Pilus Operon Research Articles

DNA Processing Proteins Involved in the UV-Induced Stress Response of Sulfolobales.

The ups operon of Sulfolobus species is highly induced upon UV stress. Previous studies showed that the pili encoded by this operon are involved in cellular aggregation, which is essential for subsequent DNA exchange between cells, resulting in homologous recombination. The presence of this pilus system increases the fitness of Sulfolobus cells under UV light-induced stress conditions, as the transfer of DNA takes place in order to repair UV-induced DNA lesions via homologous recombination. Four conserved genes (saci_1497 to saci_1500) which encode proteins with putative DNA processing functions are present downstream of the ups operon. In this study, we show that after UV treatment the cellular aggregation of strains with saci_1497, saci_1498, and saci_1500 deletions is similar to that of wild-type strains; their survival rates, however, were reduced and similar to or lower than those of the pilus deletion strains, which could not aggregate anymore. DNA recombination assays indicated that saci_1498, encoding a ParB-like protein, plays an important role in DNA transfer. Moreover, biochemical analysis showed that the endonuclease III encoded by saci_1497 nicks UV-damaged DNA. In addition, RecQ-like helicase Saci_1500 is able to unwind homologous recombination intermediates, such as Holliday junctions. Interestingly, a saci_1500 deletion mutant was more sensitive to UV light but not to the replication-stalling agents hydroxyurea and methyl methanesulfonate, suggesting that Saci_1500 functions specifically in the UV damage pathway. Together these results suggest a role of Saci_1497 to Saci_1500 in the repair or transfer of DNA that takes place after UV-induced damage to the genomic DNA of Sulfolobus acidocaldarius. Sulfolobales species increase their fitness after UV stress by a UV-inducible pilus system that enables high rates of DNA exchange between cells. Downstream of the pilus operon, three genes that seem to play a role in the repair or transfer of the DNA between Sulfolobus cells were identified, and their possible functions are discussed. Next to the previously described role of UV-inducible pili in the exchange of DNA, we have thereby increased our knowledge of DNA transfer at the level of DNA processing. This paper therefore contributes to the overall understanding of the DNA exchange mechanism among Sulfolobales cells.

Detection of Some Virulence Factors and Pyelonephritis - Associated Pilus ( Pap ) Encoding Operon Gene in Uropathogenic Escherichia Coli

Background: Urinary tract infection is one of the most common bacterial infections caused by E.coli that have virulence properties including the expression of specific adhesions, toxins such as haemolysin , also the serum resistance, gelatinase production and The P fimbriae which considered an essential virulence factor causing pyelonephritis and encoded by The pyelonephritis-associated pilus (pap) operon. Objectives: This work aimed to detect the association of some virulence factors of uropathogenic Escherichia coli (UPEC) strains: cell surface hydrophobicity, haemolysin production, serum resistance, gelatinase production, extended spectrum f lactamase production and pap adhesion encoding operon gene which is responsible for adhesion of E.coli to uroepithelium. Methodology: This work was carried out on 80 patients (27males and 53 females, their ages ranged from 15 to 60 years old) attending the Outpatient Clinic of Urology Department of Benha University Hospital suffering from urinary tract infection (UTI). 80 Urine samples (patients group) and 20 stool samples (control group) were subjected for isolation and identification of UPEC and commensal E.coli respectively. Antibiogram by disc diffusion method, detection of some virulence factors and pap gene by PCR were done for all isolated E.coli strains. Results: UPEC was the most common isolated bacteria 50(62.5%). 33 (66%) of UPEC strains show resistance to ampicillin (10 pg), 45 (90%) of UPEC strains show sensitivity to amikacin (30 pg). In commensal E.coli strains: 12(60%) strains show resistance to ampicillin(10 pg) while 20 (100%) strains were sensitivity to gentamycin (10 pg). 23 (46%) of UPEC strains were hydrophobic, 12 (24%) strains were haemolysin producers, 31 (62%) strains were serum resistant, 1(2%) strain liquefied gelatin and 26 (52%)strains were extended spectrum f lactamase production (ESBL).In commensal E.coli strains: 9 (45%) strains were hydrophobic, 3 (15%) strains were haemolysin producers, 11 (55%) strains were serum resistant, no (0%) strain liquefied gelatin and 8 (40%)strains were ESBL. In UPEC; 36(72%) strains had PAP gene while 12(60 %) strains of commensal E.coli had PAP gene. Conclusion: It can be concluded that pap gene plays an important role in virulence of UPEC

Streptococcus gallolyticus Pil3 Pilus Is Required for Adhesion to Colonic Mucus and for Colonization of Mouse Distal Colon.

