Pairs Of Sequences Research Articles

Characterization of the complete chloroplast genome of Gypsophila huashanensis Y. W. Tsui & D. Q. Lu, an endemic herb species in China

Gypsophila huashanensis Y. W. Tsui & D. Q. Lu (Caryophyllaceae) is an endemic herb species to the Qinling Mountains in China. In this study, we characterized its whole plastid genome using the Illumina sequencing platform. The complete plastid genome of G. huashanensis is 152,457 bp in length, including a large single-copy DNA region of 83,476 bp, a small single-copy DNA region of 17,345 bp, and a pair of inverted repeat DNA sequences of 25,818 bp. The genome contains 130 genes comprising 85 protein-coding genes, 37 tRNA genes, and eight rRNA genes. Evolutionary analysis showed that the non-coding regions of Caryophyllaceae exhibit a higher level of divergence than the exon regions. Gene site selection analysis suggested that 11 coding protein genes (accD, atpF, ndhA, ndhB, petB, petD, rpoCl, rpoC2, rps16, ycfl, and ycf2) have some sites under protein sequence evolution. Phylogenetic analysis showed that G. huashanensis is most closely related to the congeneric species G. oldhamiana. These results are very useful for studying phylogenetic evolution and species divergence in the family Caryophyllaceae.

Genetic heterogeneity between paired primary and metastatic solid tumors and implications for neoantigen-based personalized cancer vaccines.

3126 Background: Neoantigen-based personalized cancer vaccines carry significant promise in treating solid malignancies. For the purpose of neoantigen prediction, questions remain on the suitability of the primary versus the metastatic tumor of an individual patient (pt). Here we performed an in-depth analysis of somatic variants of 45 pts with paired primary and metastatic solid tumors. Methods: Pts were enrolled in the Total Cancer Care protocol across the Oncology Research Information Exchange Network (ORIEN). Whole-exome sequencing (WES) of primary and metastatic tumor pairs was performed for 45 pts. These included head and neck (n = 8), renal cell carcinoma (n = 7), non-small cell lung cancer (n = 6), melanoma (n = 5), bladder (n = 3), sarcoma (n = 3), ovary (n = 3), esophageal (n = 2), colorectal (n = 2) and other singletons (n = 5). The data was analyzed through the ORIEN AVATAR Molecular Analysis Pipeline, which consisted of adapter trimming, single sample variant detection, somatic mutation detection and filtering, variant annotation, and filtering of variants from a panel of normal samples. In this analysis, we focused on somatic events that result in an in-frame alteration (such as missense, in-frame insertion/deletion) and out-of-frame protein-altering mutations (such as frameshifts, de novo start and nonstop gain). To assign the clones based on the variant allele frequency, we performed complete linkage clustering. Each cluster was then assigned based on the identified oncogenic driver variant. Results: For in-frame events, we noticed that bladder cancer, melanoma, and gynecological cancers shared close to 75% of the mutations between paired primary and metastatic cases. In contrast, esophageal, brain, and endometrial cancers had a low overlap (< 25%) of variants. For out-of-frame events, we found that these events tend to have a lower proportion of shared somatic variants between primary and metastasis than in-frame variants. Through a closer evaluation of the variant allele frequency in variants shared between primary and metastatic disease, we were able to track several cancer drivers, such as oncogenic drivers of BRAF V600E, RB1 R358*, NRAS G13R, KRAS G12A, and TP53 loss-of-function that were consistently present in paired primary and metastatic tumors. Here, we were able to assign the putative clone based on the driver event in 39 out of 45 pts. Conclusions: Our analysis demonstrates genetic variations that exist when comparing paired primary and metastatic tumors that appear to vary by histology. Variants are potentially undergoing negative selection supported by the preferential loss of out-of-frame events in metastatic tumors. Understanding the clonal structure will be key to neoantigen prediction for effective neoantigen-based vaccines. Additional steps in variant prioritization are ongoing and will be reported at the meeting.

Single-cell RNA and T cell receptor (TCR) sequencing in patients with HPV-positive head and neck squamous cell carcinoma (HNSCC) after induction CTLA4 and PD-1 immune checkpoint blockade (ICB).

