-6-G7 in the format of duplex PCR-RT with the use of TaqMan® PCR technology. Material and methods. The duplex system included 2 types of specific DNA-primers and fluorescence-labeled probes: the first one is for detection of transformation event AV43- 6-G7 DNA sequence, the second is for detection of Stp23 taxon-specific potato gene. PCR parameters were chosen by empirical selection of concentrations of primers and probes, Mg2+ ions, deoxyribonucleotides, stabilizing agent for polymerase, as well as primer annealing temperature and incubation duration for each stage of the cycle. Results. As a result of these studies, the composition of the reaction mixture was optimized for the detection and quantification of GE potato event AV43-6-G7 in food. Oligonucleotide primers and fluorescent probes were selected. The compositions of reaction mixtures and temperature-time parameters of PCR were tested: 2.5-fold reaction buffer for PCR-RT in the presence of ROX (carboxy-X-rhodamine), specific to the GE component primers (AV43-6-G7-f/AV43-6-G7-r) and target taxon (GRF3/ GRR3) at 300 nM/300 nM and 100 nM/100 nM, probes at 200 nM and 200 nM, respectively; bovine serum albumin - 0.04%; MgCl2 - 3.5 mM, deoxynucleoside triphosphates - 0.3 mM, as well as the temperature-time profile of the reaction (initial denaturation of 95 °C - 5 min, followed by 45 cycles: 95 °С - 20 sec, 58 °С - 20 sec, 62 °С - 40 sec). Conclusion. The validity of the developed method is confirmed by laboratory studies and testifies to its reliability.

Establishment of PMA Real-Time PCR Method to Detect Viable Cells of Listeria monocytogenes and Salmonella spp. in Milk and Dairy Products

The infection with Salmonella spp., Listeria monocytogenes are the most contamination events in the milk and dairy products. There are many disadvantages of conventional culture-based methods, which are still recognized as the “gold standard” for identifying pathogenic bacteria. Thus, the aim of current study was to develop reliable and rapid method for the detection of bacteria causing foodborne. For the establishment of PMA Real-time PCR method for co-detection of Salmonella spp., Listeria monocytogenes , bacteria strains, including Escherichia coli (ATCC 25922), Listeria monocytogenes (ATCC 19115; ATCC 19111), Salmonella enterica (ATCC 19115), Staphylococcus aureus (ATCC 25923), Vibrio parahaemolyticus (ATCC 17802), Shigella flexneri (ATCC 12022), Bacillus aureus (ATCC 11778) were enrolled into the establishment of current protocol. The concentration of PMA, primer concentration, probe concentration, and primer annealing temperature, specificity and sensitivity were evaluated. As the results, we successfully established the protocol of PMA Real-time PCR for co-detection of Salmonella spp. and Listeria monocytogenes on milk product. The concentration of PMA was determined as 50 I¼M. The sensitivity of established protocol were 101 CFU/ml for detection of Salmonella spp., and 102 CFU/ml for detection of Listeria monocytogenes . The current PMA Real-time PCR protocol was applied to detect the contamination of twenty local milk samples. No sample was co-contaminated with Salmonella spp. and Listeria monocytogenes . These results were similar to its performed by conventional culture-based methods. In summary, the current established PMA (50 I¼M) Real-time PCR could be applied for the co-detection of Salmonella spp. and Listeria monocytogenes on milk and dairy food.

DETECTION OF CAMPYLOBACTER SPP. WITH REAL-TIME POLYMERASE CHAIN REACTION

Bacteria of Campylobacter genus are ones of the main zoonotic pathogens causing human and animal diseases. Campylobacter organisms are microaerophiles and, therefore, require low oxygen concentration (3–5%) and high carbon dioxide concentration (3–10%) for their growth. They use amino acids rather than carbons as a source of energy. Classical bacteriological methods for Campylobacter spp. detection are not always successful due to diffi culties in creating optimal conditions for their growth. Therewith, development and implementation of molecular methods for Campylobacter detection and identifi cation are of current importance. Assay for qualitative Campylobacter spp. detection with real-time polymerase chain reaction using CFX-96 thermocycler was optimized. Highly specifi c segment of 16S rRNA gene allowing identifi cation of 6 Campylobacter species: C. jejuni, C. coli, C. lari, C. upsaliensis, C. helveticus и C. hyointestinalis was selected as an amplifi cation target. Optimal magnesium ion concentration (2.5 мМ) and primer annealing temperature (58 °С) were determined. Eighteen reference strains of various bacteria were tested. Only tests of Campylobacter genus strains gave positive results. The method sensitivity was 40 target molecules. The said method was used for testing 76 samples of raw materials of animal origin. Campylobacter spp. genome was detected in 18 samples. Obtained results showed that the optimized variant of real-time polymerase chain reaction based on 16S rRNA gene amplifi cation was a specifi c, sensitive, rapid, reproducible and accurate method for qualitative detection of Campylobacter spp. in samples of raw animal materials.

