Original Tree Research Articles

A Study on Planting Techniques to Enhance the Function of Urban Wind Ventilation Forest: In the Case of Wind-Connecting Forest, Seocho-gu, Seoul

Background and objective: This study was conducted to develop Connecting Forest planting technique suitable for urban structure and target site conditions on Banpo-daero Street in Seocho-gu.Methods: Through simulation analysis of planting techniques by type (computer climate model: ENVI-met), the street types were classified into the following categories: bare ground type (1), currently planted with <i>Platanus occidentalis</i> (square pruning) (2), a type that can realistically create a strip green (3), and a type that grows the tree canopy and applies <i>Platanus occidentalis</i> and a strip green in the center of the road (4).Results: In the case of creating a 2-meter-wide band green on the existing street trees in the first row, and multi-layered vegetation using the step-by-step arrangement method of small tree + shrub + herbaceous plants, the temperature of up to 0.15°C rise in the roadway area and the temperature of up to 0.12°C went down in the sidewalk area, and PMV (Predicted Mean Vote) was reduced by up to 1.32 in the multi-layer trench planting area. Particulate matter was concentrated, resulting in an increase of about 40~80㎍/㎥in roadways and sidewalks. In the case of the ideal planting arrangement of the route applying the original tree tree tree street + the green belt 2m + the central green zone, the effect of reducing the maximum 1.6°C in the roadway area and 0.3°C in the sidewalk area was shown, and the result of lowering the temperature throughout the target area was derived. arise from street trees, trench planting and trees in Green Area at the Center Line the concentration of particulate matter in the roadway area increased to about 150<i>μ</i>g/㎥, and the concentration of particulate matter in sidewalks and residential areas decreased. Through simulation analysis, we planted street trees with large trunk widths that are favorable for shade formation (<i>Platanus occidentalis</i>) and maintained the unique tree shape, oval, rather than square pruning, and the composition of the strip greenery consisted of multi-layered plantings based on the terraced layout method by introducing tree species with excellent particulate matter reduction capabilities.Conclusion: This study is meaningful in analyzing the function of connecting forests, which play an important role in urban wind ventilation forests, which are created as a solution to improve the urban environment, such as reducing particulate matter in the city and mitigating heat waves, and suggesting planting techniques that can improve their function.

The Optimization and Application Research of the RRT-APF-Based Path Planning Algorithm

To address the shortcomings of the original rapidly-exploring random tree (RRT) algorithm, such as long and non-smooth paths, slow convergence to the goal region, and limited adaptability in dynamic environments, this paper proposes a hybrid path planning method combining the artificial potential field (APF) approach with the RRT algorithm. This integrated approach leverages the strengths of both methods to achieve efficient, collision-free path planning in both two-dimensional and three-dimensional environments. The algorithm overcomes the local minima problem inherent in APF while maintaining the RRT’s efficiency in high-dimensional spaces and complex environments. A dynamic adjustment strategy is introduced to adapt to specific application scenarios and varying environmental complexity. Additionally, Bezier curve fitting is applied to smooth the resulting paths. Simulations conducted in various environments demonstrate the effectiveness of the proposed method, highlighting its efficiency and robustness in generating collision-free paths. Compared to the original RRT algorithm, the proposed method reduces path length by 13.4% to 24.9% and decreases search time by 9.8% to 56.5%, improving both path quality and planning efficiency.

HAlign 4: a new strategy for rapidly aligning millions of sequences.

HAlign is a high-performance multiple sequence alignment software based on the star alignment strategy, which is the preferred choice for rapidly aligning large numbers of sequences. HAlign3, implemented in Java, is the latest version capable of aligning an ultra-large number of similar DNA/RNA sequences. However, HAlign3 still struggles with long sequences and extremely large numbers of sequences. To address this issue, we have implemented HAlign4 in C++. In this version, we replaced the original suffix tree with Burrows-Wheeler Transform and introduced the wavefront alignment algorithm to further optimize both time and memory efficiency. Experiments show that HAlign4 significantly outperforms HAlign3 in runtime and memory usage in both single-threaded and multi-threaded configurations, while maintains high alignment accuracy comparable to MAFFT. HAlign4 can complete the alignment of 10 million coronavirus disease 2019 (COVID-19) sequences in about 12 min and 300GB of memory using 96 threads, demonstrating its efficiency and practicality for large-scale alignment on standard workstations. Source code is available at https://github.com/malabz/HAlign-4, dataset is available at https://zenodo.org/records/13934503.