6056 Background: Combination CTLA-4 and PD-1 ICB results in durable responses in patients with recurrent and metastatic HNSCC and therefore justifies further investigation in the induction or neoadjuvant setting. Methods: We investigated features of the tumor immune microenvironment (TIME) associated with MHR after induction CTLA-4 and PD-1 ICB in patients with newly diagnosed HPV-positive HNSCC. Tumor samples were collected at baseline and on treatment from 31 patients enrolled in a phase 2 trial of a 6-week cycle of CTLA-4 and PD-1 ICB induction followed by dose/volume-adapted IMRT (50-66Gy) concurrent with cycle 2. Tumors were evaluated for histological response and single-cell RNA sequencing (scRNA-seq) and scTCR-seq were performed on the 10X genomics platform. After stringent clustering and annotation of scRNA-seq data, 76,319 CD8+ and 78,622 CD4+ T cells with paired TCR sequence data were evaluable for transcriptomic, TCR repertoire and clonotype differentiation analysis. Results: Percent reduction in tumor viability on histology correlated significantly with reduction in tumor cell proportion in scRNA-seq data (R2= 0.7). Thirteen (48%) of 27 patients with paired samples (missing data due to COVID) had MHR, defined as ≤10% residual tumor viability on ICB treatment. Through TCR tracing, over 100 T cell clonotypes that expanded significantly (p < 0.05, Fisher’s exact) post-ICB were identified. Highly expanded clonotypes resided mainly in exhausted CD8+ T cell clusters and exhibited a tissue resident memory (TRM) phenotype. Examination of their functional states revealed a variety of T cell modulatory trajectories, including reverse transition from exhausted to less exhausted states and from memory to functional states. When compared to patients without MHR, those with MHR had significantly higher ICB-induced TCR clonotype expansion (p = 0.025, Wilcoxon), reductions of activated Tregs (p = 0.003, Wilcoxon) and terminally exhausted CD8+ T cells (p = 0.003, Wilcoxon), and increase of polyfunctional CD8+ T cells (p = 0.014, Wilcoxon). A lasso regression model associated T cell expansion, basal 7-gene TRM and 5-gene effector scores, and on-treatment proliferation score and effector cell proportion with percent reduction in tumor viability (R2 = 0.66). Conclusions: In HPV-HNSCC, induction CTLA4 and PD1 ICB lead to extensive reinvigoration of CD8+ T cell clonotypes with both an exhausted and TRM phenotype, revealing a high degree of plasticity of distinct T cell clones. Paired RNA and TCR profiling facilitated identification of potentially tumor reactive and ICB-responsive T cells and clonotypes and identified several TIME features associated with tumor cell death. Clinical trial information: NCT03799445 .

Clinical synergy of universal paired tumor genomic and germline sequencing in an unselected, pan-cancer cohort of patients: Greater than the sum of the parts.

e22537 Background: Germline and tumor next-generation sequencing (NGS) are complementary tests whose benefit in capturing patients (pts) potentially eligible for precision therapies is maximized when the tests are paired, as qualifying pathogenic variants (PVs) are missed if either test was done in isolation (Lincoln et al. 2020). Germline NGS has the additional benefit of informing prevention through surveillance and cascade testing. We highlight the benefits of a universal approach to concurrent testing in a subset of the previously reported cohort of pan-cancer pts who underwent universal germline NGS (Samadder et al. 2020). Methods: Unselected pts with solid tumors underwent an 80+ gene germline panel and 315+ gene tumor panel. Variants in genes unique to the germline or tumor panels, including microsatellite instability (MSI) and tumor mutation burden (TMB), were also evaluated. Results: 104 pts [81.7% White, non-Hispanic, 71.2% male] with 23 cancer types [28% colorectal, 13% lung, 11% prostate, 49% other] were included. Five (5%) pts had no actionable tumor alterations or germline variants identified (Table). 18 pts (17%) had 19 pathogenic germline variants (PGVs) identified, 11 (58%) of which were detected on tumor NGS (Table). 92 pts had >1 tumor alteration identified, of which 12% were confirmed as PGVs (Table). Notably, tumor NGS revealed 81 pts (78%) pts with biomarkers that would could not have been identified with germline testing alone, such as variants in genes not on germline panel (80) or MSI-high (4), or TMB-high (21) status of the tumor. Conclusions: Germline and tumor NGS are complementary tests that often detect different actionable alterations. There is value in confirming both the presence and absence of somatic variants in the germline in order to make appropriate clinical recommendations for the patient and their family members. [Table: see text]

Spectrum of acquired KRAS mutations in driver mutation-positive non-small cell lung cancer.