Streptococcus gallolyticus is an increasing cause of bacteremia and infective endocarditis in the elderly. Several epidemiological studies have associated the presence of this bacterium with colorectal cancer. We have studied the interaction of S. gallolyticus with human colonic cells. S. gallolyticus strain UCN34, adhered better to mucus-producing cells such as HT-29-MTX than to the parental HT-29 cells. Attachment to colonic mucus is dependent on the pil3 pilus operon, which is heterogeneously expressed in the wild-type UCN34 population. We constructed a pil3 deletion mutant in a Pil3 overexpressing variant (Pil3+) and were able to demonstrate the role of Pil3 pilus in binding to colonic mucus. Importantly, we showed that pil3 deletion mutant was unable to colonize mice colon as compared to the isogenic Pil3+ variant. Our findings establish for the first time a murine model of intestinal colonization by S. gallolyticus.

Discrete and Structurally Unique Proteins (Tāpirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose

A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins ("tāpirins," origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose.

Phenotypical analysis of the Lactobacillus rhamnosus GG fimbrial spaFED operon: surface expression and functional characterization of recombinant SpaFED pili in Lactococcus lactis.

A noticeable genomic feature of many piliated Gram-positive bacterial species is the presence of more than one pilus-encoding operon. Paradigmatically, the gut-adapted Lactobacillus rhamnosus GG strain contains two different fimbrial operons in its genome. However, whereas one of these operons (called spaCBA) is encoding for the functionally mucus-/collagen-binding SpaCBA pilus, for the other operon (called spaFED) any native expression of the SpaFED-called pili is still the subject of some uncertainty. Irrespective of such considerations, we decided it would be of relevance or interest to decipher the gross structure of this pilus type, and as well assess its functional capabilities for cellular adhesion and immunostimulation. For this, and by following the approach we had used previously to explicate the immuno-properties of SpaCBA pili, we constructed nisin-inducible expression clones producing either wild-type or SpaF pilin-deleted surface-assembled L. rhamnosus GG SpaFED pili on Lactococcus lactis cells. Using these piliated lactococcal constructs, we found that the pilin-polymerized architecture of a recombinant-produced SpaFED pilus coincides with sequence-based functional predictions of the related pilins, and in fact is prototypical of those other sortase-dependent pilus-like structures thus far characterized for piliated Gram-positive bacteria. Moreover, we confirmed that among the different pilin subunits encompassing spaFED operon-encoded pili, the SpaF pilin is a main adhesion determinant, and when present in the assembled structure can mediate pilus binding to mucus, certain extracellular matrix proteins, and different gut epithelial cell lines. However, somewhat unexpectedly, when recombinant SpaFED pili are surface-attached, we found that they could not potentiate the existing lactococcal cell-induced immune responses so elicited from intestinal- and immune-related cells, but rather instead, they could dampen them. Accordingly, we have now provided the first phenotypical description of a spaFED pilus operon, and with that furthered the functional understanding of surface piliation for a particular gut-commensalic genre of piliated Gram-positive bacteria.

Comparative genomics analysis of Liberibacter species to elucidate pathogenesis and culturability

Liberibacter crescens BT-1, a gram negative, rod-shaped bacterial isolate, was previously recovered from mountain papaya and sequenced. As L. crescens is culturable and is not a pathogen of citrus, comparative genomics of this strain with other uncultured, pathogenic Liberibacter should suggest genes involved in both phenotypes. Genomic comparison to Liberibacter sp. revealed differences in metabolic pathways and virulence genes.  Specific differences in metabolism include the inability of L. asiaticus and L. solanacearum to synthesize histidine, tryptophan, and thiamine, as well as a reduced ability to produce other amino acids. L. asiaticus and L. solanacearum possess a thiamine ABC transporter not found in L. crescens, which may compensate for the inability to synthesize thiamine.  Diversity in the flp pilus operon and metal ABC transporters were observed that may contribute to the pathogenesis of the uncultured species. These differences may contribute to variation in virulence and culturability among species. Finally, two putative prophage regions were found in L. crescens that share moderate functional similarity to the phage regions of L. asiaticus, but sequence similarity is not conserved. Additional genomic comparisons will expand our understanding of virulence and vector-interactions of the described Liberibacter sp.&nbsp

Pilicide ec240 disrupts virulence circuits in uropathogenic Escherichia coli.

