Previous Note Research Articles

Educational technology on palliative care for nursing undergraduates: previous note

Educational technology on palliative care for nursing undergraduates: previous note

EchoGen: A New Benchmark Study on Generating Conclusions from Echocardiogram Notes.

Generating a summary from findings has been recently explored (Zhang et al., 2018, 2020) in note types such as radiology reports that typically have short length. In this work, we focus on echocardiogram notes that is longer and more complex compared to previous note types. We formally define the task of echocardiography conclusion generation (EchoGen) as generating a conclusion given the findings section, with emphasis on key cardiac findings. To promote the development of EchoGen methods, we present a new benchmark, which consists of two datasets collected from two hospitals. We further compare both standard and state-of-the-art methods on this new benchmark, with an emphasis on factual consistency. To accomplish this, we develop a tool to automatically extract concept-attribute tuples from the text. We then propose an evaluation metric, FactComp, to compare concept-attribute tuples between the human reference and generated conclusions. Both automatic and human evaluations show that there is still a significant gap between human-written and machine-generated conclusions on echo reports in terms of factuality and overall quality.

Increased potential for shell competition among hermit crabs (Pagurus beringanus and Pagurus granosimanus) in the rocky intertidal

AbstractWe examined the prevalence and shell use of two species of hermit crabs (Pagurus granosimanus and Pagurus beringanus) in exposed and protected microhabitats at five sites in the rocky temperate intertidal on San Juan Island, Washington, to compare present habitat partitioning and potential interspecific competition to that reported nearly 50 years ago. We found that, in contrast to previous findings, the two species of hermit crabs overlapped extensively at some sites, typically those with less wave action. While the hermit crabs typically inhabited certain types of shells significantly more than others, and that use was congruent across microhabitats and species of hermit crabs at the same site, the dominant domicile differed substantially across sites. We provide a more complete ranking of shell use than previous authors and note site-specific dominant shell use. We conclude that previous habitat partitioning by depth may have weakened at protected sites. We hypothesize that increasing temperatures have caused P. granosimanus to expand its range deeper into the intertidal, which may increase the degree of interspecific competition for shells at the edge of the species’ tidal height range, where they overlap. Whether the habitat shift by this hermit crab is due to recent alterations in climate (particularly elevated temperatures, ocean acidification and lower local open ocean salinity) is unknown, but warrants further study.

Noncollapsibility, confounding, and sparse-data bias. Part 2: What should researchers make of persistent controversies about the odds ratio?

A previous note illustrated how the odds of an outcome have an undesirable property for risk summarization and communication: Noncollapsibility, defined as a failure of a group measure to represent a simple average of the measure over individuals or subgroups. The present sequel discusses how odds ratios amplify odds noncollapsibility and provides a basic numeric illustration of how noncollapsibility differs from confounding of effects (with which it is often confused). It also draws a connection of noncollapsibility to sparse-data bias in logistic, log-linear, and proportional-hazards regression.

First Report of Cucurbit Chlorotic Yellows Virus from Cucumber Plants Affected by Interveinal Yellowing Disease in Jordan

First Report of Cucurbit Chlorotic Yellows Virus from Cucumber Plants Affected by Interveinal Yellowing Disease in Jordan

Revista Agrária Acadêmica – métricas do periódico entre os anos de 2018 e 2020

The Agrarian Academic Journal®, founded in 2018, is an open access bimonthly international journal aimed at publishing original and unpublished technical-scientific works in the areas of Sustainable Development, Agronomy, Veterinary Medicine, Animal Science, Food Science and Technology, Forestry Engineering, Environmental Engineering, Fishing Engineering, Aquaculture and related areas. The main objective of this work is to describe the metrics obtained by the journal between 2018 and 2020. During this period, 265 peer-reviewed articles were published, which were verified regarding the thematic area, origin and title of the authors, as well as the language and the type of publication (Review Articles, Scientific Articles, Continuing Education, Case Reports, Previous Note and Communication). In the end, it was also possible to list highlighted authors and institutions, in addition to planning strategies for the constant improvement of the journal.

