Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Abstract

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.