PCR-amplified DNA Research Articles

Detection of suid herpesvirus 1 infectivity in pigs by propidium monoazide-qPCR.

At present, there is no effective experimental method for detecting whether the suid herpesvirus 1 (SHV-1) detected in pigs is infectious. Although the technique of quantitative polymerase chain reaction (qPCR) has significantly improved the detection rate and accuracy of the disease, it does not differentiate between infective and non-infective status of the virus. Propidium monoazide (PMA) is a dye that can be combined with DNA molecules. The decomposition of PMA produces an azene compound covalently crosslinked with DNA molecules, thereby inhibiting PCR amplification of DNA. In this study, the combination of PMA and qPCR was used to determine the infectivity of SHV-1. We optimized the method from the selection of primers, the working concentration of PMA, and the method of inactivation using UV or heat inactivation. We found that when specific primer 1 was used and a PMA working concentration was 50-100 μM, heat inactivation was able to distinguish whether SHV-1 was infectious or not. We also showed that UV prevented the virus from replicating, it did not destroy the capsid of the virus, and therefore, PMA cannot enter the virus and bind to the nucleic acid of the virus. Consequently, there is no way to identify the infectivity of the virus using UV inactivation. The study showed that the method was stable and the detection rate reached 96%. In conclusion, this method exhibited strong specificity and high sensitivity and can identify the infectivity of SHV-1. This method has practical significance for clinical virus isolation and the effects of disinfection of farms.

Ileal and cecal microbiota response to Salmonella Typhimurium challenge in conventional and slow-growing broilers.

Despite the negative impacts of Salmonella intestinal colonization on human health, Salmonella is a natural colonizer of the gastrointestinal tract and is not overtly pathogenic to the avian host. It is of interest to understand the impacts and colonization rates of Salmonella across selected genetic lines such as slow-growing (SG) and conventional (CONV) broilers. The objective of this study was to characterize the relationship between Salmonella enterica serovar Typhimurium challenge and selected broiler genetic lines on the ileal and cecal microbiome. Male chicks of two broiler breeds (n = 156/breed) were cohoused in an open floor pen until day 7. On day 13, the chicks were then separated into 12 isolators per breed (4 rooms, 6 isolators/room, 11 chicks/isolator). On day 14, chicks in the 12 treatment isolators (6 isolators/breed, 108 total) were challenged with Salmonella Typhimurium (ST) (1 × CFU/ml) via oral gavage while the remaining chicks (n = 108) were given an oral gavage of sterile tryptic soy broth control (C). Ileal and cecal contents were collected on day 7 from 24 chicks of each breed, and on days 13, 17, 21, and 24 from two chicks per isolator. Samples underwent DNA extraction and PCR amplification to obtain 16S rRNA amplicons that were sequenced with Illumina MiSeq. Salmonella Typhimurium colonization in the cecum was not different in the two broiler breeds. The main effect of breed had the greatest impact on the ileum microbiota of broilers 7 days of age where SG broilers had significantly lower diversity and richness compared to CONV broilers (p < 0.05). Salmonella Typhimurium challenge consistently caused a change in beta diversity. Regardless of day or intestinal location, challenged broilers had many amplicon sequence variants (ASVs) with decreased abundance of likely beneficial bacteria such as Mollicutes RF39, Shuttleworthia, Flavonifractor, and Oscillibacter compared to broilers that were unchallenged with Salmonella Typhimurium (p < 0.05). Additionally, there was a difference in the timing of when the microbiota alpha and beta diversity of each breed responded to Salmonella Typhimurium challenge. Thus, both broiler breed and Salmonella Typhimurium can impact the intestinal microbiota.