Rethinking Mistake in the Age of Algorithms (Blog Post)

In our previous note: Cryptocurrencies and Code before the Courts ((2019) 30(3) King’s Law Journal 331 - 337), we discussed the Singapore International Commercial Court (High Court)’s decision in B2C2 Ltd v Quoine Pte Ltd. The case subsequently went on appeal, and the Singapore International Commercial Court (Court of Appeal), by a majority, affirmed the decision of the lower court in Quoine v B2C2 (“Quoine”). The case of Quoine represents the first time an apex court in the Commonwealth has ruled on the applicability of contractual principles to situations involving automated trading software. In our recent case note: Rethinking Mistake in the Age of Algorithms (forthcoming in the King’s Law Journal), we examine the decision in Quoine and argue that given that finding actual or constructive knowledge of an error necessary to invoke the doctrine of unilateral mistake may well be impossible in cases involving contracts formed by certain types of automated software, the approach set out by Lord Mance, who penned the dissenting judgment, may provide a viable solution.

Fluctuations of the magnetization for Ising models on Erdős–Rényi random graphs—the regimes of small p and the critical temperature * * The research of the first two authors was funded by the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation) under Germany’s Excellence Strategy EXC 2044-390685587, Mathematics Münster: dynamics–geometry–structure. The third author has been supported by the German Research Foundation (DFG) via

We continue our analysis of Ising models on the (directed) Erdős–Rényi random graph. This graph is constructed on N vertices and every edge has probability p to be present. These models were introduced and first studied by Bovier and Gayrard (1993 J. Stat. Phys. 72 643–64) and further analyzed by the authors in a previous note, in which we consider the case of p = p(N) satisfying p 3 N 2 → ∞ and β < 1. In the current note we prove a quenched central limit theorem for the magnetization for p satisfying pN → ∞ in the high-temperature regime β < 1. We also show a non-standard central limit theorem for p 4 N 3 → ∞ at the critical temperature β = 1. For p 4 N 3 → 0 we obtain a Gaussian limiting distribution for the magnetization. Finally, in the critical regime p 4 N 3 → c the limiting distribution for the magnetization contains a Gaussian component as well as a -term. Hence, at β = 1 we observe a phase transition in p for the fluctuations of the magnetization.

Boundary Behavior of Rotationally Symmetric Prescribed Mean Curvature Hypersurfaces in $$\pmb {\varvec{{\mathbb {R}}}}^{4}$$

In a domain $$\Omega \subset {\mathbb {R}}^{n}$$ whose boundary is smooth except on a set $${\mathcal {C}}$$ of codimension (in $$\partial \Omega $$ ) k, the behavior of a nonparametric prescribed mean curvature hypersurface $$z=f\left( \mathbf{x}\right) $$ in the vertical cylinder $$\Omega \times {\mathbb {R}}$$ at a point $${\mathcal {O}}\in {\mathcal {C}}$$ can be largely unknown when $$n\ge 3,$$ depending on the type of boundary condition f satisfies. In a previous note, the authors considered an example in which $$n=3$$ and $$k=2;$$ that is, when $${\mathcal {C}}$$ is a (nonconvex) conical point on $$\partial \Omega .$$ Here, we consider prescribed mean curvature boundary value problems which are rotationally symmetric and investigate the behavior of variational solutions near a point $$P\in {\mathcal {C}}$$ when $$n=3$$ and $$k=1.$$

First Report of Basella alba Naturally Infected with Basella Rugose Mosaic Virus in Hawaii