ABSTRACTChaperone-usher pathway (CUP) pili are extracellular organelles produced by Gram-negative bacteria that mediate bacterial pathogenesis. Small-molecule inhibitors of CUP pili, termed pilicides, were rationally designed and shown to inhibit type 1 or P piliation. Here, we show that pilicide ec240 decreased the levels of type 1, P, and S piliation. Transcriptomic and proteomic analyses using the cystitis isolate UTI89 revealed that ec240 dysregulated CUP pili and decreased motility. Paradoxically, the transcript levels of P and S pilus genes were increased during growth in ec240, even though the level of P and S piliation decreased. In contrast, the most downregulated transcripts after growth in ec240 were from the type 1 pilus genes. Type 1 pilus expression is controlled by inversion of the fimS promoter element, which can oscillate between phase on and phase off orientations. ec240 induced the fimS phase off orientation, and this effect was necessary for the majority of ec240’s inhibition of type 1 piliation. ec240 increased levels of the transcriptional regulators SfaB and PapB, which were shown to induce the fimS promoter phase off orientation. Furthermore, the effect of ec240 on motility was abolished in the absence of the SfaB, PapB, SfaX, and PapX regulators. In contrast to the effects of ec240, deletion of the type 1 pilus operon led to increased S and P piliation and motility. Thus, ec240 dysregulated several uropathogenic Escherichia coli (UPEC) virulence factors through different mechanisms and independent of its effects on type 1 pilus biogenesis and may have potential as an antivirulence compound.

Influence of isolate origin and presence of various genes on biofilm formation byEnterococcus faecium

Enterococcus faecium, a major cause of nosocomial infections, is often isolated from conditions where biofilm is considered to be important in the establishment of infections. We investigated biofilm formation among E. faecium isolates from diverse sources and found that the occurrence and amount of biofilm formation were significantly greater in clinical isolates than fecal isolates from community volunteers. We also found that the presence of the empfm (E. faecium pilus) operon was associated with the amount of biofilm formation. Furthermore, we analyzed the possible association between the distribution of 16 putative virulence genes and the occurrence of biofilm production. Even though the prevalence of these virulence genes was significantly higher in clinical isolates, we did not observe any correlation with the occurrence of biofilm formation.

Construction of isogenic mutants in Streptococcus gallolyticus based on the development of new mobilizable vectors

Streptococcus gallolyticus is an emerging cause of infective endocarditis that has been epidemiologically linked to colorectal cancer. S. gallolyticus is poorly transformable using electroporation and no defined mutant has been published yet. Hence, we used mobilization to introduce plasmid DNA from Streptococcus agalactiae into S. gallolyticus using the transfer origin of the conjugative element TnGBS1 (oriTTnGBS1), followed by a classical homologous recombination technique. Two isogenic mutants of S. gallolyticus UCN34, one deleted for the pil1 pilus operon and another for the sortase A gene, were constructed and characterized. This genetic tool should help in unravelling virulence mechanisms of this bacterium.

Structure and secretion of CofJ, a putative colonization factor of enterotoxigenic Escherichia coli

Enterotoxigenic Escherichia coli (ETEC) colonize the human gut, causing severe cholera-like diarrhoea. ETEC utilize a diverse array of pili and fimbriae for host colonization, including the Type IVb pilus CFA/III. The CFA/III pilus machinery is encoded on the cof operon, which is similar in gene sequence and synteny to the tcp operon that encodes another Type IVb pilus, the Vibrio cholerae toxin co-regulated pilus (TCP). Both pilus operons possess a syntenic gene encoding a protein of unknown function. In V. cholerae, this protein, TcpF, is a critical colonization factor secreted by the TCP apparatus. Here we show that the corresponding ETEC protein, CofJ, is a soluble protein secreted via the CFA/III apparatus. We present a 2.6 Å resolution crystal structure of CofJ, revealing a large β-sandwich protein that bears no sequence or structural homology to TcpF. CofJ has a cluster of exposed hydrophobic side-chains at one end and structural homology to the pore-forming proteins perfringolysin O and α-haemolysin. CofJ binds to lipid vesicles and epithelial cells, suggesting a role in membrane attachment during ETEC colonization.