9069 Background: With the emergence of effective targeted-therapies for KRAS G12C, and the development of promising agents for KRAS G12V and G12D among others, the identity of unique KRAS mutations in non-small cell lung cancer (NSCLC) has become increasingly relevant. Acquired KRAS mutations are a known mechanism of resistance observed across driver mutation-positive (DM+) NSCLC. The incidence and diversity of these acquired alterations, and whether they differ from those observed in de novo KRAS-mutated NSCLC, is unknown. Methods: NSCLC molecular profiles were obtained using next-generation sequencing (Caris Life Sciences) with paired whole-transcriptomic sequencing (Illumina NovaSeq) and immunohistochemistry (Caris Life Sciences). Demographic data were abstracted from medical records. KRAS mutation diversity was defined for de novo KRAS-mutated ( KRASmt) NSCLC ( KRAS as only identified driver – KRASmt_dn) and DM+ NSCLC with acquired KRAS mutations (concurrent KRASmt with other known driver – KRASmt_acq). Fisher’s exact test was used to compare the distribution of unique KRAS mutations between the groups. Due to the unique biology of NSCLC with class II/III BRAF mutations, this subset was removed from the KRASmt_acq subgroup for the final analysis. Results: A total of 5932 KRASmt NSCLC samples were identified, among which 5879 were KRASmt_dn and 53 were KRASmt_acq (see table). The distribution of unique KRAS mutations was not significantly different between groups (p = 0.14). Within the KRASmt_dn group, KRAS G12C was most common (40%), followed by G12V (19%), G12D (14%), G12A (7%) and Q61H/G13C (4% each). In the KRASmt_acq group, KRAS G12C was most common (30%), followed by G12D (19%), G12V (17%), Q61H (11%), G12A (7%), and G13C (6%). The most common observed driver mutations in the KRASmt_acq group were EGFR (38%) and MET (30%). In the EGFR group, KRAS G12D (25%), Q61H/G12C (20% each), G12V/G13C (10% each), and G12F/A/R (5% each) were observed. In the MET group, KRAS G12C (25%), G12D/V/A (19% each), Q61H (12%) and G12S (6%) were seen. Among 7 patients with a documented history of smoking in the KRASmt_acq group, KRAS G12D and Q61H were most common (29% each), followed by G12V/F and G13C (14% each). Conclusions: While the distribution of unique KRAS mutations did not differ significantly between KRASmt_dn and KRASmt_acq groups, acquired KRAS mutations were seen across DM+ NSCLC subsets, among which the frequency of observed mutations appeared to vary. The functional and immunological significance of these mutations, and their impact on clinical outcomes, warrants further investigation. [Table: see text]

Characterization of the immunophenotype and tumor specificity of CD8+ T-cells in chromophobe renal cell carcinoma (ChRCC) and renal oncocytic neoplasms.

4558 Background: ChRCC is an uncommon kidney cancer variant that has a poor prognosis in the metastatic setting, with limited response to current standard-of-care immune checkpoint inhibitors (ICIs) used for other RCC histologies. We evaluated the tumor-immune microenvironment of ChRCC and other related oncocytic neoplasms to better understand the immunophenotype of these tumors. Methods: We performed paired single-cell RNA sequencing (scRNA-seq), single-cell T-cell receptor sequencing (scTCR-seq), and CD45 immunohistochemistry (IHC) of ChRCC, renal oncocytoma (RO) and low-grade oncocytic tumor (LOT) tumor and matched normal samples. Bulk RNA-sequencing (RNA-seq) data of clear cell RCC (ccRCC), papillary RCC (pRCC) and ChRCC were additionally analyzed using The Cancer Genome Atlas (TCGA) kidney cancer cohorts. T cell antigenic specificities from scTCR-seq were inferred using a comprehensive database of annotated T-cell receptor sequences (VDJdb). Single-cell transcriptomic signatures were used to infer the tumor specificity (Oliveira G, Nature, 2021 and Lowery FJ, Science, 2022) and viral specificity (Oliveira G, Nature, 2021) of CD8+ T-cells from ChRCC, as compared to those from ccRCC (Braun DA, Cancer Cell, 2021). Results: ChRCC and other oncocytic tumors had a lower infiltration of CD45+ immune cells as compared to ccRCC (p<0.01). Single-cell analysis was performed on 46,817 cells from 5 tumors (ChRCC: n=3, RO: n=1 and LOT: n=1) and 4 normal samples. Across all tumors, CD8+ T cell clusters displayed a lower expression of immune checkpoints (i.e. PDCD1 [PD-1], CTLA4, LAG3, HAVCR2 [TIM-3], and TIGIT) as compared to ccRCC. This was further validated in a bulk RNA-seq analysis using TCGA data, with a significantly lower expression of all immune checkpoints in ChRCC compared to both ccRCC (p<0.01) and papillary RCC (pRCC; p<0.01). Analysis of the T cell receptor repertoire (scTCR-seq) of ChRCC, RO and LOT samples did not show any pattern of clonal expansion, and a higher proportion of T cells in ChRCC were inferred to have a viral specificity, as compared to ccRCC (0.79 vs. 0.1%, respectively). CD8+ T cells from ChRCC (vs. ccRCC) displayed a significantly lower expression of two signatures of tumor specificity (p<0.01), and a higher expression of the viral-specific signature (p<0.01). Conclusions: In ChRCC, there is low infiltration by CD45+ immune cells. Although infiltrating CD8+ T cells have a predominantly non-exhausted immune phenotype, they likely lack anti-tumor specificity (i.e. are “bystander” T cells). These findings may help to understand the molecular basis for the lack of response to immunotherapy recently identified among patients with advanced ChRCC, and support future therapeutic strategies to increase infiltration of tumor-specific T cells into the tumor microenvironment.