IDSV-GCN: Integrating Dual Syntactic Views Graph Convolutional Network for aspect-based sentiment analysis

Aspect-based sentiment analysis (ABSA) aims to predict the sentiment polarity towards given aspects in a sentence. Recent research has highlighted that graph neural networks based on syntactic dependency trees effectively convey rich syntactic information and are suitable for ABSA tasks. Most existing work typically adopt either dependency type or minimum distance between nodes in the original syntactic tree to construct different views. However, existing work overlooks the high-dimensional local feature information in dependency relations, resulting in inadequate exploration of this view. Meanwhile, most work ignores that the minimum distance view and the dependency view can be complementary and integrated in syntactic analysis. Unfortunately, directly adding the two views introduces noise issues, leading to unsatisfactory results after their integration. To address these issues, this paper introduces an integrating dual syntactic views graph convolutional network (IDSV-GCN) model that seamlessly integrates dependency type view and minimum distance view, enabling comprehensive utilization of syntactic structure and information. To better address the computation of weights in the dependency type view, we innovatively propose a fusion attention mechanism. This approach effectively captures both global and local feature information. To more effectively integrate the two views and reduce the impact of noise, we employ a syntactic mask layer to filter out noise in the dependency type view and highlighting important dependency feature information. Then, we construct a minimum distance weight matrix based on the matrix obtained from the dependency type view. Finally, we merge the two matrices and feed them into the GCN to facilitate the model’s learning of syntactic information. Experimental results on three widely-used benchmark datasets demonstrate that our proposed IDSV-GCN model outperforms state-of-the-art methods.

ALS-Based, Automated, Single-Tree 3D Reconstruction and Parameter Extraction Modeling

The 3D reconstruction of point cloud trees and the acquisition of stand factors are key to supporting forestry regulation and urban planning. However, the two are usually independent modules in existing studies. In this work, we extended the AdTree method for 3D modeling of trees by adding a quantitative analysis capability to acquire stand factors. We used unmanned aircraft LiDAR (ALS) data as the raw data for this study. After denoising the data and segmenting the single trees, we obtained the single-tree samples needed for this study and produced our own single-tree sample dataset. The scanned tree point cloud was reconstructed in three dimensions in terms of geometry and topology, and important stand parameters in forestry were extracted. This improvement in the quantification of model parameters significantly improves the utility of the original point cloud tree reconstruction algorithm and increases its ability for quantitative analysis. The tree parameters obtained by this improved model were validated on 82 camphor pine trees sampled from the Northeast Forestry University forest. In a controlled experiment with the same field-measured parameters, the root mean square errors (RMSEs) and coefficients of determination (R2s) for diameters at breast height (DBHs) and crown widths (CWs) were 4.1 cm and 0.63, and 0.61 m and 0.74, and the RMSEs and coefficients of determination (R2s) for heights at tree height (THs) and crown base heights (CBHs) were 0.55 m and 0.85, and 1.02 m and 0.88, respectively. The overall effect of the canopy volume extracted based on the alpha shape is closest to the original point cloud and best estimated when alpha = 0.3.

Simulation of CRISPR-Cas9 editing on evolving barcode and accuracy of lineage tracing

We designed a simulation program that mimics the CRISPR-Cas9 editing on evolving barcode and double strand break repair procedure along with cell divisions. Emerging barcode mutations tend to build upon previously existing mutations, occurring sequentially with each generation. This process results in a unique mutation profile in each cell. We sample the barcodes in leaf cells and reconstruct the lineage, comparing it to the original lineage tree to test algorithm accuracy under different parameter settings. Our computational simulations validate the reasonable assumptions deduced from experimental observations, emphasizing that factors such as sampling size, barcode length, multiple barcodes, indel probabilities, and Cas9 activity are critical for accurate and successful lineage tracing. Among the many factors we found that sampling size and indel probabilities are two major ones that affect lineage tracing accuracy. Large segment deletions in early generations could greatly impact lineage accuracy. These simulation results offer insightful recommendations for enhancing the design and analysis of Cas9-mediated molecular barcodes in actual experiments.

