Original Host Plant Research Articles

Effects of experimental host‐plant switching on the life cycle of a fern spore‐feeding micromoth of the genus Stathmopoda

AbstractFern‐feeding insects have not received much attention because ferns have been considered herbivore‐resistant plants. However, ferns are attacked by herbivorous insects, including specialized spore feeders. For a better understanding of host specialization, we investigated the effect of experimentally transferred larvae of a spore‐feeding moth, Stathmopoda sp. (Lepidoptera: Stathmopodidae), from its original fern host Amauropelta linkiana (C. Presl) Pic. Serm., to three closely related species [Amauropelta rudis (Kunze) Pic. Serm, Amauropelta oligocarpa (Humb. & Bonpl. ex Willd.) Pic. Serm., and Amauropelta resinifera (Desv.) Pic. Serm.], and one alien fern species, Macrothelypteris torresiana (Gaudich.) Ching (all Thelypteridaceae). After experimental host‐plant transfer, we measured spore consumption of the larvae, and the survival and duration of each developmental stage. Once larvae were transferred to alternative hosts, they were still able to complete their life cycle, but consumed more spores, required more time to reach the adult stage, and had lower survival rates than on their original host, or even skipped the fifth instar on alternative hosts. Thus, our results suggested a strong adaptation of this moth species on its original host plant. We discuss some traits of experimental hosts, as the spores may contain fewer nutrients, or higher concentrations of toxic agents for larval development, thus restricting successful host‐plant switching. Further studies to measure the frequency and successful colonization of alternative hosts in nature are needed, by assessing variation in the chemical composition of spores between original and alternative hosts.

Comparative Genomics of Xylella fastidiosa Explores Candidate Host-Specificity Determinants and Expands the Known Repertoire of Mobile Genetic Elements and Immunity Systems.

Xylella fastidiosa causes diseases in many plant species. Originally confined to the Americas, infecting mainly grapevine, citrus, and coffee, X. fastidiosa has spread to several plant species in Europe causing devastating diseases. Many pathogenicity and virulence factors have been identified, which enable the various X. fastidiosa strains to successfully colonize the xylem tissue and cause disease in specific plant hosts, but the mechanisms by which this happens have not been fully elucidated. Here we present thorough comparative analyses of 94 whole-genome sequences of X. fastidiosa strains from diverse plant hosts and geographic regions. Core-genome phylogeny revealed clades with members sharing mostly a geographic region rather than a host plant of origin. Phylogenetic trees for 1605 orthologous CDSs were explored for potential candidates related to host specificity using a score of mapping metrics. However, no candidate host-specificity determinants were strongly supported using this approach. We also show that X. fastidiosa accessory genome is represented by an abundant and heterogeneous mobilome, including a diversity of prophage regions. Our findings provide a better understanding of the diversity of phylogenetically close genomes and expand the knowledge of X. fastidiosa mobile genetic elements and immunity systems.

Fitness comparison of Plutella xylostella on original and marginal hosts using age-stage, two-sex life tables.

The diamondback moth, Plutella xylostella, is an important agricultural pest that severely damages cruciferous vegetables. Although previously considered a threat only to Brassica species, P. xylostella has been observed to feed on noncruciferous vegetables. Here, we established a population of P. xylostella on the pea Pisum sativum (PxP population). We compared this PxP population's performance on the pea host plant to a population (PxR) reared on the original host plant radish (Raphanus sativus) for several generations using an age‐stage, two‐sex life table and analyzed the correlations between different fitness parameters. In the 1st generation of the PxP population, survival rate of immature stage was 17%, while the survival rate of PxR was 68%; the duration of the 4th larval instar (5.30 d) and mortality (25%) of this generation were significantly longer (2.8 d) and higher (1%) than that of PxR, respectively (both p < .001). Upon long‐term acclimation, the PxP fitness improved significantly, especially that the survival rate of immature stages increased to approximately 60% in the 15th, 30th, and 45th generations. However, PxP feeding on pea exhibited poorer fitness with longer larval developmental time, shorter total life span, lighter pupa, and lower fecundity in different generations compared with PxP feeding on radish. PxP feeding on pea also showed a significantly lower intrinsic rate of increase (r), net reproduction rate (R 0), finite increase rate (λ), and longer mean generation time (T) than PxP feeding on radish in all generations tested. Significant positive correlations were observed between pupal weight and female fecundity in pea‐fed populations, and between female longevity and female fecundity in pea‐fed and radish‐fed populations. Our findings suggest that P. xylostella adaptation to pea does not improve overall fitness compared with the original host radish, making pea a marginal host for P. xylostella.

