Pelargonium Zonate Spot Virus Research Articles

Establishment of Tissue Culture System of Actinidia deliciosa Cultivar “Guichang”

In order to breed virus-free plantlets of the kiwifruit cultivar “Guichang,” which belongs to Actinidia deliciosa, in this study, stem segments with buds were used as explants, the establishment of a tissue culture rapid propagation system was carried out, and then the virus status of tissue culture plantlets was detected via the real-time reverse transcription-polymerase chain reaction (RT-qPCR) method. The tissue culture rapid propagation system proved that the contamination and browning rates could be controlled below 20% and the survival rate could be exceeded by 70% when the single bud stem segment of “Guichang” kiwifruit was sterilized with 70% alcohol for 30–60 s and 15% NaClO for 15 min, respectively. Meanwhile, we screened the hormone concentration to get better results, and the appropriate medium for adventitious bud induction was MS + 6-BA (1.0 mg/L) + IBA (0.2 mg/L); for proliferation, it was MS + 6-BA (1.0 mg/L) + IBA (0.1 mg/L); and for rooting, it was 1/2 MS + IBA (0.3 mg/L), and the efficiency of induction, proliferation, and rooting could reach 74.07%, 79.63%, and 85.18%, respectively. In addition, the RT-qPCR results demonstrated that the infection rate of 9 viruses: apple stem grooving virus (ASGV), cucumber mosaic virus (CMV), Actinidia virus X (AVX), cucumber necrosis virus (CNV), ribgrass mosaic virus (RMV), citrus leaf blotch virus (CLBV), Actinidia virus B (AcVB), Pelargonium zonate spot virus (PZSV), and cherry leaf roll virus (CLRV) in the “Guichang” kiwifruit tissue culture plantlets was 0. This study could lay a foundation for the production of “Guichang” kiwifruit tissue culture seedlings, and the medium formula provided in this study was useful for the industrial rapid propagation of “Guichang” plantlets.

Simultaneous detection of 10 viruses in globe artichoke by a synthetic oligonucleotide-based DNA polyprobe

Most of the 26 viruses that infect globe artichoke are detrimental to the crop’s production, quality, and nutritional value, hamper the development of a nursery activity in the respect of current EU legislation and pose risks for the new plantings. Worldwide movement of virus-controlled plant propagative material require fast, accurate and feasible methods to guarantee reliable results and detection of multiple viruses in a single assay to reduce time and costs in routine tests. Here we describe the use of a digoxigenin-labelled polyprobe assembled from synthetic 50 nt single-stranded DNA sequences derived from genomes of the most commonly occurring viruses in globe artichoke. These included artichoke Italian latent virus (AILV), artichoke latent virus (ArLV), artichoke mottled crinkle virus (AMCV), turnip mosaic virus (TuMV), tomato infectious chlorosis virus (TICV), bean yellow mosaic virus (BYMV), cucumber mosaic virus (CMV), pelargonium zonate spot virus (PZSV), tomato spotted wilt virus (TSWV) and tobacco mosaic virus (TMV). The polyprobe described herein represent the first cheap and reliable example of a technology for broad-spectrum surveys in globe artichoke.

A Survey on Plant Viruses in Natural Brassicaceae Communities Using RNA-Seq.

Studies on plant viruses are biased towards crop diseases and little is known about viruses in natural vegetation. We conducted extensive surveys of plant viruses in wild Brassicaceae plants occurring in three local plant communities in central Japan. We applied RNA-Seq with selective depletion of rRNA, which allowed us to detect infections of all genome-reported viruses simultaneously. Infections of Turnip mosaic virus (TuMV), Cucumber mosaic virus (CMV), Brassica yellows virus, Pelargonium zonate spot virus, and Arabidopsis halleri partitivirus 1 were detected from the two perennial species, Arabidopsis halleri subsp. gemmifera and Rorippa indica. De novo assembly further detected partial sequences of a putative novel virus in Arabis fragellosa. Virus species composition and infection rate differed depending on site and plant species. Viruses were most frequently detected from the perennial clonal plant, A. halleri, in which a high clonal transmission rate of viruses across multiple years was confirmed. Phylogenetic analysis of TuMV and CMV showed that virus strains from wild Brassicaceae were included as a major clade of these viruses with other reported strains from crop plants, suggesting that viruses were shared among wild plants and crops. Our studies indicated that distribution of viruses in natural plant populations are determined by the combinations of life histories of viruses and hosts. Revealing viral distribution in the natural plant communities improves our knowledge on the ecology of plant viruses.

