Phosphorothioate Bonds Research Articles

Effect of RP and SPPhosphorothioate Substitution at the Scissile Site on the Cleavage Activity of Deoxyribozyme 10-23

The substrate specificity towards RNA/DNA chimeric oligonucleotide containing stereodefined phosphorothioate bond of the RP and SP configuration at the scissile site was determined for the cleavage reaction catalyzed by the deoxyribozyme 10-23. Single-turnover kinetics in the presence of either Mg2+or Mn2+ was used to determine the thio- and manganese rescue effects of the cleavage reaction. The obtained results indicate that the unmodified substrate and its SP thio-analog are specifically and efficiently cleaved even at low metal ion concentration (0.02 mM). By contrast, the presence of the phosphorothioate bond of the RP configuration at the scissile site caused complete resistance of this substrate in the deoxyribozyme-mediated cleavage reaction in a broad metal ion concentration (from 0.02 to 100 mM). These findings indicate the lack of a direct metal ion coordination to the non-bridging phosphate oxygens of the scissile phosphate bond (no β catalysis is observed). Plausible mechanism of this 10-23 deoxyribozyme-assisted catalysis reaction involves engagement of the divalent metal cation in the coordination of the oxygen of the 2-OH group and migration of proton to the pro-RP oxygen of the scissile phosphate.

Utility of Azolium Triflates as Promoters for the Condensation of a Nucleoside Phosphoramidite and a Nucleoside in the Agrawal's Stereoselective Synthesis of Nucleoside Phosphorothioates

AbstractThis paper demonstrates that some azolium triflates, such as N‐phenylimidazolium triflate, benzimidazolium triflate and N‐methylbenzimidazolium triflate, are more useful than 1H‐tetrazole as promoters for the stereoselective condensation of a 5′‐O‐free nucleoside and a stereochemically pure 5′‐O‐(p,p′‐dimethoxytrityl)‐3′‐O‐{(4R)‐1H,3H‐pyrrolo[1,2‐c]‐1,3,2‐oxazaphospholidin}‐2‐yl 2′‐deoxyribonucleoside (Rc‐1) or 5′‐O‐(p,p′‐dimethoxytrityl)‐3′‐O‐{(4S)‐1H,3H‐pyrrolo[1,2‐c]‐1,3,2‐oxazaphospholidin}‐2‐yl 2′‐deoxyribonucleoside (Sc‐2) (Agrawal strategy). The azolium triflates allowed the stereoselective formation of an internucleotide phosphorothioate bond via the above‐described condensation using a stereochemically pure phosphoramidite, followed by sulfurization using bis[3‐triethoxysilylpropyl]tetrasulfide. The highest diastereoexcess values of the products in the synthesis of dideoxyribonucleoside phosphorothioates using a suitable azolium triflate such as benzimidazolium triflate, N‐methylbenzimidazolium triflate or N‐phenylimidazolium triflate were 90–96 % in solution phase or 80–88 % in solid phase; these values were higher than those obtained in the synthesis using 1H‐tetrazole as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. This paper also describes that studies on the absolute configurations of stereogenic phosphorus atoms in the phosphoramidites Rc‐1 and Sc‐2 by meansof two different existing methods, i. e., the Beaucage method, gave contrary conclusions, and thus the configurations should be determined by an absolutely reliable method, such as X‐ray analysis. (© Wiley‐VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2005)

New approach to the synthesis of oligodeoxyribonucleotides modified with phosphorothioates of predetermined sense of P-chirality

Appropriately protected, diastereomerically pure dinucleoside phosphorothioates, obtained by the stereocontrolled oxathiaphospholane method, were S-alkylated with 2-nitrobenzyl bromide and then converted into their 3′- O-phosphoramidites. The corresponding S-protected dinucleotide building blocks were successfully used for the synthesis of oligonucleotides containing P-stereodefined phosphorothioate bonds at preselected positions.