Molecular analysis of the UV‐inducible pili operon from Sulfolobus acidocaldarius

Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange between cells. As the system increases the fitness of Sulfolobus cells after UV light exposure, we assume that transfer of DNA takes place in order to repair UV-induced DNA damages via homologous recombination. Here, we studied all genes present in the ups cluster via gene deletion analysis with a focus on UpsX, a protein that shows no identifiable functional domains. UspX does not seem to be structurally essential for UV-induced pili formation and cellular aggregation, but appears to be important for efficient DNA transfer. In addition, we could show that pilin subunits UpsA and UpsB probably both function as major pilin subunits in the ups pili.

Contribution of Individual Ebp Pilus Subunits of Enterococcus faecalis OG1RF to Pilus Biogenesis, Biofilm Formation and Urinary Tract Infection

The endocarditis and biofilm-associated pilus (Ebp) operon is a component of the core genome of Enterococcus faecalis that has been shown to be important for biofilm formation, adherence to host fibrinogen, collagen and platelets, and in experimental endocarditis and urinary tract infection models. Here, we created single and double deletion mutants of the pilus subunits and sortases; next, by combining western blotting, immunoelectron microscopy, and using ebpR in trans to increase pilus production, we identified EbpA as the tip pilin and EbpB as anchor at the pilus base, the latter attached to cell wall by the housekeeping sortase, SrtA. We also confirmed EbpC and Bps as the major pilin and pilin-specific sortase, respectively, both required for pilus polymerization. Interestingly, pilus length was increased and the number of pili decreased by deleting ebpA, while control overexpression of ebpA in trans restored wild-type levels, suggesting a dual role for EbpA in both initiation and termination of pilus polymerization. We next investigated the contribution of each pilin subunit to biofilm formation and UTI. Significant reduction in biofilm formation was observed with deletion of ebpA or ebpC (P<0.001) while ebpB was found to be dispensable; a similar result was seen in kidney CFUs in experimental UTI (ΔebpA, ΔebpC, P≤0.0093; ΔebpB, non-significant, each vs. OG1RF). Hence, our data provide important structural and functional information about these ubiquitous E. faecalis pili and, based on their demonstrated importance in biofilm and infection, suggest EbpA and EbpC as potential targets for antibody-based therapeutic approaches.

Pilus Biogenesis in Lactococcus lactis: Molecular Characterization and Role in Aggregation and Biofilm Formation

The genome of Lactococcus lactis strain IL1403 harbors a putative pilus biogenesis cluster consisting of a sortase C gene flanked by 3 LPxTG protein encoding genes (yhgD, yhgE, and yhhB), called here pil. However, pili were not detected under standard growth conditions. Over-expression of the pil operon resulted in production and display of pili on the surface of lactococci. Functional analysis of the pilus biogenesis machinery indicated that the pilus shaft is formed by oligomers of the YhgE pilin, that the pilus cap is formed by the YhgD pilin and that YhhB is the basal pilin allowing the tethering of the pilus fibers to the cell wall. Oligomerization of pilin subunits was catalyzed by sortase C while anchoring of pili to the cell wall was mediated by sortase A. Piliated L. lactis cells exhibited an auto-aggregation phenotype in liquid cultures, which was attributed to the polymerization of major pilin, YhgE. The piliated lactococci formed thicker, more aerial biofilms compared to those produced by non-piliated bacteria. This phenotype was attributed to oligomers of YhgE. This study provides the first dissection of the pilus biogenesis machinery in a non-pathogenic Gram-positive bacterium. Analysis of natural lactococci isolates from clinical and vegetal environments showed pili production under standard growth conditions. The identification of functional pili in lactococci suggests that the changes they promote in aggregation and biofilm formation may be important for the natural lifestyle as well as for applications in which these bacteria are used.