JUMP: replicability analysis of high-throughput experiments with applications to spatial transcriptomic studies.

Replicability is the cornerstone of scientific research. The current statistical method for high-dimensional replicability analysis either cannot control the false discovery rate (FDR) or is too conservative. We propose a statistical method, JUMP, for the high-dimensional replicability analysis of two studies. The input is a high-dimensional paired sequence of p-values from two studies and the test statistic is the maximum of p-values of the pair. JUMP uses four states of the p-value pairs to indicate whether they are null or non-null. Conditional on the hidden states, JUMP computes the cumulative distribution function of the maximum of p-values for each state to conservatively approximate the probability of rejection under the composite null of replicability. JUMP estimates unknown parameters and uses a step-up procedure to control FDR. By incorporating different states of composite null, JUMP achieves a substantial power gain over existing methods while controlling the FDR. Analyzing two pairs of spatially resolved transcriptomic datasets, JUMP makes biological discoveries that otherwise cannot be obtained by using existing methods. An R package JUMP implementing the JUMP method is available on CRAN (https://CRAN.R-project.org/package=JUMP).

ImmuneBuilder: Deep-Learning models for predicting the structures of immune proteins

Immune receptor proteins play a key role in the immune system and have shown great promise as biotherapeutics. The structure of these proteins is critical for understanding their antigen binding properties. Here, we present ImmuneBuilder, a set of deep learning models trained to accurately predict the structure of antibodies (ABodyBuilder2), nanobodies (NanoBodyBuilder2) and T-Cell receptors (TCRBuilder2). We show that ImmuneBuilder generates structures with state of the art accuracy while being far faster than AlphaFold2. For example, on a benchmark of 34 recently solved antibodies, ABodyBuilder2 predicts CDR-H3 loops with an RMSD of 2.81Å, a 0.09Å improvement over AlphaFold-Multimer, while being over a hundred times faster. Similar results are also achieved for nanobodies, (NanoBodyBuilder2 predicts CDR-H3 loops with an average RMSD of 2.89Å, a 0.55Å improvement over AlphaFold2) and TCRs. By predicting an ensemble of structures, ImmuneBuilder also gives an error estimate for every residue in its final prediction. ImmuneBuilder is made freely available, both to download (https://github.com/oxpig/ImmuneBuilder) and to use via our webserver (http://opig.stats.ox.ac.uk/webapps/newsabdab/sabpred). We also make available structural models for ~150 thousand non-redundant paired antibody sequences (https://doi.org/10.5281/zenodo.7258553).

Rapid TCR:Epitope Ranker (RAPTER): a primary human T cell reactivity screening assay pairing epitope and TCR at single cell resolution