Development of rapid DNA extraction and PCR amplification methods for fungi and parasitic plants

Development of rapid DNA extraction and PCR amplification methods for fungi and parasitic plants

P454 Massive parallel fungal sequencing on formalin-fixed tissues: development and contribution in integrated histomolecular diagnosis

Poster session 3, September 23, 2022, 12:30 PM - 1:30 PM ObjectivesHistopathology is the gold standard for distinguishing between colonization and fungal infection, but it does not provide a precise diagnosis of genera/species. However, if the culture is negative or if no specimen is sent to the Mycology laboratory, only the specimen sent to the Pathology department is available. Formalin fixation and paraffin embedding (FFPE) cause DNA damage, making it difficult to perform molecular techniques.The objective was to develop and evaluate the contribution of massive parallel sequencing (MPS) to FFPE tissues.MethodsHistopathological review of all cases was performed. Then, DNA extraction from FFPE tissues was optimized by: (1) macrodissecting the fungal-rich area on the paraffin block; (2) comparing the efficiency of two DNA extraction kits (QIAamp DNAmicro-kit, QIAGEN; Maxwell 16 LEVRNA FFPE Purification kit, Promega, optimized for RNA and DNA extraction), by comparison of Aspergillus fumigatus and Mucorale specific PCR results for 30 cases. For 124 other cases, the sensitivity of two primer pairs (ITS3/4 and MITS2A/2B) was tested for identification by Sanger sequencing and then MPS. Finally, a histomolecular comparison was performed. This work was funded by the Société de Pathologie Infectieuse de Langue Française (SPILF).ResultsTo optimize extraction, DNA was extracted by both kits from samples of 16 mucormycoses and 14 A. fumigatus infections. PCR sensitivity was better with the QIAGEN extraction kit [100% (30/30)] compared to the Promega kit [86.7% (26/30)].PCR amplification of fungal DNA from an additional 124 FFPE samples was performed. The primer pairs ITS3/4 and MITS2A/2B, allowed: (1) identification by Sanger sequencing-histopathological analysis in 38.7% (48/124) of the cases in total, and more specifically 33% (41/124) of cases with the ITS3/4 primers and 32.3% (40/124) of cases with the MITS2A/B primers; and (2) identification by integrated SMP-histopathological analysis in 75% (93/124) of all cases (primers ITS3/4 and MITS2A/2B), and more specifically 66.1% (82/124) for ITS3/4 and 62.1% (77/124) for MITS2A/B (both primer pairs did not detect/amplify the same fungal genera/species). The combination of all results from Sanger sequencing and MPS led to fungal identification in 75.8% (94/124) of cases. In total, the addition of NGS to Sanger sequencing increased the diagnostic proportion by 36.3% (45/124; P <.0001). Example of integrated histomolecular diagnosis (Fig. 1): patient with a pseudotumor presentation of pulmonary invasive aspergillosis (A: thoracic CT scan; B: macroscopic examination of lesion after formalin fixation; C, D, E: Hematoxylin-eosin-safran, x20 and x400: observation of a necrotic mass caused by hyalohyphomycetes; F: Grocott, x400) with no culture or molecular identification available on fresh tissue. In contrast, identification by MPS on FFPE tissue was compatible with morphological analysis: Aspergillus section Fumigati, leading to the integrated histomolecular diagnosis of pulmonary invasive aspergillosis.ConclusionThe development of the fungal MPS on FFPE tissues is innovative and unprecedented for the achievement of an integrated histomolecular diagnosis in fungal pathology. It increases significantly the diagnostic proportion by 36.3%. This strategy can be used in hospitals and could improve patient management, especially when no sample is sent to the Mycology laboratory or when the culture is negative.

Analysis of the Relationship Between IL-10 Gene Polymorphism and Hypertension Susceptibility in Han Nationality in Jianghan Plain

Objective: To analyze the association between interleukin-10 (IL-10) promoter-1082 and -819 polymorphisms and hypertension in Han nationality in Jianghan Plain. Methods: A total of 50 Han patients with hypertension in Jianghan Plain, who were hospitalized in our hospital from March 2018 to April 2018, were selected as the experimental group. 50 healthy Han Chinese people in Jianghan Plain were selected as the control group. After a series of reactions such as genomic DNA extraction and PCR amplification, polymorphisms of IL-10-819 and -1082 were performed using ABI's BAT3.1 sequencing kit. Analysis and analysis of the risk of developing hypertension at each point. Results: There were three genotypes of C/C, C/T and T/T in the IL-10-819 locus. There was no significant difference between the two groups (P&gt;0.05). There were G/G, G/A and A/A genotypes in IL-10-1082 loci in both groups. There was no significant difference between the two groups (P&gt;0.05). Logistic regression analysis showed that compared with IL-10-819C/C genotype, the risk of hypertension in the population carrying IL-10-819C/T and T/T genotypes was OR＝1.19 (95%CI＝0.71~1.05), χ２=0.73, P&gt;0.05, OR＝1.05 (95%CI＝1.01~1.10), χ２=0.96,P&gt;0.05, the difference was not statistically significant (P&gt;0.05). Compared with IL-10-1082A/A, the risk of developing hypertension in the population expressing IL-10-1082G/A and G/G genotypes was OR＝1.2 (95%CI＝0.76~1.12), χ２=0.704, P&gt;0.05, OR＝1.33 (95% CI＝0.77~1.33), χ２=0.97, P&gt;0.05, the difference was not statistically significant (P&gt;0.05). Conclusion: The distribution of genotypes and alleles of IL-10-819 and -1082 loci in Han patients with hypertension and healthy people in Jianghan Plain is similar, and the genotype mutations of IL-10-819 and -1082 are irrelevant with hypertension.