The small regulatory RNA FasX controls pilus expression and adherence in the human bacterial pathogen group A Streptococcus

Bacterial pathogens use cell surface-associated adhesion molecules to promote host attachment and colonization, and the ability to modulate adhesion expression is critical to pathogen success. Here, we show that the human-specific pathogen the group A Streptococcus (GAS) uses a small regulatory RNA (sRNA) to regulate the expression of adhesive pili. The fibronectin/fibrinogen-binding/haemolytic-activity/streptokinase-regulator-X (FasX) sRNA, previously shown to positively regulate expression of the secreted virulence factor streptokinase (SKA), negatively regulates the production of pili on the GAS cell surface. FasX base pairs to the extreme 5' end of mRNA from the pilus biosynthesis operon, and this RNA:RNA interaction reduces the stability of the mRNA, while also inhibiting translation of at least the first gene in the pilus biosynthesis operon (cpa, which encodes a minor pilin protein). The negative regulation of pilus expression by FasX reduces the ability of GAS to adhere to human keratinocytes. Our findings cement FasX sRNA as an important regulator of virulence factor production in GAS and identify that FasX uses at least three distinct mechanisms, positive (ska mRNA) and negative (pilus operon mRNA) regulation of mRNA stability, and negative regulation of mRNA translation (cpa mRNA), to post-transcriptionally regulate target mRNAs during infection.

Identification and Characterization of Novel Salmonella Mobile Elements Involved in the Dissemination of Genes Linked to Virulence and Transmission

The genetic diversity represented by >2,500 different Salmonella serovars provides a yet largely uncharacterized reservoir of mobile elements that can contribute to the frequent emergence of new pathogenic strains of this important zoonotic pathogen. Currently, our understanding of Salmonella mobile elements is skewed by the fact that most studies have focused on highly virulent or common serovars. To gain a more global picture of mobile elements in Salmonella, we used prediction algorithms to screen for mobile elements in 16 sequenced Salmonella genomes representing serovars for which no prior genome scale mobile element data were available. From these results, selected mobile elements underwent further analyses in the form of validation studies, comparative analyses, and PCR-based population screens. Through this analysis we identified a novel plasmid that has two cointegrated replicons (IncI1-IncFIB); this plasmid type was found in four genomes representing different Salmonella serovars and contained a virulence gene array that had not been previously identified. A Salmonella Montevideo isolate contained an IncHI and an IncN2 plasmid, which both encoded antimicrobial resistance genes. We also identified two novel genomic islands (SGI2 and SGI3), and 42 prophages with mosaic architecture, seven of them harboring known virulence genes. Finally, we identified a novel integrative conjugative element (ICE) encoding a type IVb pilus operon in three non-typhoidal Salmonella serovars. Our analyses not only identified a considerable number of mobile elements that have not been previously reported in Salmonella, but also found evidence that these elements facilitate transfer of genes that were previously thought to be limited in their distribution among Salmonella serovars. The abundance of mobile elements encoding pathogenic properties may facilitate the emergence of strains with novel combinations of pathogenic traits.

A one dose experimental cholera vaccine

The number of cholera vaccine doses required for immunity is a constraint during epidemic cholera. Protective immunity following one dose of multiple Vibrio cholerae (Vc) colonization factors (Inaba LPS El Tor, TcpA, TcpF, and CBP-A) has not been directly tested even though individual Vc colonization factors are the protective antigens. Inaba LPS consistently induced vibriocidal and protective antibodies at low doses. A LPS booster, regardless of dose, induced highly protective secondary sera. Vc protein immunogens emulsified in adjuvant were variably immunogenic. CBP-A was proficient at inducing high IgG serum titers compared with TcpA or TcpF. After one immunization, TcpA or TcpF antisera protected only when the toxin co-regulated pilus operon of the challenge Vc was induced by AKI culture conditions. CBP-A was not consistently able to induce protection independent of the challenge Vc culture conditions. These results reveal the need to understand how best to leverage the 'right' Vc immunogens to obtain durable immunity after one dose of a cholera subunit vaccine. The dominance of the protective anti-LPS antibody response over other Vc antigen antibody response needs to be controlled to find other protective antigens that can add to anti-LPS antibody-based immunity.

