First Report of Melon necrotic spot virus in Melon Plantations in Brazil

Abstract

HomePlant DiseaseVol. 102, No. 5First Report of Melon necrotic spot virus in Melon Plantations in Brazil Previous DISEASE NOTES OPENOpen Access licenseFirst Report of Melon necrotic spot virus in Melon Plantations in BrazilM. C. F. Moura, I. S. A. Holanda, R. Sales Júnior, A. P. O. Queiroz, E. O. A. Araújo, G. D. C. Oliveira, G. H. S. Nunes, T. Nagata, and A. M. P. NegreirosM. C. F. MouraSearch for more papers by this author, I. S. A. Holanda†Corresponding author: I. S. A. Holanda; E-mail: E-mail Address: [email protected]Search for more papers by this author, R. Sales JúniorSearch for more papers by this author, A. P. O. QueirozSearch for more papers by this author, E. O. A. AraújoSearch for more papers by this author, G. D. C. OliveiraSearch for more papers by this author, G. H. S. NunesSearch for more papers by this author, T. NagataSearch for more papers by this author, and A. M. P. NegreirosSearch for more papers by this authorAffiliationsAuthors and Affiliations M. C. F. Moura I. S. A. Holanda † R. Sales Júnior A. P. O. Queiroz E. O. A. Araújo G. D. C. Oliveira G. H. S. Nunes , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil T. Nagata , Department of Cellular Biology, University of Brasília, 70910-900, DF, Brazil A. M. P. Negreiros , Department Plant Science, Federal Rural University of the Semiarid/UFERSA, Mossoró, 59600-970, Rio Grande do Norte, Brazil. Published Online:6 Mar 2018https://doi.org/10.1094/PDIS-09-17-1391-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Melon necrotic spot virus (MNSV) is a carmovirus that causes necrotic spots on melon plants and is transmitted by fungi of the genus Olpidium. In Brazil, the major melon fields are located in the states of Rio Grande do Norte (RN) and Ceará (CE). Different types of virus-like symptoms (necrotic streaks at the base of the stem and vine decline) were observed in commercial fields and infection by MNSV was suspected by symptomatology. To determine the presence of MNSV, soil samples were collected from 10 commercial fields with MNSV-like symptoms from both states in 2012. These samples were processed at the Plant Pathology Laboratory of the Federal Rural University of the Semiarid (UFERSA), Mossoró, RN. The soil samples were placed in plastic trays, and exposed in open air for a week to dry. Then, soil samples were sieved and subsequently used for planting yellow-skin melon (cv. Goldex, a major cultivar in the region). Seeds were pretreated at 70°C for 144 h with a photoperiod of 16 h and relative humidity of approximately 15% (Herrera-Vásquez et al. 2009). The seeds were placed in a Petri dish to germinate, with filter paper and distilled-autoclaved water. Seedlings were planted in a plastic pot containing a mixture of the collected soils in addition to autoclaved sand (1:10 soil/sand ratio). These plants were maintained for 30 days in the greenhouse, with temperature ranging from 25 to 30°C and relative humidity of 60%. RT-PCR for the detection of MNSV was performed using specific primers (MNSV3F - CAGGGAAATCCTAGAATACAG and MNSV4R - ATTAATGCGTCTAACCATCG) (Herrera-Vásquez et al. 2010). Although the seedlings did not present any symptoms of MNSV, RT-PCR confirmed the presence of MNSV in five out of 30 samples in three out of 10 commercial melon fields. For further confirmation, cDNA fragments of five samples amplified by RT-PCR were directly sequenced by the Sanger method and the amplified 7A/7B protein genomic region of 385 nt showed 100% identity among the five samples used (deposited under accession no. LC318764). The obtained sequence showed the highest identity of 97% with a Spanish MNSV isolate (FJ621526). Therefore, soils collected in the states of RN (two samples) and CE (three samples), Brazil, analyzed in this study, showed the presence of MNSV. This is the first report of the occurrence of MNSV in Brazil.