Biodistribution and metabolism of immunostimulatory oligodeoxynucleotide CPG 7909 in mouse and rat tissues following subcutaneous administration

To evaluate pharmacokinetics (PK) and biodistribution, CPG 7909, a 24-mer immunostimulatory fully phosphorothioated oligodeoxynucleotide (PS-ODN), was administered by subcutaneous injection at 2, 5 and 12.5 mg/kg to mice and at 9 mg/kg to rats. Parent compound and metabolites were isolated from plasma and tissues and quantified by capillary gel electrophoresis with UV detection (CGE-UV) and molecular masses were determined by matrix-assisted-laser-desorption-ionization time of flight detection (MALDI-TOF). An established method for PS-ODN isolation from plasma and tissue was modified to prevent oxidation of the phosphorothioate bonds during the extraction process, significantly increasing sensitivity in the subsequent MALDI-TOF analysis. Concentrations of CPG 7909 and metabolites were highest at the injection site (>600 mg/kg at 4 h). Maximal concentrations in local (draining) lymph nodes (LLN), kidney and liver were 10–15% of that at the injection site. The highest total amount of PS-ODN (percentage of administered dose) was found in the liver (32% at 4 h), followed closely by the injection site (23% at 4 h). Only very low levels of CPG 7909 and metabolites were found in plasma and only during the first hours. Metabolites identified by MALDI-TOF were similar for both species and all analyzed tissues, although the relative amounts of the different metabolites varied with tissue and over time. Degradation of CPG 7909 in vivo occurred predominantly by 3′exonucleases with additional cleavage by endonucleases.

In This Issue

In This Issue

Stereochemistry of cleavage of internucleotide bonds by Serratia marcescens endonuclease

Endonuclease from Serratia marcescens hydrolyzes internucleotide phosphorothioate linkages of R P configuration with inversion of configuration at P-atom. This observation supports a reported architecture of the active site, with 3′-bridging and pro-S P non-bridging oxygen atoms of the scissile phosphate group involved in direct contact with hydrated magnesium cation, while His-89 activates a water molecule which attacks the phosphorus atom according to a one-step in-line mechanism. The presence of a phosphorothioate bond of S P configuration downstream to that one being cleaved reduces the rate of hydrolysis. This suggests participation of the pro-S P oxygen atom of that phosphate bond in the mechanism of action of the enzyme, which was not detected in published crystallographic analyses.

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH3)CH2(RCl) (II-PS) and (RCl)CH2N(CH3)pGpsCpsApsTpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl = C6H4N(CH3)(CH2CH2Cl) at the 3'- or 5'-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (at t-->infinity) at 20 degrees C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH3)CH2(RCl) (II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex.

Stepwise Solid-Phase Synthesis of Peptide-Oligonucleotide Conjugates on New Solid Supports

Several peptide-oligonucleotide and peptide-(oligonucleotide phosphorothioate) conjugates were synthesized on new solid supports. These supports are designed to link the 3′-terminus of an oligonucleotide to the C-end of a peptide via a phosphodiester or phosphorothioate bond in the process of stepwise solid-phase assembly.

Enzymatic assignment of diastereomeric purity of stereodefined phosphorothioate oligonucleotides.

Enzymatic hydrolysis of stereoregular oligodeoxyribonucleoside phosphorothioates (PS-oligos) synthesized via the oxathiaphospholane method has been used for assignment of their diastereomeric purity. For this purpose, two well-known enzymes of established diastereoselectivity, nuclease P1 and snake venom phosphodiesterase (svPDE) have been used. However, because of some disadvantageous properties of svPDE, a search for other [Rp]-specific endonucleases was undertaken. Extracellular bacterial endonuclease isolated from Serratia marcescens accepts PS-oligos as substrates and hydrolyzes phosphorothioate bonds of the [Rp] configuration, whereas internucleotide [Sp]-phosphorothioates are resistant to its action. Cleavage experiments carried out with the use of unmodified and phosphorothioate oligonucleotides of different sequences demonstrate that the Serratia nuclease is more selective in recognition and hydrolysis of oligodeoxyribonucleotides than previously reported. The substrate specificity exhibited by the enzyme is influenced not only by the nucleotide sequence at the cleavage site but also by the length and base sequence of flanking sequences. The Serratia nuclease can be useful for analysis of diastereomeric purity of stereodefined phosphorothioate oligonucleotides, but because of its sequence preferences, the use of this enzyme in conjunction with svPDE is more reliable.

Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

Biologically active oligodeoxyribonucleotides. Part 11: The least phosphate-modification of quadruplex-forming hexadeoxyribonucleotide TGGGAG, bearing 3′- and 5′-end-modification, with anti-HIV-1 activity

We have found that a hexadeoxyribonucleotide (5′TGGGAG3′, R-95288), Koizumi, M. et al. Bioorganic & Medicinal Chemistry, 1997, 5, 2235, bearing a 3,4-dibenzyloxybenzyl (3,4-DBB) group at the 5′-end and a 2-hydroxyethylphosphate at the 3′-end, has high anti-HIV-1 activity and the least cytotoxicity in vitro and in vivo. In order to synthesize more potent hexadeoxyribonucleotides, we substituted phosphodiester (PO) bonds in the 6-mer with the least phosphorothioate (PS), phosphoramidate (PN), or methylphosphonate (PMe) bonds. When more than two PN or PMe bonds were introduced into a 6-mer, the phosphate-modified 6-mers had weak or no anti-HIV-1 activity, in spite of quadruplex structure formation. However, when PS bonds were substituted for PO bonds, anti-HIV-1 activity of their 6-mers did not dramatically decrease, compared with compounds substituted with PN or PMe bonds. The results suggest that the formation of a quadruplex structure is not always sufficient for anti-HIV-1 activity of the 6-mer, and that net negative charges derived from PO or PS bonds in the quadruplex are important for anti-HIV-1 activity. Moreover, among various phosphate-modified ODNs, we found that the anti-HIV-1 activity of ODN PS7 with only one PS bond was the same as that of R-95288, both having a high stability in human plasma.

Influence of P-Chirality of Phosphorothioate Oligonucleotides on the Activity of Amv-Reverse Transcriptase

The inhibition of reverse transcriptase by phosphorothioate oligonucleotides of predetermined absolute configuration at each internucleotide centre (PS-oligos) was studied in a cell-free system, composed of an RNA template, a primer oligodeoxynucleotide (PO-oligo) and the AMV or HIV reverse transcriptase. It was found that the non-antisense inhibition of the RT enzymes caused by their direct interaction with PS-oligos depends upon a nucleoside sequence of oligonucleotide as well as upon the absolute configuration at phosphorus atoms of internucleotide phosphorothioate bonds.

Use of T7 gene 6 exonuclease and phosphorothioated primers for the manipulation of HIV-1 infectious clones

A method is described for the efficient substitution, deletion or insertion of any desired DNA sequence into any viral infectious clones without the limitation of naturally occurring restriction sites. The technique employs the polymerase chain reaction combined with the resistance of 2′-deoxynucleotides 5′- O-(1-thiotriphosphate) dNTPs [S] bonds (phosphorothiate bonds) to the 5′-3′ double strand specific T7 gene 6 exonuclease (T7 Exo) digestion. Primers used to amplify the DNA target regions being manipulated present three phosphorothioate bonds from the fifteenth base at the 5′ end. The enzyme activity was shown to be completely inhibited by the presence of more than one phosphorothioate residue at the 5′ end of the DNA molecules. When the amplification products are submitted to the exonuclease digestion the hydrolytic T7 Exo activity generates a short single strand DNA tail which contains the nucleotide integrity of the 3′ strand. Since the ends of two independently amplified products overlap they can regenerate a stable recombinant structure when further combined in the same reaction tube in the presence of T4 DNA ligase. This new method can be used for manipulating an HIV-1 full-length clone belonging to subtype D replacing the env (gp120) gene for an F subtype sequence.