First report of Pelargonium zonate spot virus from wild Brassicaceae plants in Japan

Pelargonium zonate spot virus (PZSV) was identified from two wild Brassicaceae plant species, Arabidopsis halleri and Rorippa indica, in central Japan using RNA-Seq and RT-PCR. The deduced amino acid sequences of RNA-dependent RNA polymerase and coat protein were highly similar to those of previously reported PZSV isolates, with 96.6–98.2% and 93.7–98.0% identity, respectively. Mechanical inoculation revealed the pathogenicity of the PZSV isolate to Nicotiana benthamiana and Brassica oleracea. To the best of our knowledge, this is the first report of PZSV from Japan.

Occurrence of artichoke‐infecting viruses in Tunisia

Crops of globe artichoke (Cynara scolymus) in Manouba and Bizerte regions, Tunisia, were surveyed in spring and autumn 2012 for the presence of key artichoke viruses. A total of 336 leaf samples were collected randomly from plants that were either asymptomatic or showing virus‐like symptoms. These were tested for Artichoke Italian latent virus (AILV), Cucumber mosaic virus (CMV), Artichoke mottled crinkle virus (AMCV), Pelargonium zonate spot virus (PZSV), Artichoke latent virus (ArLV), Bean yellow mosaic virus (BYMV), Turnip mosaic virus (TuMV), Potato virus X (PVX), Tomato infectious chlorosis virus (TICV) and Tomato spotted wilt virus (TSWV). Results from dot‐blot hybridization and reverse transcription polymerase chain reaction (RT‐PCR) showed the occurrence of AILV and BYMV for the first time in Tunisia, and confirmed that of TICV on artichoke crops. ArLV and AILV were the most frequent viruses detected, whereas infections of AMCV, CMV and PVX had a lower incidence. PZSV, TuMV and TSWV were not detected in any of the samples collected. Notable differences were observed between results from spring and autumn surveys, probably as a consequence of the different vegetatives status of the plants and different leaf sample conditions (fresh versus dried). Consequences of the import of planting material with a poor sanitary status and of the overall phytosanitary status of globe artichoke in Tunisia are discussed.

Yellow tailflower mild mottle virus and Pelargonium zonate spot virus co‐infect a wild plant of red‐striped tailflower in Australia

Isolates of an Australian indigenous virus, Yellow tailflower mild mottle virus (YTMMV‐Kalbarri), and an exotic virus, Pelargonium zonate spot virus (PZSV‐SW13), are described from Anthocercis ilicifolia subsp. ilicifolia (red‐striped tailflower, family Solanaceae), a species endemic to Western Australia. This is the first report of either virus from this plant species. The complete genome sequences of YTMMV‐Kalbarri and of PZSV‐SW13 were obtained. YTMMV‐Kalbarri shared 97% nucleotide pairwise identity with the sequence of the type isolate YTMMV‐Cervantes. The sequence PZSV‐SW13 shared greatest sequence identity with the partial sequence of an Australian isolate of PZSV, also from a wild plant, and with a sunflower‐derived isolate of PZSV from Argentina. An experimental host range study was done of YTMMV‐Kalbarri using cultivated and wild solanaceous and non‐solanaceous plants. Most solanaceous plants became systemically infected, with symptoms of systemic infection ranging from symptomless to whole plant necrosis. Based on these studies, it is suggested that YTMMV has the potential to become a pathogen of commercial species of Solanaceae. This study provides further evidence that PZSV is present in wild plants in Australia, in this case an indigenous host species, and possible routes by which it invaded Australia are discussed.

Development of Nucleotide Primers for Diagnostic RT-PCR and Nested PCR Detection of Pelargonium zonate spot virus in Quarantine

Development of Nucleotide Primers for Diagnostic RT-PCR and Nested PCR Detection of Pelargonium zonate spot virus in Quarantine

Cassava Ivorian bacilliform virus is a member of the genus Anulavirus.

The complete genomic sequence of Cassava Ivorian bacilliform virus (CIBV) is described. The virus has a genomic organization similar to that of pelargonium zonate spot virus (PZSV), the type member of the genus Anulavirus, but it is most closely related to a second, recently described, anulavirus, Amazon lily mild mottle virus (ALiMMV).