High-Resolution Melting Analysis Enables Efficient Detection and Differentiation of Two Boxwood Blight Pathogens by qPCR Assays

Boxwood blight is a devastating disease caused by the fungal pathogens Calonectria henricotiae ( Che) and C. pseudonaviculata ( Cps). Identification and detection of these pathogens from infected plant material could play a significant role in breeding and selection of resistant cultivars and development of disease management strategies in the ornamental nursery industry. We designed a simple, single-tube method for extraction of PCR-amplifiable DNA from boxwood leaves and cultures of the Calonectria pathogens. Previously developed fungal-specific primers based on histone and calmodulin regions were used to detect and distinguish between Che and Cps using real-time PCR and high-resolution melting (HRM) analysis, with discernable melting temperature differences of 0.5°C between amplified products. Here, we describe a single-tube acetone-based DNA extraction method and qPCR-HRM assay targeting single nucleotide polymorphisms within the calmodulin and histone H3 DNA regions as a fast and highly sensitive molecular method to detect and differentiate between Che and Cps species directly from plant tissue. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license .

Abstract P1043: Myocardial Infarction Induces Translocation Of Gut Bacteria To The Heart

Introduction: Myocardial hypoxia &amp; intestinal hyperpermeability (IH) are two important events commonly observed in the aftermath of a myocardial infarction (MI) event. Recent studies have shown that gut bacteria and their metabolites are able to leak into the systemic circulation due to post-MI IH. Hypothesis: We hypothesized that facultative anaerobic gut bacteria such as E. coli will be able to translocate and colonize the hypoxic heart post-MI. Methods: C57 mice were given an oral administration of 10e9 cfu of luciferase/GFP expressing E. coli Nissle (EcN). Permanent occlusion of LAD arteries was performed to induce MI. Mouse hearts were checked for presence of EcN using PCR at different timepoints (n=32), IHC (n=4), and siderophore-based PET imaging (n=2). Immunoblotting of heart tissue lysate was used to check for presence of GFP. Results: PCR amplification of DNA extracted from MI hearts of mice given oral EcN revealed cardiac presence of translocated EcN. IHC analysis further confirmed presence of EcN in the heart. Siderophore-based PET imaging &amp; radionuclide-based biodistribution studies revealed significantly higher uptake in the MI heart vs. Sham corroborating EcN presence. Immunoblotting revealed presence of GFP in cardiac tissue of MI mice suggesting that bacterial products and proteins could potentially translocate through the gut-heart axis. Conclusion: MI induced IH &amp; myocardial hypoxia contribute to the translocation of gut bacteria and colonization of the ischemic heart.

Effects of municipal wastewater effluents on the digestive gland microbiome of wild freshwater mussels (Lasmigona costata)