Basella alba, also known as Malabar spinach, is a plant belonging to the family Basellaceae. It is native to tropical Asia and Africa and introduced to Hawaii, where it is grown as a vegetable crop (Wester 1992). Basella rugose mosaic virus (BaRMV) is a potyvirus that was first isolated from B. alba and reported in December 2006 in Taiwan (Zheng et al. 2008). In December 2018, B. alba plants with leaves exhibiting mosaic and rugose symptoms were found growing in a community garden consisting of about 150 small gardens 10 m² in size on Oahu, Hawaii (21°17′05″ N, 157°49′40″ W). Five leaf samples with severe mosaic and rugose symptoms from five different B. alba plants in five different small gardens in the same community garden were tested by ELISA using potyvirus-specific antibodies (Agdia, Elkhart, IN) (Wang et al. 2019). All symptomatic leaf samples tested positive for potyvirus infection by the ELISA test. Total RNAs were extracted from these samples and tested by reverse transcription PCR (RT-PCR) using the universal primer pair CIFor and CIRev designed to amplify the cylindrical inclusion protein (CI) gene from the genomes of potyviruses (Ha et al. 2008). To identify the specific potyvirus infecting the B. alba samples, amplicons of approximately 600 bp corresponding to the targeted potyviral CI region were directly sequenced (MN075828). BLAST analysis of the 564-bp sequences showed that this virus isolate respectively shared 97 and 95% nucleotide and amino acid sequence identities with the homologous sequences of a peace lily mosaic virus (PeLMV) isolate from Vietnam (DQ851494/ABI34613). PeLMV was first reported infecting peace lily (Spathiphyllum patinii, family Araceae) in Vietnam in 2008 (Ha et al. 2008). Because the Vietnam isolate of PeLMV (DQ851494/ABI34613) respectively shared 83 and 92% nucleotide and amino acid sequence identities to an isolate of BaRMV (DQ821939/ABH10135), PeLMV is considered a strain of BaRMV (Wylie et al. 2017). However, our Hawaii isolate (MN075828) of BaRMV only shared 83 and 94% nucleotide and amino acid sequence identities, respectively, with the isolate of BaRMV (DQ821939/ABH10135). We then designed new BaRMV CI gene-specific primers B-CIF (5′-TCAGTTTTTGGTTCGACGCC-3′) and B-CIR (5′-GATTTCCGTTGCACCCGACT-3′) from the BaRMV-specific sequence (MN075828) to further characterize the viral isolate from B. alba. BLASTn analysis of the 389-bp sequence of the CI fragment amplicon (MN075829) indicated that it shared 98% nucleotide sequence identity with the same isolate from Vietnam (DQ851494), whereas BLASTx analysis showed that the CI amplicon shared 96% amino acid sequence identity with the corresponding amino acid region of the same isolate from Vietnam (ABI34613). The CI fragment amplicon (MN075829) also revealed 83 and 95% nucleotide and amino acid sequence identities, respectively, to the Taiwan isolate of BaRMV (DQ821939/ABH10135). Our sequence comparison results indicated that our Hawaii isolate was more closely related to the Vietnamese BaRMV isolate initially identified as PeLMV than to the Taiwan isolate of BaRMV. The primer set B-CIF and B-CIR was further used in RT-PCR reactions to determine infection by BaRMV in nine additional symptomatic samples of B. alba based on amplification of DNA fragments of the expected size. We have also used RT-PCR to test 20 more samples from this community garden; our results show that two asymptomatic samples were negative and 18 symptomatic samples were positive. Therefore, the disease incidence of BaRMV on B. alba was approximately 92%. To our knowledge, this is the first report of BaRMV infecting B. alba plants in the United States. Further studies to obtain information on the full-length genome sequence, insect vector(s), and geographic distribution of this BaRMV isolate are necessary to help control BaRMV infection in B. alba and other vegetables among Hawaii’s community and family gardens.

Intégrales orbitales semi-simples et centre de l'algèbre enveloppante

In a previous Note, the first author has established an explicit local formula for semi-simple orbital integrals associated with the Casimir. In this Note, we extend the formula to all elements of the center of the Lie algebra.

How to Clean Academic TRACE Data

This note updates the filter from the previous note How to clean Enhanced TRACE data to handle the Academic TRACE data. The Academic TRACE include masked dealer identifiers and allow for improved handling of inter-dealer transactions. We include SAS code for the new filter in the appendix.