Pelargonium zonate spot virus. [Distribution map

Abstract A new distribution map is provided for Pelargonium zonate spot virus. Bromoviridae: Anulavirus. Hosts: tomato ( Solanum lycopersicum ) and Pelargonium zonale . Information is given on the geographical distribution in Europe (France, Italy and Spain), Asia (Israel), North America (USA, California), South America (Argentina) and Oceania (Australia, Western Australia).

VIRUSES OF KIWIFRUIT (ACTINIDIA SPECIES)

Kiwifruit (Actinidia deliciosa) was introduced to New Zealand more than one hundred years ago and the New Zealand-raised cv. Hayward is now the dominant cultivar grown worldwide. Further accessions of kiwifruit seed and scionwood have been sourced from China for research and breeding. In one importation consignment, the first virus naturally infecting kiwifruit, Apple stem grooving virus (ASGV), was identified following symptoms observed in quarantined plants (2003). Since that time a further 12 viruses have been identified in kiwifruit. We classify these 13 viruses into three groups. The first group comprises the non-specialist viruses and includes Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV) both members of the family Bromoviridae. The group also includes a further five viruses that appear to have limited effect on kiwifruit: two tobamoviruses, Ribgrass mosaic virus (RMV) and Turnip vein clearing virus (TVCV); a tombusvirus, Cucumber necrosis virus (CNV); a novel potexvirus; and Apple stem gooving virus (ASGV, genus Capillovirus). Most of the viruses classified in this first group are cosmopolitan and sometimes orchard weeds provide reservoirs for infection. The second group comprises the kiwifruit-adapted viruses. This group includes three novel viruses. i.e. two vitiviruses, Actinidia virus A (AcVA) and Actinidia virus B (AcVB), and a citrivirus closely related to Citrus leaf blotch virus (CLBV). In addition, preliminary evidence of a novel virus belonging to the Closteroviridae family has been obtained. The third group of viruses induces disease in kiwifruit. To date only two viruses have caused significant damage to kiwifruit within commercial orchards. In New Zealand, Cherry leaf roll virus (CLRV) has been detected on kiwifruit associated with symptoms including leaf spots, fruit malformation, reduction in yield, bark cracking and cane wilting. Pelargonium zonate spot virus (PZSV) has been detected in Italy associated with severe symptoms on leaves and fruit.

Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR.

To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus) for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

A DNA probe mix for the multiplex detection of ten artichoke viruses

Artichoke Italian latent virus (AILV), Artichoke latent virus (ArLV), Artichoke mottled crinkle virus (AMCV), Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV), Pelargonium zonate spot virus (PZSV), Tomato infectious chlorosis virus (TICV), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV) and Turnip mosaic virus (TuMV) are damaging to artichoke. We have developed a protocol enabling the simultaneous detection of these artichoke viruses by non-isotopic dot blot hybridisation with DNA probes. The probe mix detected all viruses with high specificity and identical to that obtained using individual probes. The approach is proposed for the routine assessment of phytosanitary status for certified nursery production of globe artichoke.

Characterization of a new anulavirus isolated from Amazon lily plants

A quasi-spherical virus was isolated from a cultivated Amazon lily plant (Eucharis grandiflora) that could be mechanically transmitted to healthy E. grandiflora plants, subsequently producing mild mosaic or mottle symptoms on the leaves. The purified virus consisted of three quasi-spherical particles about 20 nm wide and 70, 40 and 30 nm in length, containing three segmented genomes of 3,169, 2,507 and 2,530 nucleotides, respectively. Sequence analysis showed that the newly isolated virus is related to pelargonium zonate spot virus, a member of the genus Anulavirus. We propose that the virus should be designated as Amazon lily mild mottle virus (ALiMMV).