Identifying epitopes that T cells respond to is critical for understanding T cell-mediated immunity. Traditional multimer and other single cell assays often require large blood volumes and/or expensive HLA-specific reagents and provide limited phenotypic and functional information. Here, we present the Rapid TCR:Epitope Ranker (RAPTER) assay, a single cell RNA sequencing (scRNA-SEQ) method that uses primary human T cells and antigen presenting cells (APCs) to assess functional T cell reactivity. Using hash-tag oligonucleotide (HTO) coding and T cell activation-induced markers (AIM), RAPTER defines paired epitope specificity and TCR sequence and can include RNA- and protein-level T cell phenotype information. We demonstrate that RAPTER identified specific reactivities to viral and tumor antigens at sensitivities as low as 0.15% of total CD8+ T cells, and deconvoluted low-frequency circulating HPV16-specific T cell clones from a cervical cancer patient. The specificities of TCRs identified by RAPTER for MART1, EBV, and influenza epitopes were functionally confirmed in vitro. In summary, RAPTER identifies low-frequency T cell reactivities using primary cells from low blood volumes, and the resulting paired TCR:ligand information can directly enable immunogenic antigen selection from limited patient samples for vaccine epitope inclusion, antigen-specific TCR tracking, and TCR cloning for further therapeutic development.

The Impact of Germline Alterations in Appendiceal Adenocarcinoma.

More than 10% of assessed patients with appendiceal adenocarcinoma have a pathogenic (P) or likely pathogenic (LP) germline variant, including genes implicated in heritable gastrointestinal cancer syndromes, such as Lynch syndrome. We defined the clinical and molecular impact of heritable alterations in appendiceal adenocarcinoma to evaluate the need for dedicated appendiceal screening and prevention strategies in patients with LP/P germline variants. We performed an integrated germline and somatic molecular analysis for patients with confirmed appendiceal adenocarcinoma. Patients underwent paired tumor-normal sequencing for up to 90 hereditary cancer risk genes and 505 genes for somatic mutation profiling. We defined the cooccurrence of LP/P germline variants and second-hit pathogenic somatic alterations. The associations between germline variants and patient clinicopathologic features were also evaluated. Twenty-five of 237 patients (10.5%) carried pathogenic or likely pathogenic germline variants in cancer susceptibility genes. Clinicopathologic characteristics and appendiceal adenocarcinoma-specific survival were similar in patients with or without germline variants. Most (92%, N = 23/25) patients with germline variants demonstrated no second-hit somatic alterations, including loss of heterozygosity. Two patients with a germline APC I1307K low-penetrance founder variant exhibited secondary somatic pathogenic alterations in APC. However, only one patient tumor exhibited APC-mediated WNT signaling dysregulation: a plausible consequence of multiple somatic APC mutations with no germline variant contribution. Four patients had germline variants in PMS2 or MSH2 associated with Lynch syndrome, yet their cancers were microsatellite-stable. Germline variants are likely incidental without a contributory driver role in appendiceal adenocarcinoma. Appendiceal adenocarcinoma screening in patients with germline variants is not clearly merited.

Increased mutation and gene conversion within human segmental duplications

Single-nucleotide variants (SNVs) in segmental duplications (SDs) have not been systematically assessed because of the limitations of mapping short-read sequencing data1,2. Here we constructed 1:1 unambiguous alignments spanning high-identity SDs across 102 human haplotypes and compared the pattern of SNVs between unique and duplicated regions3,4. We find that human SNVs are elevated 60% in SDs compared to unique regions and estimate that at least 23% of this increase is due to interlocus gene conversion (IGC) with up to 4.3 megabase pairs of SD sequence converted on average per human haplotype. We develop a genome-wide map of IGC donors and acceptors, including 498 acceptor and 454 donor hotspots affecting the exons of about 800 protein-coding genes. These include 171 genes that have ‘relocated’ on average 1.61 megabase pairs in a subset of human haplotypes. Using a coalescent framework, we show that SD regions are slightly evolutionarily older when compared to unique sequences, probably owing to IGC. SNVs in SDs, however, show a distinct mutational spectrum: a 27.1% increase in transversions that convert cytosine to guanine or the reverse across all triplet contexts and a 7.6% reduction in the frequency of CpG-associated mutations when compared to unique DNA. We reason that these distinct mutational properties help to maintain an overall higher GC content of SD DNA compared to that of unique DNA, probably driven by GC-biased conversion between paralogous sequences5,6.

A draft human pangenome reference

Here the Human Pangenome Reference Consortium presents a first draft of the human pangenome reference. The pangenome contains 47 phased, diploid assemblies from a cohort of genetically diverse individuals1. These assemblies cover more than 99% of the expected sequence in each genome and are more than 99% accurate at the structural and base pair levels. Based on alignments of the assemblies, we generate a draft pangenome that captures known variants and haplotypes and reveals new alleles at structurally complex loci. We also add 119 million base pairs of euchromatic polymorphic sequences and 1,115 gene duplications relative to the existing reference GRCh38. Roughly 90 million of the additional base pairs are derived from structural variation. Using our draft pangenome to analyse short-read data reduced small variant discovery errors by 34% and increased the number of structural variants detected per haplotype by 104% compared with GRCh38-based workflows, which enabled the typing of the vast majority of structural variant alleles per sample.