SISTEM INFORMASI PENGELOLAAN DATA LAUNDRY PADA RUMAH LAUNDRY BEKASI

Laundry house is a business engaged in services in washing and drying, especially clothing. To serve the public in the field of laundry services, the laundry house in managing the data is still done manually and has not been computerized so there are still errors in the transaction process. Problems that occur in a laundry house such as incorrectly recording the type of package, the calculation is still using a calculator tool, in making the report must see the notes that have been collected previously, must see previous records recorded in the ledger, and be vulnerable to losing previous note notes so that it takes a long time and the results obtained are less accurate. The purpose of this study is to build a laundry data management program using the waterfall method which consists of 5 stages, namely, software requirements analysis, design, programming code, testing and support or maintenance. While the data collection is through observation, interviews and searching for literature related to this research so that it can solve problems related to laundry data management activities, especially in the process of receiving laundry services transactions to be more effective and efficient and can improve service to customers. The results of the study show that this laundry data management program can help and simplify the process of receiving laundry services at the laundry house.

Note on Multi-Sectoral Growth and Sustainability Pricing in a Leontief-Type Model with Technical Progress

Here I reconsider a previous note of mine (D’Adda Econ J 1:1–4, 2016), focused on a Leontief-type sectoral growth model, to explore problems of pricing, income distribution and capital ownership, starting from explicit attention to technical progress.

A Quant Perspective on IBOR Fallback Consultation Results

With the increased expectation of some IBORs discontinuation and the increasing regulatory requirements related to benchmarks, a more robust fallback provision for benchmark-linked derivatives is becoming paramount for the interest rate market. Several options for such a fallback have been proposed and ISDA held a consultation on some of them. The results of the ISDA consultation has been to privilege the compounding setting in arrears option. This note, which can be viewed as the version 2.0 of a previous note, presents the different options briefly and analyses the privileged option in details. It also presents an alternative option supported by different working groups. The note's focus is on the quantitative finance impacts for derivatives. To our opinion, the option selected by the consultation fails the basic achievability criterion in many cases. Even when achievable, the option can lead to significant value transfer and risk management complexities.

Occurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in India

HomePlant DiseaseVol. 102, No. 8Occurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in India Previous DISEASE NOTES OPENOpen Access licenseOccurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in IndiaC. Senthilraja, P. Renukadevi, V. G. Malathi, S. Nakkeeran, and H. R. PappuC. SenthilrajaSearch for more papers by this author, P. Renukadevi†Corresponding author: P. Renukadevi; E-mail: E-mail Address: renucbe88@gmail.comhttp://orcid.org/0000-0001-9665-1681Search for more papers by this author, V. G. MalathiSearch for more papers by this author, S. NakkeeranSearch for more papers by this author, and H. R. PappuSearch for more papers by this authorAffiliationsAuthors and Affiliations C. Senthilraja P. Renukadevi † V. G. Malathi S. Nakkeeran , Department of Plant Pathology, Centre for Plant Protection Studies, Tamil Nadu Agricultural University, Coimbatore-03 H. R. Pappu , Washington State University, Department of Plant Pathology, Pullman. Published Online:19 Jun 2018https://doi.org/10.1094/PDIS-02-18-0250-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Snapdragon (Antirrhinum majus L.) is an important ornamental plant grown all over the world. A recent survey in the Nilgiris district of Tamil Nadu (India) indicated that snapdragon plants exhibited typical symptoms of tospovirus infection, including severe chlorotic and necrotic rings in leaves accompanied with stunting. Ten symptomatic plant samples were collected from Kotagiri and subjected to serological detection of tomato spotted wilt virus (TSWV) with a triple antibody sandwich ELISA kit (DSMZ, Germany). All the suspected symptomatic plants were positive for TSWV. For bioassay studies, one representative sample was collected, and the virus was mechanically transmitted through sap inoculation using 0.1 M phosphate buffer (pH 7.0) into nine different indicator host plants. Among them, Vigna unguiculata (cultivar CO7) and Physalis peruviana exhibited localized, chlorotic spots, which later turned necrotic. Other indicator hosts, including Datura metal, D. stramonium, Nicotiana glutinosa, N. tabacum, Impatiens balsamiana, Gomphrina globosa, and Solanum lycopersicum (tv. PKM1), exhibited local as well as systemic symptomic necrotic rings on the leaves, followed by wilting of the inoculated plants. Symptoms exhibited by all the assay hosts resembled those of TSWV infection (Parrella et al. 2003; Renukadevi et al. 2015; Salem et al. 2012). Electron microscopic observation of plant sap from a symptomatic leaf on a snapdragon plant revealed the presence of spherical virion particles of TSWV (80 to 100 nm in diameter) (Pappu et al. 2009). Further, the tospovirus nucleocapsid gene was amplified with specific primers (N-F-5′-CAAGCAATAAAGATAAAGAAAGC-3′; N-R-5′-AGCATATAACAACTTCTACGATC-3′) through reverse transcription PCR for three symptomatic leaf samples. One representative amplicon of 850 bp was cloned, sequenced, and submitted to the NCBI GenBank database under the accession number MG191200. The sequence of nucleocapsid gene shared maximum identity of 99% with other TSWV isolates, reported in different hosts, from various countries (India, KJ494928; Korea, HQ267713; France, FR693048). All these results clearly illustrate the infection of A. majus by tomato spotted wilt virus. In India, TSWV was reported for the first time as a new pathogen, infecting chrysanthemum in Nilgiris, Tamil Nadu (Renukadevi et al. 2015). Our study is the first report of TSWV infecting a new host, snapdragon (A. majus). This is suggestive of the spread and host-range extension of TSWV into different crop plants in India, which needs further investigation.

Note: Additionally refined new possibilities of plasma probe diagnostics.

In two previous Notes published in this journal, a method of measuring probe sheath thickness and ion mass was described using Langmuir probe diagnostics in low pressure xenon plasma close to Maxwellian substance. According to the first Note, this method includes two stages: (i) in a special experiment with known ion mass, the Bohm and Child-Langmuir-Boguslavsky (CLB) equations for cylindrical Langmuir probes used in this xenon plasma were solved jointly to determine the probe sheath thicknesses and Bohm coefficient CBCyl ≈ 1.13; and (ii) in a general experiment, with known CBCyl, the same equations could be solved to obtain the probe sheath thicknesses and the mean ion mass. In the second Note, the (i) stage of this method was refined: the results of the CLB probe sheath model application, which were termed "evaluations," were corrected using the step-front probe sheath model, which was closer to reality in the special experiment with the xenon plasma. This process resulted in a Bohm coefficient of CBCyl ≈ 1.23 for the cylindrical probe. In the present Note, corrected xenon plasma parameters without the influence of the bare probe protective shield were used for the (i) stage of this diagnostic method. This action also refined the Bohm coefficient, lowering it to CBCyl ≈ 0.745 for cylindrical probes. This advance makes the new diagnostics method more objective and reliable.