In vitro Apical Shoot Culture and Callus Formation of Durian (Durio zibethinus Murray)

Backgroud: Durian (Durio zibethinus Murray), A tropical fruit with high nutritional and commercial value, is widely cultivated in Southeast Asia. Unfortunately, growing durian is fraught with difficulties. Propagation is the traditional method for conserving plants. This method does have some drawbacks, one of which is that the original tree may suffer as a result. Therefore, a contemporary method for growing durian plants is plant tissue culture. Aim: The objective of this research is creating a premise for the development of durian high-value varieties by biotechnology, specifically setting up the first step closer to develop durian somatic cell formation protocol in vitro. Methodology: Effects of media MS on shoot culture and Kinetin and 2.4D on callus formation and growth. Experiments were designed by randomized complete block (RCB). Results: There are not significant difference between two treatments of 0.1 mg/L BAP (6-benzylaminopurine) added to 1/3xMS and free hormone medium, in an effort to preserve high-value durian varieties. There is research on formating callus from young leaves of durian affected by Kinetin and 2.4D. The outcomes demonstrated that MS medium supplemented with 3 mg/L 2.4D had an impact on the formation of callus on leaves. The combination of 1.0 mg/L Kinetin + 4.0 mg/L 2.4D make a significant to induce callus growth and callus area. Callus was white color, fresh and soft. Conclusion: the combination of Kinetin + 2.4D was finding the best combination to maintain the survival of callus induction and growth; coconut water treatment was highly effective in sustaining fresh callus.

Growth dynamics of an Amazonian forest: Effects of reduced impact logging and recurring atypical climate events during a 20-year study

Although forest management with reduced impact logging (RIL) practices is regarded as a way to generate income from tropical forests without losing their overall conservation values, the behavior of forests following logging is a topic that has been little studied in the southwestern Brazilian Amazon (SWA), where the predominant forest type is open with low density of commercial timber species. This study examined the growth dynamics of a logged forest in the SWA through monitoring of permanent sample plots (PSP) over twenty years post logging. Following logging, the forest fully recovered its original tree density (439. ha−1) and aboveground biomass (AGB) stocks (188.4 Mg. ha−1) but did not recover extracted timber volume in the commercial size class (DBH > 50 cm, 28 m3. ha−1 before logging and 22.6 m3. ha−1 in 2022). Tree growth, recruitment and mortality rates presented a high fluctuation during the monitoring period, increasing immediately after logging (0.43 cm. yr.−1, 4.1 % and 4.7 % respectively), declining five years after, (0.25 cm. yr.−1, 0.7 % and 1.5 % respectively) and presenting a new peak sixteen years after logging (0.35 cm. yr.−1, 3.9 % and 7.4 % respectively) which persisted to the end of the study period. Consequently, forest turnover was very high, with stand half-life and doubling life of 29.6 and 27.2 years, respectively. The results show that in terms of forest dynamics and production, the behavior of logged forests was also affected by atypical climate events, such as recurring droughts across Amazonia. Consequently, in the forest type studied, and under the prescribed logging cycle of 25 years, RIL alone was not sufficient to guarantee the sustainability of long-term production of the main timber species harvested. Following the current growth trend (0.46 m3. ha−1. yr.−1 for trees above 10 cm DBH and 0.22 m3. ha−1. yr.−1 for trees above 50 cm DBH) the time to recover the total commercial volume and commercial volume for trees above 10 cm DBH and above 50 cm DBH would be 34 and 45 years respectively. Our findings suggest the need for adoption of silvicultural treatments to increase forest productivity in areas under RIL in SWA.

Efficient Maintenance of Minimum Spanning Trees in Dynamic Weighted Undirected Graphs

This paper presents an algorithm for effectively maintaining the minimum spanning tree in dynamic weighted undirected graphs. The algorithm efficiently updates the minimum spanning tree when the underlying graph structure changes. By identifying the portion of the original tree that can be preserved in the updated tree, our algorithm avoids recalculating the minimum spanning tree from scratch. We provide proof of correctness for the proposed algorithm and analyze its time complexity. In general scenarios, the time complexity of our algorithm is comparable to that of Kruskal’s algorithm. However, the experimental results demonstrate that our algorithm outperforms the approach of recomputing the minimum spanning tree by using Kruskal’s algorithm, especially in medium- and large-scale dynamic graphs where the graph undergoes iterative changes.