Abstract 1793: Optimal quantification of a circulating miRNA profile predictive for treatment response with droplet digital PCR in patients with multi-organ metastatic colorectal cancer

Abstract Introduction: Presence of microRNAs (miRNAs) in blood specimens hold promise for a predictive biomarker for treatment response in clinical practice as they are relatively resistant to degradation. Previously, we identified a six miRNA expression signature from tumor tissue that predicted response to first line systemic treatment in patients with metastatic colorectal cancer (mCRC) when combined with clinicopathological factors. The six miRNA expression signature consists of miR-17-5p, miR-20a-5p, miR-30a-5p, miR-92a-3p, miR-92b-3p and miR-98-5p. The aim of this study is to determine whether circulating levels of these miRNAs will be predictive for treatment outcome as well. Therefore we first studied whether these six miRNAs can be adequately measured in blood samples of patients with mCRC undergoing first line chemotherapy. Droplet digital PCR (ddPCR) technology was used for optimal quantification of miRNAs compared to normal quantitative PCR, because of low abundance of tumor specific miRNAs in blood. Methods: Serum samples of 120 patients with multi-organ mCRC who participated in a multi-center randomized controlled clinical trial were analyzed. RNA was isolated with miRNeasy Serum/Plasma Advanced Kit of Qiagen. Expression levels of the six miRNA expression signature was determined with ddPCR by using the miRCURY LNA miRNA PCR system combined with EvaGreen. Primer concentration and annealing temperature were first optimized per specific miRNA assay for ddPCR. RNA spike cel-miR-39-3p was used for quality control. Analysis was performed on samples with at least a minimal amount of 10.000 obtained droplets. Absolute quantification per patient is displayed as copies per µl (cop/µl) as defined by Quantasoft software. Results: In 120 blood samples miRNAs were measured by ddPCR. The most optimal primer concentrations for the different miRNAs was 0,5 µl for cel-miR-39-3p and 1,0 µl for the other 6 miRNAs. For cel-miR-39-3p, miR-17-5p, miR-20a-5p and miR-92a-3p the most efficient annealing temperature was 53 °C and for miR-30a-5p, miR-92b-3p and miR-98-5p this was 58 °C. The mean number of obtained droplets was 15.044 (SD 1922). The highest amount of detected copies were observed in miR-17-5p (644,4 cop/µl), miR-20a-5p (1037,1 cop/µl) and miR-92a-3p (1136,0 cop/µl). Lower expression levels were observed in miR-30a-5p (9,88 cop/µl), miR-92b-3p (1,6 cop/µl) and miR-98-5p (6,9 cop/µl). Conclusion: We demonstrated that with ddPCR absolute quantification of these six miRNAs in serum samples was efficient and reliable. Further analysis will reveal whether circulating miRNA expression levels can be used as a liquid biomarker for response to first line systemic treatment in patients with multi-organ mCRC. Citation Format: Lotte Bakkerus, Dennis Poel, Elske C. Gootjes, Cornelis Verhoef, Tineke E. Buffart, Hendrik M. Verheul. Optimal quantification of a circulating miRNA profile predictive for treatment response with droplet digital PCR in patients with multi-organ metastatic colorectal cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2019; 2019 Mar 29-Apr 3; Atlanta, GA. Philadelphia (PA): AACR; Cancer Res 2019;79(13 Suppl):Abstract nr 1793.