The endemic Chamaecytisus albidus is nodulated by symbiovar genistearum of Bradyrhizobium in the Moroccan Maamora Forest

Out of 54 isolates from root nodules of the Moroccan-endemic Chamaecytisus albidus plants growing in soils from the Maamora cork oak forest, 44 isolates formed nodules when used to infect their original host plant. A phenotypic analysis showed the metabolic diversity of the strains that used different carbohydrates and amino acids as sole carbon and nitrogen sources. The isolates grew on media with pH values ranging from 6 to 8. However, they did not tolerate high temperatures or drought and they did not grow on media with salt concentrations higher than 85 mM. REP-PCR fingerprinting grouped the strains into 12 clusters, of which representative strains were selected for ARDRA and rrs analyses. The rrs gene sequence analysis indicated that all 12 strains were members of the genus Bradyrhizobium and their phylogeny showed that they were grouped into two different clusters. Two strains from each group were selected for multilocus sequence analysis (MLSA) using atpD, recA, gyrB and glnII housekeeping genes. The inferred phylogenetic trees confirmed that the strains clustered into two divergent clusters. Strains CM55 and CM57 were affiliated to the B. canariense/B. lupini group, whereas strains CM61 and CM64 were regrouped within the B. cytisi/B. rifense lineage. The analysis of the nodC symbiotic gene affiliated the strains to the symbiovar genistearum. The strains were also able to nodulate Retama monosperma, Lupinus luteus and Cytisus monspessulanus, but not Phaseolus vulgaris or Glycine max.Inoculation tests with C. albidus showed that some strains could be exploited as efficient inocula that could be used to improve plant growth in the Maamora forest.

The Limited Establishment of Native Ectomycorrhizal Fungi in Exotic Eucalyptus spp. Stands in Japan.

Host specificity may potentially limit the distribution expansion of ectomycorrhizal (ECM) fungi into areas where their original host plants are absent. To test this hypothesis, we investigated whether populations of native ECM fungi may establish in stands of exotic host trees, namely those of the Eucalyptus species, in Japan. ECM fungal communities associated with eucalyptus and surrounding native host species (Pinus thunbergii and Fagaceae spp.) were investigated at two sites; one site in which eucalyptus and native trees were growing in isolation, and a second site in which these species were mixed. To identify fungal taxa, the nuclear ribosomal internal transcribed spacer region 1 was sequenced for the ECM fungi from the root tips and clustered into operational taxonomic units (OTUs). To confirm whether the retrieved OTUs were native to Japan, they were queried against the entire database of the National Center for Biotechnology Information, UNITE, and GlobalFungi, whereby sampling locations and associated hosts were obtained from sequences with ≥97% similarity. Eucalyptus trees were associated with seven and 12 ECM fungal OTUs, including putatively exotic OTUs in isolated and mixed sites, respectively. Among the 36 and 63 native ECM fungal OTUs detected from native hosts at isolated and mixed sites, only one OTU was shared with eucalyptus at the respective sites. This means that most native ECM fungi in Japan may be incapable of forming an association with exotic Eucalyptus spp. Notably, even ECM fungi associated with both Pinus and Quercus were not detected from eucalyptus, suggesting that host-fungus incompatibility is determined not only by host phylogenetic relatedness but also by host biogeographic affinities. Our findings show that the incompatibility with eucalyptus as well as dispersal limitation may prevent the distribution expansion of native ECM fungi in Japan into the distribution ranges of Eucalyptus spp., where the original hosts are absent.

Bradyrhizobium sp. sv. retamae nodulates Retama monosperma grown in a lead and zinc mine tailings in Eastern Morocco

The aim of this work was to characterize and identify some bacteria isolated from the root nodules of Retama monosperma grown in Sidi Boubker lead and zinc mine tailings. Very few root nodules were obtained on the root nodules of R. monosperma grown in these soils. The three bacteria isolated from the root nodules were tolerant in vitro to different concentrations of heavy metals, including lead and zinc. The rep-PCR experiments showed that the three isolates have different molecular fingerprints and were considered as three different strains. The analysis of their 16S rRNA gene sequences proved their affiliation to the genus Bradyrhizobium. The analysis and phylogeny of the housekeeping genes atpD, glnII, gyrB, recA, and rpoB confirmed that the closest species was B. valentinum with similarity percentages of 95.61 to 95.82%. The three isolates recovered from the root nodules were slow-growing rhizobia capable to renodulate their original host plant in the presence of Pb-acetate. They were able to nodulate R. sphaerocarpa and Lupinus luteus also but not Glycine max or Phaseolus vulgaris. The phylogeny of the nodA and nodC nodulation genes as well as the nifH gene of the three strains showed that they belong to the symbiovar retamae of the genus Bradyrhizobium. The three strains isolated could be considered for use as inoculum for Retama plants before use in phytoremediation experiments.