Gut microbial communities are vital for maintaining host health, and are sensitive to diet, environment, and chemical exposures. Wastewater treatment plants (WWTPs) release effluents containing antimicrobials, pharmaceuticals, and other contaminants that may negatively affect the gut microbiome of downstream organisms. This study investigated changes in the diversity and composition of the digestive gland microbiome of flutedshell mussels (Lasmigona costata) from upstream and downstream of two large (service >100,000) WWTPs. Mussel digestive gland microbiome was analyzed following the extraction, PCR amplification, and sequencing of bacterial DNA using the V3-V4 hypervariable regions of the 16 S rRNA gene. Bacterial alpha diversity decreased at sites downstream of the second WWTP and these sites were dissimilar in beta diversity from sites upstream and downstream of the first upstream WWTP. The microbiomes of mussels collected downstream of the first WWTP had increased relative abundances of Actinobacteria, Bacteroidetes, and Firmicutes, with a decrease in Cyanobacteria, compared to upstream mussels. Meanwhile, those collected downstream of the second WWTP increased in Proteobacteria and decreased in Actinobacteria, Bacteroidetes, and Tenericutes. Increased Proteobacteria has been linked to adverse effects in mammals, but their functions in mussels is currently unknown. Finally, effluent-derived bacteria were found in the microbiome of mussels downstream of both WWTPs but not in those from upstream. Overall, results show that the digestive gland microbiome of mussels collected upstream and downstream of WWTPs differed, which has implications for altered host health and the transport of WWTP-derived bacteria through aquatic ecosystems.

Mutant vary region of pncA gene sequence of pyrazinamide resistance among multidrug resistant Mycobacterium tuberculosis isolates

ABSTRACT Introduction: Pyrazinamide (PZA) is one of the potent front-line drugs that act as antituberculosis (antiTB) for nonresistant or resistant Mycobacterium tuberculosis. Mutation of pncA gene is considered to be main target of PZA resistance mechanism. This study aims to determine the mutant gene sequences, location, and correlation of pncA gene mutations with PZA resistance in MDR Mycobacterium tuberculosis as a base for the rapid molecular examination. Objective: This study aims to determine the mutant gene sequence and location of pncA gene with PZA resistance in multidrug resistant (MDR) Mycobacterium tuberculosis need a rapid molecular examination for consideration of MDR TB therapy management in Indonesia. Methods: MDR Mycobacterium tuberculosis were identified and tested for PZA resistance with BACTEC MGIT 960 as a gold standard, followed by DNA extraction, PCR amplification and pncA gene sequencing. Results: An analysis of 561 bp sequence of nucleotides was performed to determine type and location of mutations. A total of 35 isolates of this study showed 14 isolates of pncA gene mutation (40%), and revealed in 13 resistant and 1 sensitive isolate. The correlation analysis of pncA gene mutation to PZA resistance was significant (p = 0,003 and r = 0,452). Mutations in 3 (three) specific regions of pncA gene are 1 isolate at codons 51-76, 1 isolate at codons 130-142, and 3 isolates at codons 163-180. Conclusion: Types of mutations in the pncA gene include substitution of 11 isolates, insertion of 2 isolates, and no deletion. Insertion of 178 CGCGCTGGAGGAGATGCGCACCGCC and multiple mutations in one isolate.

Molecular Characterization of 18S rDNA, ITS-1, ITS-2, and COI from Eimeria christenseni and E. arloingi in Goats from Shaanxi Province, Northwestern China.

Simple SummaryThis study first determined the 18S rDNA, ITS-1, ITS-2, and COI sequences of E. christenseni and E. arloingi. The lengths of the 18S rDNA, ITS-1, ITS-2, and COI were 1790 bp, 403 bp, 584 bp, and 1268 bp for E. arloingi and 1796 bp, 386 bp, 565 bp, and 1268 bp for E. christenseni, respectively. Furthermore, phylogenetic analyses based on the 18S rDNA, ITS-1, ITS-2, and COI loci were conducted to assess the relationship of E. christenseni, E. arloingi, and other Eimeria species in ruminants.Coccidiosis caused by Eimeria is one of the most common and significant diseases in goats, leading to serious economic losses in the development of the goat industry. Although several genetic loci, such as 18S rDNA, ITS-1, ITS-2, and COI, have been applied in the molecular characterization of Eimeria in chicken, rabbits, turkey, and wildlife, little is known about these molecular markers of Eimeria in goats. In the present study, we isolated purified oocysts of highly pathogenic Eimeria arloingi and Eimeria christenseni from fecal samples of goats in Shaanxi province, China, and then subjected these purified oocysts to genomic DNA isolation, PCR amplification, and sequencing of 18S rDNA, ITS-1, ITS-2, and COI loci of Eimeria arloingi and Eimeria christenseni. Finally, the obtained sequences were used for phylogenetic analysis of Eimeria species in goats and other livestock. The lengths of the 18S rDNA, ITS-1, ITS-2, and COI were 1790 bp, 403 bp, 584 bp, and 1268 bp for E. arloingi and 1796 bp, 386 bp, 565 bp, and 1268 bp for E. christenseni, respectively. The phylogenetical analysis based on 18S rDNA indicated that E. christenseni and E. arloingi were the most closely related to ovine Eimeria, followed by E. bovis, E. ellipsoidalis, and E. zuernii from cattle. The phylogenetical analysis based on ITS-1 and ITS-2 could not effectively distinguish ovine Eimeria from caprine Eimeria. The phylogenetical analysis based on the COI locus could effectively distinguish between Eimeria species from goats and cattle, but it was ineffective in distinguishing between Eimeria species from sheep and goats. To the best of our knowledge, this is the first characterization of 18S rDNA, ITS-1, ITS-2, and COI in E. arloingi and E. christenseni; it can provide useful genetic markers for molecular epidemiological and population genetic studies on E. arloingi and E. christenseni in goats and contribute to the prevention and control of goat coccidiosis.