REAL-TIME PCR OPTIMIZATION FOR LISTERIA MONOCYTOGENES GENOME DETECTION

Listeria monocytogenes is one of the major food contaminants causing the illness, called Listeriosis. Listeriosis incidence is much less, than the number salmonellosis and campylobacteriosis cases, but the clinical disease is significantly more severe and has a higher mortality. That’s why the development of species-specific PCR techniques to detect L. monocytogenes genome is a topical task. L. monocytogenes bacteria genome detection technique using real-time polymerase chain reaction (qRT-PCR) was improved. The amplification target was a highly specific and suitable for qualification of all strains iap gen, coding L. monocytogenes р60 surface protein. Optimum magnesium concentration (6 mM) and primer annealing temperature (57 °С) were selected. The sensitivity and specificity of the technique were identified. Detection threshold was 120 target molecules. The results obtained demonstrate that optimized qRT-PCR version, based on iap gen amplification, enables to detect L. monocytogenes in animal product and food samples. Optimized qRT-PCR-based screening tests ensure rapid and reliable results.

Abstract 3900: Plasma ctDNA multigene mutation analysis for the diagnosis and treatment monitoring of colorectal cancer patients

Abstract Introduction Colorectal cancer is a highly preventable disease as early detection increases rates of patient survival to near 100%. Also during therapy colorectal tumors can develop resistance due to mutations in cellular growth factor receptor signaling pathway genes such as KRAS and BRAF. Herein we report new validation studies of a novel multigene mutation biomarker real-time PCR based assay for qualitative detection of colorectal cancer associated mutations including the tumor suppressor APC, growth factor signaling pathway genes KRAS and BRAF and the essential WNT pathway signaling gene Beta- catenin (CTNNB1) called ColoScapeTM .The assay allows the sensitive detection of the presence or absence of mutations in the targeted regions of the genes interrogated. While tumor-tissue remains the ‘gold standard' for genetic analysis in cancer patients, it is challenged with the advent of circulating cell-free tumor DNA (ctDNA) analysis from blood samples; so called 'liquid biopsy'. Here we broaden our previous study on the initial validation of FFPE samples to include plasma DNA in colorectal cancer patients and by evaluating its clinical utility as a method for monitoring tumor ctDNA mutations during and after therapy as well as a potential screening test for early diagnosis of colorectal cancer. Methodology he high sensitivity of this multigene biomarker assay is achieved due to xenonucleic acid (XNA) probe technology. XNA probes are novel backbone modified oligomers having natural nucleoside bases (A,T,C and G) that hybridize by Watson-Crick base pairing to natural DNA and RNA with much higher binding affinity than natural deoxyribonucleic acid oligomers of the same sequence. XNA probes are designed that bind to the selected wild-type sequences at the respective genetic loci in the target genes. These XNA probes have a much higher Tm than the primer annealing temperature and suppress amplification of WT DNA templates and only allow amplification of the target mutant DNA templates in the sample. Both single nucleotide polymorphisms (SNP's) and insertion/deletions (indels) mutations can be detected. Performance parameters of the assay were established on DNA of colorectal cancer patients extracted from FFPE as well as reference DNA materials (synthetic and cell line derived DNA). This study presents further validation of the test as a potential landmark clinical test for colorectal cancer initial detection in FIT posiive patients and for recurrence and therapy monitoring Conclusion: The ColoScapeTM Colorectal Cancer Mutation Detection assay is shown to be a sensitive tool intended to facilitate research in Colon Cancer development, early detection, disease monitoring and therapeutic interventions. Citation Format: Michael J. Powell, Elena Peletskaya, Qing Sun, Jinwei Du, Larry Pastor, Jyoti Phatak, Jenny Wilding, Walter F. Bodmer, Aiguo Zhang. Plasma ctDNA multigene mutation analysis for the diagnosis and treatment monitoring of colorectal cancer patients [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 3900.

ANALYSIS OF POLYMORPHISM IN MUCIN 4 GENE ASSOCIATED WITH ANIMAL RESISTANCE TO COLIBACTERIOSIS IN PIGS OF DOMESTIC AND FOREIGN SELECTIONS