BloomDT - An improved privacy-preserving decision tree inference scheme

Outsourcing decision tree models to cloud servers can allow model providers to distribute their models at scale without purchasing dedicated hardware for model hosting. However, model providers may be forced to disclose private model details when hosting their models in the cloud. Due to the time and monetary investments associated with model training, model providers may be reluctant to host their models in the cloud due to these privacy concerns. Furthermore, clients may be reluctant to use these outsourced models because their private queries or their results may be disclosed to the cloud servers. In this paper, we propose BloomDT, a privacy-preserving scheme for decision tree inference, which uses Bloom filters to hide the original decision tree's structure, the threshold values of each node, and the order in which features are tested while maintaining reliable classification results that are secure even if the cloud servers collude. Our scheme's security and performance are verified through rigorous testing and analysis.

Initial microbiome and tree root status structured the soil microbial community discrepancy of the subtropical pine-oak forest in a large urban forest park.

Plant-microbe-soil interactions control over the forest biogeochemical cycling. Adaptive plant-soil interactions can shape specific microbial taxa in determining the ecosystem functioning. Different trees produce heterogeneous soil properties and can alter the composition of soil microbial community, which is relevant to the forest internal succession containing contrasting stand types such as the pine-oak forests. Considering representative microbial community characteristics are recorded in the original soil where they had adapted and resided, we constructed a soil transplant incubation experiment in a series of in situ root-ingrowth cores in a subtropical pine-oak forest, to simulate the vegetational pine-oak replacement under environmental succession. The responsive bacterial and fungal community discrepancies were studied to determine whether and how they would be changed. The pine and oak forest stands had greater heterogeneity in fungi composition than bacteria. Original soil and specific tree root status were the main factors that determined microbial community structure. Internal association network characters and intergroup variations of fungi among soil samples were more affected by original soil, while bacteria were more affected by receiving forest. Specifically, dominant tree roots had strong influence in accelerating the fungi community succession to adapt with the surrounding forest. We concluded that soil microbial responses to forest stand alternation differed between microbiome groups, with fungi from their original forest possessing higher resistance to encounter a new vegetation stand, while the bacteria community have faster resilience. The data would advance our insight into local soil microbial community dynamics during ecosystem succession and be helpful to enlighten forest management.

Modal properties of fractal trees as recursive analytical solutions

This study analyzes the modal properties of two-dimensional fractal trees under the assumptions of linear-elastic vibrations and axially inextensible branches. The examined fractal trees are of a generalized sympodial architecture with possibly non-zero and non-uniform branching angles. The study first presents the construction of tree geometry via iterated functions and then formulates the trees’ dynamic matrices from a renormalization viewpoint. The study proposes a novel recursive analytical solution to capture the trees’ modal properties. The proposed solution perceives the modal analysis of the fractal trees as an equivalent static analysis of trees with a modified configuration. These “modified” trees are made from the original trees but with all branches connected to the ground via negative stiffness springs. The analysis shows that identifying the lateral trunk displacements of the modified trees (under a static unit force) is associated with the recursive construction of a new family of functions that are introduced in the study, called the auxiliary P-functions. The results reveal that the modal frequencies of the original fractal trees are given by the roots of all auxiliary P-functions. Crucially, these auxiliary P-functions allow the graphical construction of the trees’ mode shapes. Illustrative examples demonstrate how the proposed recursive analytical solutions can be used to determine the trees’ modal properties. Lastly, the study concludes that the repetition of branches, even without geometrical symmetry, is a necessary condition for the existence of a unique vibration mitigation mechanism in fractal trees, namely the self-similar modes.

Optimization Model for Timing of Preventive Maintenance of Asphalt Pavement Based on Decision Trees

The timing of preventive maintenance for asphalt pavement determines the effectiveness and cost-effectiveness of preventive maintenance measures. Firstly, a weighted average method combining subjective and objective factors is used to evaluate the performance index of road sections and select preventive maintenance measures. Secondly, a decision tree model for preventive maintenance of highways in Gansu Province is established using field measurement data to determine the timing of preventive maintenance for road sections. Finally, the model is validated using the example of the G22 Qingdao-Lanzhou Expressway by evaluating the pavement service performance index and the timing of preventive maintenance. The results show that compared to directly establishing decision trees based on uniform standards, the decision tree established using field measurement data reflects the differences in the importance of various decision indicators and respects the objectivity of road data. It improves the poor portability of the original decision tree model and enables more accurate determination of the timing of preventive maintenance.

First Report of Leaf Black Spot Caused by Alternaria alternata on American Persimmons in China.