Evaluation and Comparison of Genomic DNA Extraction Methods and PCR Optimization on Archival Formalin-Fixed and Paraffin-Embedded Tissues of Oral Squamous Cell Carcinoma.

Recovery and amplification of nucleic acids from archived formalin-fixed tissue samples is the most developing field in retrospective genetic studies. We compared different deparaffinization methods and DNA isolation techniques, and intergroup comparisons were performed to evaluate the effectiveness of different storing methods for archival OSCC samples based on obtained mean DNA quantity, quality, and PCR amplification of the P53 gene. The study comprised 75 archival histologically diagnosed OSCC samples which were divided into Group I: Formalin-fixed paraffin-embedded tissue blocks and Group II: Long-term formalin-fixed tissue. A comparison of different deparaffinization methods showed that xylene deparaffinization is an efficient method to obtain suitable DNA. Comparing different DNA isolation techniques illustrated that the conventional phenol–chloroform method gives better integrity to DNA in contrast with the kit method. Comparison between FFPET and long-term FFT samples demonstrated that samples fixed in formalin overnight and embedded in wax yield better quality and quantity DNA in comparison with long-term samples fixed in formalin. To obtain suitable integrity of DNA, tissue samples should be stored by fixing in formalin overnight followed by preparation of paraffin tissue blocks, deparaffinization by xylene, and subjecting them to the conventional phenol–chloroform DNA isolation protocol.

Next-Generation Sequencing to Characterize Mitochondrial Genomic DNA Heteroplasmy.

Mitochondria play a very important role in many crucial cellular functions. Each eukaryotic cell contains hundreds of mitochondria with hundreds of mitochondrial genomes. Mutant and wild-type mitochondrial DNA (mtDNA) may co-exist as heteroplasmy and cause human disease. The purpose of the protocols in this article is to simultaneously determine the mtDNA sequence and quantify the heteroplasmy level using parallel sequencing. The protocols include mitochondrial genomic DNA PCR amplification of two full-length products using two distinct sets of PCR primers. The PCR products are mixed at an equimolar ratio, and the samples are then barcoded and sequenced with high-throughput next-generation sequencing technology. This technology is highly sensitive, specific, and accurate in determining mtDNA mutations and the degree/level of heteroplasmy. © 2022 Wiley Periodicals LLC. Basic Protocol 1: PCR amplification of mitochondrial DNA Basic Protocol 2: Analysis of next-generation sequencing of mitochondrial DNA Basic Protocol 3: Mutect2 pipeline for automated sample processing and large-scale data analysis.

The fecal microbiota transplantation response differs between patients with severe and moderate irritable bowel symptoms