Linearization and connection coefficients of polynomial sequences: A matrix approach

For any sequence of polynomials {pk(t)} in one real or complex variable, where pk has degree k for k≥0, we find explicit expressions and recurrence relations for infinite matrices whose entries are the numbers d(n,m,k), called linearization coefficients, that satisfypn(t)pm(t)=∑k=0n+md(n,m,k)pk(t),n,m≥0. For any pair of polynomial sequences {uk(t)} and {pk(t)} we find infinite matrices whose entries are the numbers e(n,m,k) that satisfypn(t)pm(t)=∑k=0n+me(n,m,k)uk(t),n,m≥0. We also obtain recurrence relations and other properties of the linearization coefficients. Such results are obtained using only simple algebraic properties of infinite matrices. We apply the general results to general orthogonal polynomial sequences and to some simple families of orthogonal polynomials, such as the Chebyshev, Hermite, and Charlier families.

Exome Sequencing of Paired Colorectal Carcinomas and Synchronous Liver Metastases for Prognosis and Therapy Prediction.

Analysis of somatic variant profiles in retrospectively collected pairs of primary tumors and synchronous liver metastases from surgically treated patients with colorectal carcinomas. Mutational profiles were compared between groups of patients stratified by response to chemotherapy and survival. The study used whole-exome sequencing of tumor sample pairs from 20 patients diagnosed and treated at a single center. The Cancer Genome Atlas COAD-READ data set (n = 380) was used for validation in silico, where possible. The most frequently altered oncodrivers were APC (55% in primaries and 60% in metastases), TP53 (50/45), TRIP11 (30/5), FAT4 (20/25), and KRAS (15/25). Harboring variants with a high or moderate predicted functional effect in KRAS in primary tumors was significantly associated with poor relapse-free survival in both our sample set and the validation data set. We found a number of additional prognostic associations, including mutational load, alterations in individual genes, oncodriver pathways, and single base substitution (SBS) signatures in primary tissues, which were not confirmed by validation. Altered ATM, DNAH11, and MUC5AC, or a higher share of SBS24 signature in metastases seemed to represent poor prognostic factors, but because of a lack of suitable validation data sets, these results must be treated with extreme caution. No gene or profile was significantly associated with response to chemotherapy. Taken together, we report subtle differences in exome mutational profiles between paired primary tumors and synchronous liver metastases and a distinct prognostic relevance of KRAS in primary tumors. Although the general scarcity of primary tumor-synchronous metastasis sample pairs with high-quality clinical data makes robust validation difficult, this study provides potentially valuable data for utilization in precision oncology and could serve as a springboard for larger studies.

Heterogeneous Specificities of Nickel Presentation to Nickel Specific CD4 T Cells

Abstract Sensitization to nickel (Ni2+) is the most common T cell mediated type IV hypersensitivity, although the mechanisms by which Ni2+ alters antigen presentation are not understood. To study how the TCR then recognizes Ni2+ bound to the MHC molecule, we performed paired single cell RNA sequencing of PBMCs from two highly Ni2+ sensitized subjects to orthopedic implants and characterized three Ni2+ specific CD4+ T cell clones. One Ni2+ specific CD4+ T cell is highly restricted to HLA-DR7. But the other highly cross-reactive CD4+ T cell clones was restricted to multiple HLA alleles, including HLA-DR, HLA-DP, and HLA-DQ expressing antigen presenting cells. We identified a HLA-DQ8 restricted Ni2+ dependent mimotope reactive to the highly cross-reactive T cell clone. This mimotope appeared to present Ni2+ ions with the Glu at P2 position, involving βH81. The mutational studies of HLA-DP2 molecule showed that the same T cell recognized the Ni2+ ion bound to a completely different location in the P4-P7 pocket. Ni2+ ion was also can be presented efficiently by HLA-DR53 to the same T cells. mutational and structural study of HLA-DR53 molecules suggested that HLA-DR53 presented Ni2+ in the P4-P7 pocket. This is the first evidence showing that a metal ion can be presented by HLA using the different sites. The metal binding sites are HLA and peptide dependent. The heterogeneous specificities of Ni2+ specific TCRs are determined by different alleles of HLAs together with particular self-peptides. Sensitization to nickel (Ni2+) is the most common T cell mediated type IV hypersensitivity, although the mechanisms by which Ni2+ alters antigen presentation are not understood. To study how the TCR then recognizes Ni2+ bound to the MHC molecule, we performed paired single cell RNA sequencing of PBMCs from two highly Ni2+ sensitized subjects to orthopedic implants and characterized three Ni2+ specific CD4+ T cell clones. One Ni2+ specific CD4+ T cell is highly restricted to HLA-DR7. But the other highly cross-reactive CD4+ T cell clones was restricted to multiple HLA alleles, including HLA-DR, HLA-DP, and HLA-DQ expressing antigen presenting cells. We identified a HLA-DQ8 restricted Ni2+ dependent mimotope reactive to the highly cross-reactive T cell clone. This mimotope appeared to present Ni2+ ions with the Glu at P2 position, involving βH81. The mutational studies of HLA-DP2 molecule showed that the same T cell recognized the Ni2+ ion bound to a completely different location in the P4-P7 pocket. Ni2+ ion was also can be presented efficiently by HLA-DR53 to the same T cells. mutational and structural study of HLA-DR53 molecules suggested that HLA-DR53 presented Ni2+ in the P4-P7 pocket. This is the first evidence showing that a metal ion can be presented by HLA using the different sites. The metal binding sites are HLA and peptide dependent. The heterogeneous specificities of Ni2+ specific TCRs are determined by different alleles of HLAs together with particular self-peptides.