Properties and Anti-HIV Activity of Nicked Dumbbell Oligonucleotides

Abstract We have designed a new type of oligodeoxyribonucleotide. These oligodeoxyribonucleotides form two hairpin loop structures with base pairs (sense and antisense) in the double helical stem at the 3′ and 5′-ends (nicked dumbbell oligonucleotides). The nicked dumbbell oligonucleotides are molecules with free ends that are more resistant to exonuclease attack. Furthermore, the nicked dumbbell oligonucleotide containing phosphorothioate (P=S) bonds in the hairpin loops has increased nuclease resistance, as compared to the unmodified nicked oligonucleotide. The binding of the nicked dumbbell oligonucleotide to RNA is lower than that of a single-stranded DNA. We also describe the anti-HIV activity of nicked dumbbell oligonucleotides. #This article is dedicated to Professor Yoshihisa Mimno on the occasion of his 75 th birthday.

The synthesis and X-ray structural studies of 2-cholesteryl-2-thio-1,3,2-oxathiaphospholane and 2-cholesteryl-2-thio-1,3,2-dithiaphospholane

Two “thiophospholane” derivatives of cholesterol: 2-cholesteryl-2-thio-1,3,2-oxathiaphospholane (1) and 2-cholesteryl-2-thio-1,3,2-dithiaphospholane (2) were synthesized as new reagents for introducing a cholesteryl moiety at the 5′-end of oligonucleotidesvia the phosphorothioate or phosphorodithioate bond. Compounds1 and2 were subjected to structural studies by X-ray methods. Both compounds crystallized in the orthorhombic system, space group P212121,1 witha=6.283(1) A,b=12.067(1) A,c=38.983(3) A,2 witha=6.371(1) A,b=11.971(1) A andc=39.502(3) A. The five-membered heterocyclic rings of both compounds attain a half-chair conformation in the solid state. In structures of1 and2 a disorder of some atoms is observed. The absolute configuration at the phosphorus atom in1 of the components of diastereoisomeric mixture has been established.

Helix-stabilizing compounds CC-1065 and U-71,184 bind to RNA-DNA and DNA-DNA duplexes containing modified internucleotide linkages and stabilize duplexes against thermal melting.

CC-1065 and U-71,184 bind and hyperstabilize DNA duplexes, but little is known about their effects on nucleic acid duplexes of different structure. A 20 mer DNA sequence (5'-TTACTTCAGTTATGAGACCA) containing a drug binding sequence (5'-AGTTA) was selected as the target sequence, and this was duplexed with complementary antisense sequences containing phosphodiester (PO), phosphorothioate (PS), and methylphosphonate (MP) bonds. The duplexes containing PO or PS bound 2 CC-1065 molecules per duplex, presumably at both the target site and at a lower affinity site (5'-AGTAA) on the antisense strand. The duplex containing MP bound only 1 CC-1065, and all duplexes bound only 1 U-71,184. Both CC-1065 and U-71,184 bound to 20 mer duplexes comprised of oligo(dA)-oligo(dT) (2.5 and 2 drugs per duplex, respectively) and poly(rA)-oligo(dT) (1 drug per 20 base pairs). CC-1065 also bound to duplexes between the PO- or PS-based antisense structures and a complementary synthetic 20 mer RNA sequence, with about 1 drug per duplex in each case. CC-1065 increased the Tm for the 20 mer DNA duplexes 17 to 29 degrees C, and the corresponding values for U-71,184 ranged from 7 to 19 degrees C. CC-1065 raised the Tm of oligo(dA)-oligo(dT) and poly(rA)-oligo(dT) 29 degrees C. U71,184 increased the Tm for oligo(dA)-oligo(dT) 30 degrees C but did not significantly elevate the Tm for the corresponding RNA-DNA duplex. The results show that CC-1065 and U-71,184 are capable of binding and stabilizing a variety of nucleic acid duplexes. These agents or their analogs may become useful ligands for antisense oligonucleotide applications.