Objectives Fecal microbiota transplantation (FMT) is a promising intervention for patients with irritable bowel syndrome (IBS). The present study aimed to identify any differences in FMT response between patients with severe and moderate IBS symptoms. Materials and method The study included the 164 patients who participated in our previous study, of which 96 (58.5%) and 68 (41.5%) had severe (S-IBS-S) and moderate (Mo-IBS-S) IBS, respectively. The patients were randomly divided into a placebo group (own feces) and 30-g and 60-g (donor feces) FMT groups. Patients completed three questionnaires that assessed their symptoms and quality of life at baseline and at 2 weeks, 1 month, and 3 months after FMT, and provided fecal samples before and 1 month after FMT. The fecal bacteria were analyzed using the 16S rRNA gene in PCR DNA amplification covering the V3–V9 variable genes. Results Response rates of the placebo group did not differ between S-IBS-S and Mo-IBS-S patients at 2 weeks, 1 month and 3 months after FMT. The response rates in the active treatment group were higher in S-IBS-S patients than in Mo-IBS-S patients at each observation time. FMT reduced abdominal symptoms and fatigue and improved the quality of life in patients with both severe and moderate IBS. Patients with S-IBS-S had higher levels of Eubacterium siraeum, and lower levels of Eubacterium rectale than Mo-IBS-S, after FMT. Conclusion Patients with S-IBS-S have a higher response rate to FMT and a marked improvement in fatigue and in quality of life compared with those with Mo-IBS-S. The clinical trial registration number is NCT03822299 and is available at www.clinicaltrials.gov.

Role of TLR9 methylation on its active transcription in apical inflammation.

To explore the methylation pattern, its role in transcriptional regulation and potential modifiers of methylation of the TLR9 gene in chronic periapical inflammation. In this cross-sectional study, apical lesions of endodontic origin (ALEO, n=61) and healthy periodontal ligaments (HPL, n=15) were included. Products from bisulfited and PCR-amplified DNA were analysed for their methylation profiles in the promoter region and at each CpG island. Additionally, TLR9 mRNA levels were quantified by qPCR and bivariate and multiple modelling were performed to better understand the influence of methylation on gene transcription. TLR9 mRNA levels were upregulated in ALEO compared to HPL (p<.001). TLR9 promoter CpG sites and CpG +2086 in the intragenic island 1 were demethylated in ALEO compared to HPL (p<.05). Multivariate analysis, adjusted by smoking and gender, revealed that demethylation of TLR9 promoter sites enhanced transcriptional activity, specifically demethylated CpGs at positions -736 and -683, (p=.02), which are close to CRE binding. Although ALEO reduced the global methylation of the gene promoter and intragenic-island 2 (p<.05) by -42.5 and -9.5 percentage points, respectively, age reduced the global methylation of intragenic-island 3 within the exon 2. Demethylations of TLR9 promoter CpG sites, along with the intragenic DNA methylation status, were involved in higher transcription in ALEO. Hence, chronic periapical inflammation and ageing modify the methylation status both in the gene promoter and in intragenic CpG islands.

Syngamus trachea in free-ranging white stork (Ciconia ciconia) nestlings in Switzerland.

Syngamosis is a disease caused by the strongylid nematode Syngamus trachea, which infects the respiratory tract of various bird species around the world. The parasite appears to be harmful for a wide variety of avian orders, occasionally leading to a fatal outcome, particularly in young birds.The aim of this study was to examine the parasitic fauna in deceased or euthanized, free-ranging white storks nesting at the Zoo Basel in 2019 and 2020; and to assess the extent to which these parasites contributed to the wild birds' death.In five out of 24 necropsied white storks, an infection with S. trachea was diagnosed based on morphological analysis of adult nematode stages and eggs, in combination with PCR amplification and sequencing of DNA extracted from female worms. The main pathological changes affected the white storks’ respiratory tract and a mixed cell tracheitis was diagnosed in the histopathological examination of three of the five infected birds. Some birds displayed additional lesions compatible with syngamosis, namely partially degenerated parasitic structures with concurrent granulomatous inflammation in the lung and multifocal acute hemorrhages in the bronchi and parabronchi. Coprological examinations (fecal flotation technique, fecal sedimentation technique, sodium acetate acetic acid formalin procedure and Ziehl-Neelsen staining) from the intestinal content as well as a PCR for Toxoplasma gondii on brain, lung, heart, liver, and spleen tissue yielded negative results in all examined individuals. In the absence of further major pathological findings, S. trachea was assumed to have significantly contributed to the death of the infected birds.