Pelargonium zonate spot virus Is Transmitted Vertically via Seed and Pollen in Tomato

In autumn 2007, a new disease with unknown etiology was observed in open-field tomato (Solanum lycopersicum) in the Lachish region of Israel. The symptoms included mild mosaic, leaf malformation, and severe stunting of the plants. The causal agent was readily transmitted mechanically from the sap of infected plants to indicator plants. Viral particles were purified from infected plants and cDNA was synthesized from RNA isolated from the particles. Cloning and sequencing of the cDNA showed 95% identity to RNA 3 of Pelargonium zonate spot virus (PZSV). Using reverse-transcription polymerase chain reaction, PZSV was detected in both seed and pollen grains of infected tomato plants. Attempts to disinfect seed by using hydrochloric acid and trisodium phosphate failed to eliminate this PZSV detection. Seed from infected tomato plants gave rise to infected seedlings with a seed-transmission rate of PZSV of 11 to 29%. Pollen grains collected from flowers of infected plants were used to hand pollinate healthy mother tomato plants. Although none of the pollinated mother plants became infected with PZSV, 29% of the seedlings produced from seed harvested from these plants were found to be infected. This is the first demonstration that PZSV is transmitted vertically via both pollen and seed in tomato plants.

Identification of plant viruses using one-dimensional gel electrophoresis and peptide mass fingerprints

A generic assay to detect and partially characterize unknown viruses from plants was developed. Proteins extracted from virus-infected and uninfected plants were separated in one dimension by SDS polyacrylamide gel electrophoresis. Differentially expressed protein bands were eluted after trypsin digestion and resulting peptide fragments separated according to their mass by matrix-assisted laser-desorption ionization time-of-flight (MALDI-TOF) mass spectrometry. Resulting peptide mass fingerprints (PMF) were compared with those in protein databases. The assay was used to identify three known viruses: the potyviruses Zucchini yellow mosaic virus and Turnip mosaic virus, and an alfamovirus Alfalfa mosaic virus. It was also used to identify a virus that manifested symptoms in wild Cakile maritima plants, tentatively identified as Pelargonium zonate spot virus (PZSV) (genus Anulavirus) by its PMF, and then confirmed by nucleotide sequencing. The detection of PZSV constitutes a first record of this virus in Australia and in this host. It is proposed that this rapid and simple assay is a useful approach for analysis of plant samples known to harbor viruses that could not be identified using antisera or nucleic acid-based assays.

First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain.

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2). In Spain, PZSV was first detected in 1996 in tomato plants of cv. Royesta from greenhouses in Zaragoza Province (3) and subsequently in tomato in the Catalonia and Navarra areas. In April 2006, symptoms of PZSV were found at high incidence on tomato in a greenhouse in Huesca, Aragón (northeastern Spain). Randomly distributed pepper plants (Capsicum annuum L.) of cv. Estilo F1 growing in the same greenhouse showed severe foliar chlorotic ringspots and line patterns similar to those observed in tomato. Samples from symptomatic peppers and tomatoes and one asymptomatic weed of Rubia tinctorum L. tested positive by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against PZSV (Agdia Inc., Elkhart, IN and DSMZ, Braunschweig, Germany) as did a Spanish PZSV isolate used as a positive control (3). Sap extracts from two tomatoes, three peppers, and the single R. tinctorum plant were mechanically inoculated to 22 indicator species, including pepper and tomato. On 17 of 22 species inoculated, sap from symptomatic tomatoes and peppers elicited local or systemic symptoms similar to those reported earlier for PZSV isolates (3). Systemic symptoms were mainly mosaic, chlorotic, and necrotic line patterns and ringspots on leaves of most indicator species, closely resembling those observed on the greenhouse pepper and tomato plants. Symptoms on inoculated tomatoes also included stem necrosis and death. Reactions of indicator species did not indicate the presence of any other pepper- or tomato-infecting viruses. Both field infected and mechanically inoculated plants of pepper cvs. Yolo Wonder and Doux des Landes were maintained in the greenhouse until the development of fruit symptoms. Only fruits of cv. Yolo Wonder showed dark green and slightly depressed circles on their surface. Local and systemic infection by PZSV was confirmed by DAS-ELISA in most inoculated plants. Total RNA from leaves of field or inoculated plants was used as template for amplification by reverse transcription (RT)-PCR with primers R3-F and R3-R that are specific for the PZSV 3a gene (2), and amplicons were sequenced directly. The sequences of 697 nt from pepper and tomato isolates from the same greenhouse were identical (GenBank Accession Nos. CQ178217 and CQ178216, respectively) and had 96.1% identity to nucleotides 384 to 1,080 in PZSV RNA-3 (NC_003651). Our results confirm the natural infection of pepper plants in Huesca by PZSV. To our knowledge, this is the first report of pepper as a natural host for PZSV, a significant finding considering the potential risks of PZSV dispersion whenever tomato and pepper coexist, particularly in greenhouses and nurseries.