American persimmons (Diospyros virginiana L.) are native to the United States. After being introduced into China, they were used as a rootstock for expanding persimmon varieties and planted in local areas due to their strong cold resistance and diverse leaf colors. In 2022, 12 plants had similar symptoms to black spot disease on the leaves of 18 American persimmons introduced in the National Field Genebank for Persimmon, Yangling, Shaanxi, China (34°17'42.80″ N, 108°04'08.21″ E). Among them, severity was highest in the 'VM10' variety (almost 100%), 'VM10' is the main cultivar in Shaanxi and Henan regions of China, and the incidence of disease in the two regions ranged between 30 and 60% in 2022. Early symptoms were irregular black-brown spots, which gradually combined into large irregular lesions with a dark brown border. The leaves began to curl, crack, scorch, and abscissed. When relative humidity was high, leaves also had signs of black sporulation and became chlorotic. To isolate the causal agent, 10 symptomatic leaves were collected from 5 diseased plants in the National Field Genebank for Persimmon. The infected leaves were cut into 20 small pieces of 5 × 5 mm from the junction of the diseased and healthy tissues and surface disinfected in 75% alcohol for 15 sec, washed with sterile water and 2% NaClO for 90 sec, rinsed three times with sterile water, dried with sterile absorbent paper, and plated on potato dextrose agar (PDA) medium. After 3 days, 12 strains of fungi were isolated from the tissue by transferring the hyphal tips of the mycelium. Among them, 10 strains had similar morphological characteristics. Fungal colonies developed on the PDA medium were initially white, then gradually changed to gray-brown with neat edges and flocculent hyphae. Conidia (n=50) light brown or medium brown, obovate or pear-shaped, and 8.27 to 15.31×17.51 to 24.31 µm, with 1 to 4 transverse septa and 0 to 2 longitudinal septa. The isolates were morphologically similar to Alternaria alternata (Simmons et al. 2007). For molecular identification, the E.Z.N.A.® Fungal DNA kit (Omega Bio-Tek) was used to extract genomic DNA from 7-day-old mycelium grown on PDA medium. The internal transcribed spacers (ITS) region, translation elongation factor 1-alpha (TEF1-α), Alternaria major allergen (Alt a1) gene, and partial RNA polymerase second largest subunit (RPB2) were amplified using ITS1/4 (Glass et al. 1995), EF1-728F/EF1-968R (Carbone and Kohn 1999), and Alt-4for /Alt-4rev (Hong et al., 2005) and RPB2-5F/RPB2-7CR (Liu et al. 1999) respectively. The sequences of a representative isolate MZS1 were deposited in GeneBank with accession numbers OP198643 for ITS, OP286949 for Tef1-α, OP286948 for Alt a1, and OP951084 for RPB2, and were 100% identical to strains of A. alternata (MN615420 for ITS, MN615423 for EF1-α, MW848792 for Alt a1 and MN615422 for RPB2). A maximum-likelihood (ML) phylogenetic tree was constructed based on the concatenated sequences of ITS, TEF1-α, Alt a1, and RPB2gene, which clustered with the A. alternata strains YZU191238 with high bootstrap support (99%). To fulfill Koch's postulates, three-month-old American persimmon 'VM10' seedlings were tested for pathogenicity. Three seedlings were sprayed with 1 × 106 spores/ml suspension in a spray pot, and the three seedlings were treated with sterilized water as a noninoculated control. All seedlings were cultured in a 25°C incubator. The experiment was performed three times under the same conditions. One week after inoculation, typical symptoms appeared on the leaves, which were similar to those observed on the leaves of the original infected persimmon trees. In the control treatment, the leaves did not show symptoms. To the best of our knowledge, this is the first report of A. alternata causing American persimmon black spots disease in China. This report will contribute to the identification of disease symptoms in the field and provide a basis for the occurrence, distribution, and control of A. alternata on American persimmon leaves.