Low prevalence of Plasmodium falciparum parasites lacking pfhrp2/3 genes among asymptomatic and symptomatic school-age children in Kinshasa, Democratic Republic of Congo

BackgroundLoss of efficacy of diagnostic tests may lead to untreated or mistreated malaria cases, compromising case management and control. There is an increasing reliance on rapid diagnostic tests (RDTs) for malaria diagnosis, with the most widely used of these targeting the Plasmodium falciparum histidine-rich protein 2 (PfHRP2). There are numerous reports of the deletion of this gene in P. falciparum parasites in some populations, rendering them undetectable by PfHRP2 RDTs. The aim of this study was to identify P. falciparum parasites lacking the P. falciparum histidine rich protein 2 and 3 genes (pfhrp2/3) isolated from asymptomatic and symptomatic school-age children in Kinshasa, Democratic Republic of Congo.MethodsThe performance of PfHRP2-based RDTs in comparison to microscopy and PCR was assessed using blood samples collected and spotted on Whatman 903™ filter papers between October and November 2019 from school-age children aged 6–14 years. PCR was then used to identify parasite isolates lacking pfhrp2/3 genes.ResultsAmong asymptomatic malaria carriers (N = 266), 49%, 65%, and 70% were microscopy, PfHRP2_RDT, and pfldh-qPCR positive, respectively. The sensitivity and specificity of RDTs compared to PCR were 80% and 70% while the sensitivity and specificity of RDTs compared to microscopy were 92% and 60%, respectively. Among symptomatic malaria carriers (N = 196), 62%, 67%, and 87% were microscopy, PfHRP2-based RDT, pfldh-qPCR and positive, respectively. The sensitivity and specificity of RDTs compared to PCR were 75% and 88%, whereas the sensitivity and specificity of RDTs compared to microscopy were 93% and 77%, respectively. Of 173 samples with sufficient DNA for PCR amplification of pfhrp2/3, deletions of pfhrp2 and pfhrp3 were identified in 2% and 1%, respectively. Three (4%) of samples harboured deletions of the pfhrp2 gene in asymptomatic parasite carriers and one (1%) isolate lacked the pfhrp3 gene among symptomatic parasite carriers in the RDT positive subgroup. No parasites lacking the pfhrp2/3 genes were found in the RDT negative subgroup.ConclusionPlasmodium falciparum histidine-rich protein 2/3 gene deletions are uncommon in the surveyed population, and do not result in diagnostic failure. The use of rigorous PCR methods to identify pfhrp2/3 gene deletions is encouraged in order to minimize the overestimation of their prevalence.

Study single nucleotide polymorphism in Promoter region of UGT1A1 Gene in Iraqi Patients with Gilbert's syndrome

This study aimed to detect genetic variants of the UGT1A1 gene in patients with Gilbert's syndrome. To detect this, primers were designed; PCR and direct sequencing were done for the promoter area of the gene as a diagnostic tool for the detection of any polymorphism. Variation and polymorphism were detected within the promoter mutants of the UDP glycosyltransferase _UGT1A1 gene that causes hyperbilirubinemia in a group of Iraqi patients compared with a group of the normal healthy individual as controls. The patients with hyperbilirubinemia in this study were 30 in which the total bilirubin level was more than 12 mg/dl serum; they included 25 males and 5 females, while the control group consisted of 20 healthy individuals. This study was carried out from September 2019 till April 2021. The result displayed high occurrence of Gilbert syndrome within male patients than in females, and regarding the analyses of mutation of bilirubin UDP glycosyltransferase _UGT1A1 gene, it is clear that the genotypic distribution of variation among the hyperbilirubinemia patients included all 30 patients, while SNP was detected in 18 patients out of 30 which indicate that the UGT1A1 gene mutation was a likely risk factor for the development of hyperbilirubinemia related Gilbert syndrome in Iraq. The homozygous and heterozygous polymorphisms A/G inside the promoter region of the UGT1A1 gene were effectively identified by sequencing. Our finding suggests that TA repeats and allele of UGT1A1 polymorphism A/G are associated with Gilbert's syndrome and act as genetic markers of this disease in Iraqi patients. To analyze data and sequence variation in gene, generous software was used after amplifying the gene. All processes include DNA extraction, PCR amplification, sequencing, and assembly.