Strong adaptive immunity in humans with inherited CD4 deficiency

Abstract Since the early 1970s when the T cell receptor was first characterized, the role of human CD4 in adaptative immunity has been extensively studied, especially in the context of HIV infection and inborn error of immunity (e.g. HLA class II deficiency). Nonetheless, it was only recently (2019, 2021) that patients with inactivating germline mutations in CD4has been described. Herein, we present five novel patients from three unrelated kindred with bi-allelic rare variants in CD4. Consistent with previous studies, patients showed a broad spectrum of clinical infectious susceptibility which was rather mild given their lack of detectable CD4 +T cells in peripheral blood mononuclear cells (PBMCs). Despite an almost unremarkable immunophenotype, patient’s PBMCs were characterized by the expansion of an enigmatic CD4 −CD8 −(DN) TCRαβ +T cells population which retained some functional characteristic of typical CD4 +T cells. We observed that the patient’s DN cells transcriptionally (Sc-RNAseq) and functionally (cytokine production/secretion) were comparable to that of healthy donor CD8 −T cells. Interestingly, using cutting-edge long-read sc-RNAseq technology we revealed that patient’s DN cells expressed normal TCR repertoires, and paired TCRαβ sequences comparable to healthy donor CD4 +T cells. Furthermore, via biochemical studies we identified a CD4alternative transcript expressed in patient’s PBMCs (also detected in healthy donor cells) leading to the surface expression of an unreported CD4 shorter isoform which is not detectable with conventional CD4 antibodies. To conclude, our study not only characterizes novel CD4-deficient patients, but also reveals alternative CD4 isoform expression and its compensatory role in immunity. AAI Careers in Immunology Fellowship 2022 (RG222573)

Plasticity of clonal memory CD8 T cell differentiation

Abstract Memory CD8 T cells provide highly specific and long-lasting protection against previously experienced pathogens. This potent protection is mediated by hundreds to thousands of unique clones with distinct T cell receptors (TCRs). Higher T cell clonal diversity and recognition of a wider range of pathogen antigens are associated with improved host protection. Therefore, understanding how clonal responses are organized is important for improving T cell function in a range of diseases. To comprehensively test the range of clonal memory T cell differentiation capacity, we deeply profiled polyclonal mouse memory CD8 T cells from acute lymphocytic choriomeningitis virus (LCMV) infection before and after viral rechallenge by paired single cell RNA and TCR sequencing. We found that individual memory T cell clone expansion and differentiation at the peak of the rechallenge response is highly variable. Clones are spread across various patterns of unique phenotypes ranging from highly cytotoxic to stem-like memory states. To quantify clonal differentiation plasticity, we transferred memory T cells into multiple new congenic recipients. Clonal progeny in different hosts acquired highly similar differentiation states suggesting that emergent memory clone behavior is imprinted by events during the primary infection. Indeed, transcriptional state of clones prior to rechallenge was sufficient to predict clone behavior upon rechallenge. This work provides a platform for understanding the mechanisms by which memory T cells make decisions and future studies will aim to perturb clones to elicit specific functions during a memory response. Supported by grants from the Burroughs Wellcome Fund (Career Award for Medical Scientists [ATS]), Cancer Research Institute (Technology Impact Award, Lloyd J. Old STAR Award [ATS]), American Society of Hematology (ASH Scholar Award [ATS]), Parker Institute for Cancer Immunotherapy (ATS), Stanford School of Medicine (Propel Postdoctoral Scholarship [KHG]), National Institutes of Health (5T32AI007290-38 [CJR])