Production of polyclonal antibodies against Pelargonium zonate spot virus coat protein expressed in Escherichia coli and application for immunodiagnosis

Pelargonium zonate spot virus (PZSV) is identified recently in tomato plants in the United States. To develop serological diagnostic tools for the detection of this virus, the production of good quality antibodies is a necessity. The coat protein (CP) gene of a California isolate of PZSV was cloned into a bacterial expression vector (pTriEX-4 Ek/LIC). The plasmid pTriEX-4-PZSV-CP was transformed into Escherichia coli Rosetta 2(DE3)pLacI and the recombinant PZSV-CP was expressed as a fusion protein containing N-terminal hexa-histidine and S tags. Expressed PZSV-CP was purified under denaturing conditions by affinity chromatography yielding 3 mg refolded protein per 200 mL of bacterial culture, and used as an antigen for raising PZSV-CP antiserum in rabbits. Specificity of the antiserum to PZSV was shown by Western blot and ELISA. When used in Western blot analysis, the antiserum was able to detect the recombinant protein, the PZSV coat protein and PZSV infected plant samples. The antiserum was successfully used in indirect-ELISA at dilutions of up to 1:16,000 to detect PZSV in infected leaf samples. Direct ELISA was successful only with denatured antigens. This is the first report on production of polyclonal antiserum against recombinant coat protein of PZSV and its use for detection and diagnosis of virus using serological methods.

First Report of Pelargonium zonate spot virus from Tomato in the United States.

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5' TGGCTGGCTTTTTCCGAACG 3' and R1-R: 5' CCTAATCTGTTGGTCCGAACTGTC 3'), RNA2 (R2-F: 5' GCGTGCGTATCATCAGAAATGG 3' and R2-R: 5' ATCGGGAGCAG AGAAACACCTTCC 3'), and RNA3 (R3-F: 5' CTCACCAACTGAAT GCTCTGGAC 3' and R3-R: 5' TGGATGCGTCTTTCCGAACC 3') for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States.

Evolutionary relationships among members of the Bromoviridae deduced from whole proteome analysis

Many molecular phylogenies of viruses build upon the analysis of single genes. The study of whole-genomes, however, might yield more reliable information to infer tree topologies and a better approach for drawing the evolutionary history of virus families. In this study, we apply a novel comparative proteomic approach to seek whether incorporating information from the entire proteome would support the actual taxonomy of the family Bromoviridae. Our results suggest that the current taxonomic classification should be modified in several aspects to account for the genomic properties of the Bromoviridae. These differences are: i) Alfalfa mosaic virus (AMV) is a true Ilarvirus instead of constituting an independent genus; ii) Pelargonium zonate spot virus (PZSV) should be considered as a member of the Bromoviridae; and iii) the genus Ilarvirus should be divided into fewer phylogenetic subgroups than suggested by antigenic differences.

Complete nucleotide sequence of Pelargonium zonate spot virus and its relationship with the family Bromoviridae.

The complete sequence of the Pelargonium zonate spot virus (PZSV) genome was determined. It comprises 8477 nt, distributed in three positive-strand RNA species encoding four proteins. RNA-1 is 3383 nt long, with an ORF that encodes a polypeptide with a molecular mass of 108 419 Da (denoted protein 1a). This protein contains the conserved sequence motifs I-III of type I methyltransferases and the seven consensus motifs of the helicases of superfamily 1. RNA-2 is 2435 nt long and encodes a major polypeptide with a molecular mass of 78 944 Da (denoted protein 2a), which shows identity to the RNA-dependent RNA polymerases of positive-strand RNA viruses. RNA-3 is 2659 nt long and contains two major ORFs. The first ORF is located in the 5' portion of the genome and sequence comparison of the putative translation product revealed similarities with the 30K superfamily of virus movement proteins. The second ORF is located in the 3' half and encodes the viral coat protein, which is expressed via a subgenomic RNA, RNA-4. The transcription initiation site of RNA-4 maps to the intergenic region of RNA-3. The organization of the PZSV genome, including the primary structure of terminal non-coding regions, strongly suggests that this virus belongs to the family Bromoviridae. The overall biological and genomic characteristics of PZSV indicate affinities in diverging directions with one or other of the virus species in this family, thus enabling it to be considered as a possible representative of a new genus within the family Bromoviridae.