The use of phosphorothioate primers and exonuclease hydrolysis for the preparation of single-stranded PCR products and their detection by solid-phase hybridization.

The effect of phosphorothioate bonds on the hydrolytic activity of the 5'-->3' double-strand-specific T7 gene 6 exonuclease was studied. Double-stranded DNA substrates containing one phosphorothioate residue at the 5' end were found to be hydrolyzed by this enzyme as efficiently as unmodified ones. The enzyme activity was, however, completely inhibited by the presence of four phosphorothioates. On the basis of these results, a method for the conversion of double-stranded PCR products into full-length, single-stranded DNA fragments was developed. In this method, one of the PCR primers contains four phosphorothioates at its 5' end, and the opposite strand primer is unmodified. Following the amplification, the double-stranded product is treated with T7 gene 6 exonuclease. The phosphorothioated strand is protected from the action of this enzyme, whereas the opposite strand is hydrolyzed. When the phosphorothioated PCR primer is 5' biotinylated, the single-stranded PCR product can be easily detected colorimetrically after hybridization to an oligonucleotide probe immobilized on a microtiter plate. We also describe a simple and efficient method for the immobilization of relatively short oligonucleotides to microtiter plates with a hydrophilic surface in the presence of salt.

The influence of oligodeoxyribonucleotide phosphorothioate pyrimidine strands on triplex formation

Analogues of the homopyrimidine oligonucleotide dT 15 that contained phosphorothioate bonds of a mixture of diastereoisomers or one of the two stereoisomers (either Rp or Sp) were synthesized. The analogues were mixed under conditions conducive to the formation of triple-stranded assemblies. The mixtures were characterized by their thermal stabilities ( T m values), CD spectra, and gel electrophoresis pattern. The 34-mer duplexes containing 15 central purines on one strand and 15 complementary pyrimidines on the other strand gave no detectable triple helix upon combination with dT 15S 14. On the other hand, 34-bp duplexes with dT 15S 1, having Rp or Sp, formed triple helixes. This suggests that a steric factor plays an important role in triple helix formation.

Amplimers with 3'-terminal phosphorothioate linkages resist degradation by vent polymerase and reduce Taq polymerase mispriming.

The 3'-->5' exonuclease activity of Vent, a thermostable polymerase from Thermococcus litoralis, enhances DNA replication fidelity but also diverts PCR primers (amplimers) from targeted amplification by degrading their 3' termini. We demonstrate that amplimers with a 3-base 3'-terminal mismatch can be efficiently truncated by Vent to prime DNA polymerizations that compete with the specific amplification reaction. However, amplimers with phosphorothioate bonds joining their 3'-terminal residues are resistant to degradation and demonstrate greatly enhanced priming specificity. Slight destabilization of base-pairing by phosphorothioate bond-linked residues also diminishes extension of mispaired 3' amplimer termini in Taq polymerase-mediated amplifications.

Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity.

Two thermostable DNA polymerases with proofreading activity--Vent DNA polymerase and Pfu DNA polymerase--have attracted recent attention, mainly because of their enhanced fidelities during amplification of DNA sequences by the polymerase chain reaction. A severe disadvantage for their practical application, however, results from the observation that due to their 3' to 5' exonuclease activities these enzymes degrade the oligodeoxynucleotides serving as primers for the DNA synthesis. It is demonstrated that this exonucleolytic attack on the primer molecules can be efficiently prevented by the introduction of single phosphorothioate bonds at their 3' termini. This strategy, which can be easily accomplished using routine DNA synthesis methodology, may open the way to a widespread use of these novel enzymes in the polymerase chain reaction.