Rga, a RofA-Like Regulator, Is the Major Transcriptional Activator of the PI-2a Pilus inStreptococcus agalactiae

Rapid adaptation to changing environments is key in determining the outcome of infections caused by the opportunistic human pathogen Streptococcus agalactiae. We previously demonstrated that the RofA-like protein (RALP) regulators RogB and Rga activate their downstream divergently transcribed genes, that is, the pilus operon PI-2a and the serine-rich repeat encoding gene srr1, respectively. Characterization of the Rga regulon by microarray revealed that the PI-2a pilus was strongly controlled by Rga, a result confirmed at the protein level. Complementation experiments showed that the expression of Rga, but not RogB, in the double ΔrogB/Δrga mutant, or in the clinical strain 2603V/R displaying frameshift mutations in rogB and rga genes, is sufficient to restore wild-type expression levels of PI-2a pilus and Srr1. Biofilm formation was impaired in the Δrga and Δrga/rogB mutants and restored on complementation with rga. Paradoxically, adherence to intestinal epithelial cells was unchanged in the Δrga mutant. Finally, the existence of several clinical isolates mutated in rga highlights the concept of strain-specific regulatory networks.

Genome‐wide transcriptome analysis of fluoroquinolone resistance in clinical isolates of Escherichia coli

Coincident with their worldwide use, resistance to fluoroquinolones in Escherichia coli has increased. To identify the gene expression profiles underlying fluoroquinolone resistance, we carried out genome-wide transcriptome analysis of fluoroquinolone-sensitive E. coli. Four fluoroquinolone-sensitive E. coli and five fluoroquinolone-resistant E. coli clinical isolates were subjected to complementary deoxyribonucleic acid microarray analysis. Some upregulated genes' expression was verified by real-time polymerase chain reaction using 104 E. coli clinical isolates, and minimum inhibitory concentration tests were carried out by using their transformants. A total of 40 genes were significantly upregulated in fluoroquinolone-resistant E. coli isolates (P < 0.05). The expression of phage shock protein operons, which are involved in biofilm formation, was markedly upregulated in our profile of fluoroquinolone-resistant E. coli. One of the phage shock protein operons, pspC, was significantly upregulated in 50 fluoroquinolone-resistant E. coli isolates (P < 0.0001). The expression of type I fimbriae genes, which are pilus operons involved in biofilm formation, were markedly downregulated in fluoroquinolone-resistant E. coli. Deoxyribonucleic acid adenine methyltransferase (dam), which represses type I fimbriae genes, was significantly upregulated in the clinical fluoroquinolone-resistant E. coli isolates (P = 0.007). We established pspC- and dam-expressing E. coli transformants from fluoroquinolone-sensitive E. coli, and the minimum inhibitory concentration tests showed that the transformants acquired fluoroquinolone resistance, suggesting that upregulation of these genes contributes to acquiring fluoroquinolone resistance. Upregulation of psp operones and dam underlying pilus operons downregulation might be associated with fluoroquinolone resistance in E. coli.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Fimbrial Adhesins Produced by Atypical Enteropathogenic Escherichia coli Strains

Atypical enteropathogenic Escherichia coli (aEPEC) has emerged as a significant cause of pediatric diarrhea worldwide; however, information regarding its adherence mechanisms to the human gut mucosa is lacking. In this study, we investigated the prevalence of several (fimA, ecpA, csgA, elfA, and hcpA) fimbrial genes in 71 aEPEC strains isolated from children with diarrhea (54 strains) and healthy individuals (17 strains) in Brazil and Australia by PCR. These genes are associated with adhesion and/or biofilm formation of pathogenic and commensal E. coli. Here, the most prevalent fimbrial genes found, in descending order, were hcpA (98.6%), ecpA (86%), fimA (76%), elfA (72%), and csgA (19.7%). Phenotypic expression of pili in aEPEC strains was assessed by several approaches. We were not able to detect the hemorrhagic coli pilus (HCP) or the E. coli laminin-binding fimbriae (ELF) in these strains by using immunofluorescence. Type 1 pili and curli were detected in 59% (by yeast agglutination) and 2.8% (by Congo red binding and immunofluorescence) of the strains, respectively. The E. coli common pilus (ECP) was evidenced in 36.6% of the strains on bacteria adhering to HeLa cells by immunofluorescence, suggesting that ECP could play an important role in cell adherence for some aEPEC strains. This study highlights the complex nature of the adherence mechanisms of aEPEC strains involving the coordinated function of fimbrial (e.g., ECP) and nonfimbrial (e.g., intimin) adhesins and indicates that these strains bear several pilus operons that could potentially be expressed in different niches favoring colonization and survival in and outside the host.