Extractable Compounds in a Birch Tree—Variations in Composition and Yield Potentials

Extractives from silver birch (Betula pendula) can play an important role in the future bioeconomy by delivering the feedstock, for instance, for antioxidative applications. It is, therefore, inevitable to gain knowledge of the distribution of extractive content and composition in the different tissues of the tree for estimating the potential volumes of valuable extractable compounds. This study examines the extractable compound distribution of different tree tissues such as outer and inner bark and wood, respectively, considering the original height of the stem and comparing the yields after Soxhlet and accelerated solvent extraction (ASE). Eleven parts of the model tree (seven stem discs and four branches) were separated into primary tissues and extracted with a ternary solvent system. The investigated extraction methods resulted in a comparable performance regarding yields and the composition of the extractives. The extractives were divided into single compounds such as betulin, lupeol, γ-sitosterol, and lupeone and substance groups such as carbohydrates, terpenes, aromatics, and other groups. The distribution of single substances and substance groups depends on the location and function of the examined tissues. Furthermore, the evidence for the correlation of a single substance’s location and original tree height is stronger for lupeol than for betulin. Primary betulin sources of the calculated betulin output are the outer bark of the stem and the branches. By using small branches, further potential for the extraction of betulin can be utilized. A model calculation of the betulin content in the current birch tree revealed a significant potential of 23 kg of betulin available as a valuable chemical resource after by-product utilization.

Positivity bounds at one-loop level: the Higgs sector

In this paper, we promote the convex cone method of positive bounds from tree level to loop level. This method is general and can be applied to obtain leading s2 positivity bounds on the forward scattering process in the standard model effective field theory. To obtain the loop level bounds, the original tree level bounds are modified by loop corrections, which involve low dimensional coefficients. New positivity bounds being valid at one loop level on the four-Higgs scattering have been provided. We study some specific ultraviolet models to check the validity of the new bounds. In addition, the renormalisation group effect on positivity is explored. We point out that as long as the new bounds are satisfied at the cutoff scale Λ, they will also be satisfied at all scales below Λ.

Characterization of key sweet taste compounds in Camellia nanchuanica black tea

Camellia nanchuanica gained attention for having original tea tree characteristics and producing black tea with appealing sweetness. To better study the sweet taste of Camellia nanchuanica black tea, 30 kinds of Camellia nanchuanica black tea (NCBT) samples were classified into three types (high, middle and low sweetness) according to the differences in sweetness. A total of 844 metabolites were detected in NCBT; among them, there were 155 differential metabolites. Four differential metabolites (phloridzin, dulcitol, l-alanine, and sucrose) positively correlated with sweetness and showed higher VIP (variable importance for the projection) values (>1), which made main contributions to the sweetness of NCBT. Phloridzin and l-alanine might be the key sweet compounds of NCBT due to higher DoT (dose-over-threshold) values. Addition experiments further verified that phloridzin was the key sweet taste compound because phloridzin significantly increased the sweet taste of low sweetness samples. Notably, although NCBT24, 26, and 28 belonged to high sweetness samples, phloridzin content was lower. Based on the interactions of binary mixture, hyper-addition effects of phloridzin, dulcitol, l-alanine, and sucrose existed in NCBT24, 26 and 28.

A parallel CF tree clustering algorithm for mixed-type datasets

Many traditional clustering algorithms are incapable of processing mixed-type datasets in parallel, limiting their applications in big data. In this paper, we propose a CF tree clustering algorithm based on MapReduce to handle mixed-type datasets. Mapper phase and reducer phase are the two primary phases of MR-CF. In the mapper phase, the original CF tree algorithm is modified to collect intermediate CF entries, and in the reducer phase, k-prototypes is extended to cluster CF entries. To avoid the high costs associated with I/O overheads and data serialization, MR-CF loads a dataset from HDFS only once. We first analyze the time complexity, space complexity, and I/O complexity of MR-CF. We also compare it with sklearn BIRCH, Apache Mahout k-means, k-prototypes, and mrk-prototypes on several real-world datasets and synthetic datasets. Experiments on two mixed-type big datasets reveal that MR-CF reduces execution time by 45.4% and 61.3% when compared to k-prototypes, and it reduces execution time by 73.8% and 55.0% when compared to mrk-prototypes.