Diagnostic test of multiplex PCR design based on COVID-19 genotype variations in local isolates

Background: Coronavirus disease 2019 (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus which is a new strain of the Coronavirus, the primary and probe designs were carried out to find candidate primers and probes to be used as the detection of COVID-19. The purpose of this study was to design multiplex PCR on primers and ORF1ab and N gene probes in COVID-19 examination using the multiplex PCR method and it is expected to have good validity in the examination. Methods: The research design is in the form of explorative descriptive with a cross sectional approach. Starting from April to December 2021. The samples used in this study were 221 COVID-19 gene sequences downloaded from the NCBI and GISAID gene databases. Results: The design results of the ORF1ab gene primer and probe with forward primer: 5'- CGCAATTTACAACACAGAC -3' reverse primer: 5'- GTTCTTTATGCTAGCCACT -3' amplicon length 183 bp, and probe sequence: FAM 5'-AAACACACAACAGCATCGTCA-3' BHQ-1, on the N gene with forward primer: 5'-AATTCAACTCCAGGCAG -3' and reverse primer: 5'- CTCTCTCAAGCTGGTTCAATC -3' amplicon length 111 bp, and probe sequence: HEX 5'-CAGCAAAGCAAGAGCAGCA-3' BHQ-1 primary pair sequence and ORF1ab gene probe and N gene conjecture qualified for q-PCR. Conclusions: The obtained primary and probe pair sequences can be used as COVID-19 detection using the multiplex PCR method.

Transformations of marginal zone lymphomas and lymphoplasmacytic lymphomas: Report from the 2021 SH/EAHP Workshop.

To summarize the conclusions of the 2021 Society for Hematopathology/European Association for Haematopathology workshop regarding transformations of marginal zone lymphoma (MZL) and lymphoplasmacytic lymphoma (LPL). Nineteen cases were submitted to this portion of the workshop. Additional studies were performed in cases with sufficient material. Cases included splenic MZL (n = 4), splenic diffuse red pulp small B-cell lymphoma (n = 2), nodal MZL (n = 4), extranodal MZL (n = 1), and LPL (n = 8). The most common transformation was to diffuse large B-cell lymphoma (DLBCL), but others included classic Hodgkin lymphoma, high-grade B-cell lymphomas with MYC and BCL6 rearrangements, plasmablastic lymphoma, and plasma cell leukemia. Two splenic MZLs with transformation to DLBCL contained t(14;19)(q32;q13.3) IGH::BCL3 rearrangements in both samples. Paired sequencing studies in 5 MZLs with transformation to clonally related DLBCL identified a variety of mutations and gene fusions at the time of transformation, including CARD11, IGH::MYC, NOTCH2, P2RY8, TBLX1X1, and IGH::CD274. Marginal zone lymphoma and LPL may undergo a variety of transformation events, most commonly to DLBCL, which is usually, although not always, directly clonally related to the underlying low-grade lymphoma. Multiparameter analysis including broad-based sequencing studies can assist in the diagnosis and classification of these uncommon cases.

Fast, accurate antibody structure prediction from deep learning on massive set of natural antibodies

Antibodies have the capacity to bind a diverse set of antigens, and they have become critical therapeutics and diagnostic molecules. The binding of antibodies is facilitated by a set of six hypervariable loops that are diversified through genetic recombination and mutation. Even with recent advances, accurate structural prediction of these loops remains a challenge. Here, we present IgFold, a fast deep learning method for antibody structure prediction. IgFold consists of a pre-trained language model trained on 558 million natural antibody sequences followed by graph networks that directly predict backbone atom coordinates. IgFold predicts structures of similar or better quality than alternative methods (including AlphaFold) in significantly less time (under 25 s). Accurate structure prediction on this timescale makes possible avenues of investigation that were previously infeasible. As a demonstration of IgFold’s capabilities, we predicted structures for 1.4 million paired antibody sequences, providing structural insights to 500-fold more antibodies than have experimentally determined structures.