ALAD Allelic Frequency and Lead Toxicity in Children Under the Age of Five in a Former Used Lead-Acid Battery Area

Polymorphisms in the Aminolevulinic acid dehydratase (ALAD) gene responsible for the ALAD1 and ALAD2 alleles have been implicated in susceptibility to lead toxicity. This study aimed to determine the allelic frequency of ALAD2 among children living in Bogor District, Indonesia, and its association with BLLs and lead toxicity. A cross-sectional study involving 128 children was conducted during September-October 2019 in the former ULAB area in Cinangka Village. The ALAD polymorphism, BLLs, and hematological parameters were evaluated. Blood samples were taken for dried blood spotting on filter paper, blood film, and BLL measurement. PCR amplification and sequencing of the genomic DNA revealed the presence of two forms of the ALAD2 allele: 177C and 177T with a frequency of 0.05. Analysis of the correlation between the ALAD2 allele, BLLs, and basophilic stippling revealed that ALAD2 carriers had a five times higher risk of high BLLs, (OR=5.359, p=0.155) and had a slightly higher risk of exhibiting basophilic stippling (OR=1.09, p=1.000). Although not statistically significant, these findings suggested that the ALAD genotype may modify BLLs and lead to toxicity. The ALAD2 allele (177T) is firstly reported in any population in the world.

Variations on The Concentration and Purity of Oil Palm Flowers (Elais guineensis Jac.) in Some Extraction Methods for Identification of the Flowering Gene

Palm oil production is related to the number of fruit and is thought to be determined since the beginning of the flowering phase as the initial stage of fruit formation. Identification of oil palm flowing genes needs to be done as the first step of knowing the mechanism of flowering in oil palm molecular. Oil male and palm females contain high polysaccharides and polyphenolic compounds so they can inhibit the process of molecular identification. Molecular studies provide accurate and fast information about the potential of oil palm genetics as a commercial commercial commodity. The purity and concentration of DNA and the temperature of annealing are the main requirements for PCR-based molecular studies. The purpose of this study obtained the extraction method of oil palm flowers which produced high DNA concentration and purity and optimized the temperature of annealing to identify the flowering gene. DNA from male flower spike and female flowers is extracted using the A (SDS) method, method B (CTAB), method C (CTAB + PVP), and method D (commercial kit). Primary BMS annealing temperature for amplification of optimized flowering genes using PCR gradients. The extraction of male flowers and female flowers using the C (CTAB + PVP) method produces the best DNA concentration and purity compared to other methods. The best annealing temperature for male flower DNA amplification and female flowers using the BMS primer is 61.1 o C. Amplification of male flowers and female flowers using Primary BMS produces 1200 PB products. The results of DNA extraction and PCR amplification using the BMS primers in female flower samples are better than male flowers

Detection and Identification of a 'Candidatus Liberibacter solanacearum' Species from Ash Tree Infesting Psyllids.

'Candidatus Liberibacter' species are associated with severe, economically important diseases. Nearly all known species are putatively insect transmitted, specifically by psyllids. Detection of 'Ca. Liberibacter' in plants is complicated by their uneven distribution in host plants and largely fastidius nature. The death of black (Fraxinus nigra) and mancana (Fraxinus mandshurica) ash trees in Saskatchewan, Canada has been associated with infestation by the cottony ash psyllid (Psyllopsis discrepans). A combination of conventional PCR amplification and Sanger sequencing of the 16S recombinant DNA was used to detect and identify 'Ca. Liberibacter' in psyllids collected from ash trees in Saskatchewan. BLAST analysis of two 16S sequences that were 1,058 and 1,085 bp long (NTHA 5, GenBank accession number MK942379 and NTHA 6, GenBank accession number MK937570, respectively) revealed they were 99 to 100% similar to a 'Ca. Liberibacter solanacearum' sequence (GenBank accession number KX197200) isolated from the Nearctic psyllid (Bactericera maculipennis) of U.S. provenance. Sequencing the psyllid genes CO1 and Cyt-b confirmed that the psyllids from which the bacterial DNA was isolated were P. discrepans, based on comparisons with sequences in GenBank and BOLD and a reference sample from the United Kingdom. These results provide the first evidence that 'Ca. Liberibacter solanacearum' species are associated with psyllids collected from ash trees and specifically P. discrepans. The recent episodes of dieback of ash in Saskatchewan associated with psyllid feeding are consistent with disease symptoms caused by 'Ca. Liberibacter' pathogens, and this possibility warrants further study.