First Report of Melon necrotic spot virus in Melon Plantations in Brazil

HomePlant DiseaseVol. 102, No. 5First Report of Melon necrotic spot virus in Melon Plantations in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Melon necrotic spot virus in Melon Plantations in BrazilM. C. F. Moura, I. S. A. Holanda, R. Sales Júnior, A. P. O. Queiroz, E. O. A. Araújo, G. D. C. Oliveira, G. H. S. Nunes, T. Nagata, and A. M. P. NegreirosM. C. F. MouraSearch for more papers by this author, I. S. A. Holanda†Corresponding author: I. S. A. Holanda; E-mail: E-mail Address: [email protected]Search for more papers by this author, R. Sales JúniorSearch for more papers by this author, A. P. O. QueirozSearch for more papers by this author, E. O. A. AraújoSearch for more papers by this author, G. D. C. OliveiraSearch for more papers by this author, G. H. S. NunesSearch for more papers by this author, T. NagataSearch for more papers by this author, and A. M. P. NegreirosSearch for more papers by this authorAffiliationsAuthors and Affiliations M. C. F. Moura I. S. A. Holanda † R. Sales Júnior A. P. O. Queiroz E. O. A. Araújo G. D. C. Oliveira G. H. S. Nunes , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil T. Nagata , Department of Cellular Biology, University of Brasília, 70910-900, DF, Brazil A. M. P. Negreiros , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil. Published Online:6 Mar 2018https://doi.org/10.1094/PDIS-09-17-1391-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Melon necrotic spot virus (MNSV) is a carmovirus that causes necrotic spots on melon plants and is transmitted by fungi of the genus Olpidium. In Brazil, the major melon fields are located in the states of Rio Grande do Norte (RN) and Ceará (CE). Different types of virus-like symptoms (necrotic streaks at the base of the stem and vine decline) were observed in commercial fields and infection by MNSV was suspected by symptomatology. To determine the presence of MNSV, soil samples were collected from 10 commercial fields with MNSV-like symptoms from both states in 2012. These samples were processed at the Plant Pathology Laboratory of the Federal Rural University of the Semiarid (UFERSA), Mossoró, RN. The soil samples were placed in plastic trays, and exposed in open air for a week to dry. Then, soil samples were sieved and subsequently used for planting yellow-skin melon (cv. Goldex, a major cultivar in the region). Seeds were pretreated at 70°C for 144 h with a photoperiod of 16 h and relative humidity of approximately 15% (Herrera-Vásquez et al. 2009). The seeds were placed in a Petri dish to germinate, with filter paper and distilled-autoclaved water. Seedlings were planted in a plastic pot containing a mixture of the collected soils in addition to autoclaved sand (1:10 soil/sand ratio). These plants were maintained for 30 days in the greenhouse, with temperature ranging from 25 to 30°C and relative humidity of 60%. RT-PCR for the detection of MNSV was performed using specific primers (MNSV3F - CAGGGAAATCCTAGAATACAG and MNSV4R - ATTAATGCGTCTAACCATCG) (Herrera-Vásquez et al. 2010). Although the seedlings did not present any symptoms of MNSV, RT-PCR confirmed the presence of MNSV in five out of 30 samples in three out of 10 commercial melon fields. For further confirmation, cDNA fragments of five samples amplified by RT-PCR were directly sequenced by the Sanger method and the amplified 7A/7B protein genomic region of 385 nt showed 100% identity among the five samples used (deposited under accession no. LC318764). The obtained sequence showed the highest identity of 97% with a Spanish MNSV isolate (FJ621526). Therefore, soils collected in the states of RN (two samples) and CE (three samples), Brazil, analyzed in this study, showed the presence of MNSV. This is the first report of the occurrence of MNSV in Brazil.

Differences of Alexander polynomials for knots caused by a single crossing change, II

In the previous note, Okada and the author gave an approach to give a characterization of Alexander polynomials for knots which are transformed by a single crossing change into a given knot whose Alexander polynomial is monic. In this note, we give a characterization in the case of [Formula: see text], and show that the Gordian distance of [Formula: see text] and [Formula: see text] is two. We also give a characterization in the cases of more three knots.

Well-posedness for multi-dimensional junction problems with Kirchoff-type conditions

We consider multi-dimensional junction problems for first- and second-order pde with Kirchoff-type Neumann boundary conditions and we show that their generalized viscosity solutions are unique. It follows that any viscosity-type approximation of the junction problem converges to a unique limit. The results here are the first of this kind and extend previous work by the authors for one-dimensional junctions. The proofs are based on a careful analysis of the behavior of the viscosity solutions near the junction, including a blow-up argument that reduces the general problem to a one-dimensional one. As in our previous note, no convexity assumptions and control theoretic interpretation of the solutions are needed.