A new 500-year reconstruction of Truckee River streamflow

The Truckee River Basin, located on the Nevada-California border, is an area of extreme hydrologic variability, being subject to both prolonged multi-decadal droughts and devastating floods; however, due to the brief instrumental record, understanding of the full range of this variability is limited. To assist local water managers assess the post-2000 drought in the context of historic droughts, this study revisits the first tree-ring reconstruction of Truckee River runoff: Hardman and Reil (1936). Incorporating their original 1930s tree cores as well as newly sampled material, three new site chronologies were developed and combined with other regional chronologies to produce a 1491–2003 reconstruction of Truckee River streamflow, an over 400-year extension of the instrumental record and 230 years longer than the previous reconstruction, providing new insights into the basin’s natural variability. In addition to evidence of extended droughts and extreme high streamflow years, this reconstruction shows a marked hydroclimatic shift centered around the 1850s. Prior to then, the Truckee River experienced decadal to multi-decadal periods of higher than average streamflow; subsequently, these periods have been decreasing in length with only two instances above three consecutive years of high streamflow since 1900. Whether this represents fundamental shift to a new hydroclimatic regime remains unclear. However, as global temperatures continue to rise, fewer long-term high streamflow episodes may have lasting impacts on water availability in the basin, raising the question further of whether the post-2000 drought is a new megadrought or a sign of aridification.

First report of ash shoestring-associated virus (ASaV) infecting European ash (Fraxinus excelsior L.) in France.

Ash shoestring-associated virus (ASaV) is a recently described Emaravirus with five genome segments identified in Germany and Switzerland from European ash (Fraxinus excelsior) or South European flowering ash (F. ornus) trees with chlorotic spots or mosaics and leaf curling or leaf shoestring symptoms [1]. In summer 2021 several European ash trees with severe leaf mosaic and deformation were observed 50 km south east of Bordeaux (France). Double stranded RNAs were purified from the leaves of one of the trees (2021-432) and analyzed by Illumina high throughput sequencing (HTS, 2x150 nt) as described [2]. Following quality trimming, reads were assembled de novo (CLC Genomics Workbench 21, Qiagen) and contigs annotated by BlastX analysis. Contigs homologous to ASaV genomic RNAs 2 to 5 were identified. For ASaV RNA2, four contigs were identified which could be manually assembled to yield a single scaffold while a single contig was obtained for RNAs 3, 4 and 5. The RNA2 scaffold assembled 1,206 reads for an average coverage of 58.2x, while the corresponding values for RNAs 3 to 5 were respectively 21,381 reads (1,529x), 18,146 reads (1,266x) and 1,234 reads (97.4x). While no contig was identified for ASaV RNA1 (or for other viruses), mapping of reads on an RNA1 reference (OU466880) allowed to identify 25 reads for this genomic segment (average coverage 0.4x). In total, ASaV reads represented 3.9% of the ca. 1 million reads obtained from the ash sample. The RNAs 2 to 5 scaffolds for isolate 2021-432 have been deposited in GenBank (OP501824-7). They show between 94.6% and 97.6% nucleotide identity with the corresponding RNAs of a reference isolate (OU466881-4). In order to validate the presence of ASaV in the original tree, PCR primers were designed based on RNAs 1 and 3 sequences. Primers ASaV1-F (5'-ATTATTCACAGTATGAAAGGG-3') and ASaV1-R (5'-GGTGTGGAGAATATCAAACC-3') amplify a 286 nt RNA1 fragment, while primers ASaV3-F (5'-GCTATACCCAGCTGAGGTGC-3') and ASaV3-R (5'-GTGTGCAATTCTATCAGCCTC-3') amplify a 322 nt RNA3 fragment. Amplicons of the expected size were obtained and directly sequenced. The RNA3 amplicon sequence was identical to the corresponding region of the HTS contig, while the RNA1 amplicon was 97.5% identical to the OU466880 reference sequence. The same primer pairs and a third one, ASaV4-F (5'- GAGGTTGCTTTGATGTCAGG -3') and ASaV4-R (5'- TGCCTCTCCGATGGTGATG -3'), amplifying a 411 nt RNA4 fragment, were used to test a European ash (2022-91) showing similar mosaic and shoestring symptoms collected in spring 2022 about 170 km south of Bordeaux. Again, amplifications were positive and the sequences of the amplicons showed 94.3 to 96.5% nt identity with the corresponding regions of the reference ASaV isolate and 93.9 to 94.3% identity with the French 2021-432 isolate. The PCR amplicon sequences for the two French isolates have been deposited in GenBank (OP501828-32). To our knowledge, these results represent the first report of a natural infection of ASaV in European ash in France. Identification of the virus in two ash populations about 150 km apart suggests the virus maybe widespread. The finding of ASaV in an ash tree with severe leaf symptoms and in which no other virus was identified by HTS supports its role as the causal agent of the symptoms observed. Ash trees in Europe are already threatened by the invasive ash dieback agent [3] and ASaV represents a further potential threat that deserves to be evaluated.