Nowadays one of the most common and critical problem in pig breeding is colibacteriosis. This infectious disease has acute course and it is caused by enteropathogenic strains of bacteria Escherichia coli. One of the recent and effective approaches to prevent colibacteriosis is using markers of selection; it involves pig genotyping by genome loci. The chosen loci are associated with animal sensitivity to the disease and selection of animals with increased resistance by the results of genotyping. According to several researches, one of such loci is Mucin 4 (MUC4) gene. MUC4 gene is located in the13-th chromosome (SSC13q41). Mucins (MUC) are macromolecular glycoproteins synthesized by goblet enterocytes and play main role in protecting the intestinal epithelium from pathogens, including adhesive strains of Escherichia coli. As a result of spot replacement g.1849 G>С in intron 7, structure of mucin protein encoded by gene is changing which leads to changes in the sensitivity of the intestinal mucosa to pathogenic Escherichia coli. G allele and respectively GG genotype determine the resistance of animals to colibacteriosis, while СС і GС genotypes are susceptible to this disease. In Ukraine, the studies of polymorphism MUC4 g.1849 G> C were held fragmentally and only at certain populations of Ukrainian Meat and Large White. The aim of the work was to determine the genetic structure of pig breeds of domestic and foreign selection for MUC4 gene and to establish the possibility of organizing marker associated selection for genetic improvement of resistance to colibacteriosis. For research the samples of blood and hair were used from the animals of Large White of English selection, Large White of Ukrainian selection Type 1 and Type 3, Red White-Belt, Mirgorod, Poltava Meat and Landrace breeds. DNA isolation from the samples of biomaterial were carried out using ion exchange resin Chelex-100. Genotyping was performed by PCR-RFLP by Jorgensen methods (2006) with own modifications, concerning the selection of primer annealing temperature and optimum concentration of the gel to separate the restriction fragments. Genetic structure was determined using DNA analysis of MUC4 locus at seven breeds and intrabreed types. Predominance of potentially beneficial G allele frequency over undesirable C allele was established in all the populations of the studied pigs. The highest frequencies of G allele were characterized for Mirgorod (0.795), Poltava Meat (0.740) and Red White-Belt (0.820) breeds. Analysis of the distribution of genotypes showed domination of genotypes GG and GC in all analysed populations. Positive Wright fixation index and predominance of expected heterozygosity (0.484) over actual one (0.460) for Large White of Ukrainian selection Type 3 indicate the existence of moderate inbreeding and selective pressure in this herd. Other populations were characterized by a negative value of fixation index, which is indicative of an excess of heterozygotes, these breeds are in outbreeding depression. Statically significant deviation of actual frequencies of genotypes from expected ones was identified using Hardy-Weinberg criterion for pig population of Large White of English selection and Large White of Ukrainian selection Type 1. This may indicate that these populations aren’t in condition of equilibrium and about inclusion of the chosen gene to the selection process. The valuation was performed by calculating the PIC (polymorphic information content) of the marker. Based on the calculated PIC index MUC4 locus could be perspective to be used in marker associated selection with improving genetic resistance to colibacteriosis. The data of Mucin 4 gene polymorphism at Ukrainian pig populations of different origins and productive direction show the possibility of marker selection to improve the genetic resistance of animals to colibacteriosis regardless of their belonging to breed. This creates prerequisites for the establishment and implementation of the early molecular diagnosis of carriers of harmful C allele in MUC4 gene in pig breeding.

A Novel Multiplex PCR-RFLP Method for Simultaneous Genotyping of CYP3A4*4 A>G, CYP3A4*18B G>A and CYP3A4*22 C>T.

BackgroundCytochrome P450 3A enzymes exhibit a variety of physiological roles and have been reported to be the most predominant enzymes involved in drugs metabolism. Single nucleotide polymorphisms (SNPs) in the genes that code for these enzymes may result in functional changes that affect enzyme activity. CYP3A4 is an important enzyme in the metabolism of many important drugs used in the treatment of breast cancer.MethodsA total of 94 post-menopausal breast cancer patients were recruited for the study and their DNA was isolated for polymerase chain reaction (PCR). The primers were designed using Primer3 software with primer specificities checked via the Basic Local Alignment Tool (BLAST) database. The primer specificity, functionality and annealing temperature were first investigated using uniplex PCR protocols, followed by a single multiplex polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The digested amplification fragments were analysed by gel electrophoresis and subsequently validated by sequencing.ResultsA multiplex PCR-RFLP method was successfully developed for simultaneous detection of CYP3A4*4, CYP3A4*18B and CYP3A4*22 in a population of post-menopausal breast cancer patients.ConclusionThe technique is simple, cost-effective, time-saving and can be routinely applied in the identification of SNPs and determination of allelic and genotypic frequencies of CYP3A4*4, CYP3A4*18B and CYP3A4*22.