Host Range Expansion of an Endemic Insect Herbivore is Associated With High Nitrogen and Low Fibre Content in Exotic Pasture Plants.

Endemic moth species of the genus Wiseana spp. (Hepialidae) have become serious pests of introduced pasture plants in New Zealand. The original native host plants of these moths have not been confirmed. This study investigated the performance (survival, development time, weight gain) of three Wiseana species on seven putative host plants: five native and two exotic species. The aim was to identify native hosts for the three Wiseana species and to compare their performance on native plants and exotic pasture plants. The chemical composition of the seven putative host plants was investigated to compare native and exotic plant chemistries, and to test for associations between plant characteristics and performance of selected Wiseana species. Carbon, nitrogen, silica and fibre contents were measured for each plant species; primary metabolite composition was determined by gas chromatography-mass spectrometry. For the three moth species, increased survival and weight gain were significantly associated with high nitrogen and low fibre contents in one exotic host plant, white clover (Trifolium repens), although one species, W. umbraculata, did not complete development to adult on any of the plants tested, including clover. Two exotic plants (T. repens, Lolium perenne × Lolium multiflorum), and two native plants (Aciphylla squarrosa and Festuca actae) supported W. copularis development to the adult stage, but only one exotic (T. repens) and one native (F. actae) species supported complete development of W. cervinata. Exotic and native plant species had distinct metabolite profiles, but there was no significant association between metabolite composition and Wiseana performance. We conclude that W. copularis and W. cervinata, but not W. umbraculata, have expanded their host range, because of their ability to use both native and new hosts. No evidence was found for a host shift, i.e., a loss of performance on the ancestral host compared with the new host.

Symbiotic, phenotypic and genotypic characterization of Bradyrhizobium sp. nodulating Spartium junceum L. from Bejaia, northeastern Algeria

Twenty-three bacterial strains were isolated from root nodules of Spartium junceum L., growing wild in four distinct geographic locations in Bejaia city (Northeastern Algeria). They were analyzed based on their symbiotic effectiveness, phenotypic properties and restriction fragment length polymorphism of the 16S rRNA gene. In addition, sequence analyses of the ribosomal gene, protein-coding housekeeping genes glnII and recA, and symbiotic gene (nodC) were used to clarifying their taxonomic and phylogenetic position. Plant infection tests revealed that all strains were able to form nodules on their original host plant, but with variable nodulation ability and symbiotic effectiveness. All strains were slow-growing, alkali-producing rhizobia in YEMA medium. According to phenotypic test results, the strains were grouped in four main clusters in a UPGMA dendrogram, while they were discriminated into 12 distinct genotypes by 16S rDNA-RFLP. Phylogenetic analyses of 16S rRNA genes and two concatenated housekeeping genes, glnII and recA, distributed the representative strains from each RFLP genotypes into two major clades within Bradyrhizobium genus. Some of these strains were closely related to B. retamae and B. japonicum whereas others represented four novel genospecies. Based on analysis of the symbiotic gene sequence (nodC), all strains were placed in the symbiovar retamae cluster except for SjBA12 which possibly constitutes a new symbiovar within the genus Bradyrhizobium.

Adaptive changes in morph and preference induced by novel host plants mediate host specialization of the cotton–melon aphid

Flexibility and variations in morphological and physiological traits are the key for insect herbivores to adapt to environments. The cotton–melon aphid Aphis gossypii Glover is a polyphagous insect which populations exhibit host specialization. Feeding experience on specific host plants converted host specialization in this aphid. However, adaptive changes of this aphids during the host conversion are still unclear. Here, we examined variations in body length, leg segments, and host preference of the cotton-specialized and cucurbit-specialized aphids, A. gossypii, induced by novel host plants. We found that on the original host plants, body, femur, tibia, and tarsus of the cucurbit-specialized aphids were significantly longer than these of the cotton-specialized aphids. However, feeding on zucchini or cowpea resulted in the short body and leg segments in the cucurbit-specialized aphids, whereas led to the long body and leg segments or no changes in the cotton-specialized aphids, and consequently, the tarsus lengths became equal between the cotton- and cucurbit-specialized aphids. Interestingly, the change trends of the relative lengths of leg segments to body length with the increase of reared generation on zucchini were almost different between the cucurbit-specialized and cotton-specialized aphids, especially the relative length of tarsus, but on cowpea, the trends were similar. Meanwhile, feeding on zucchini altered host preference of the cotton-specialized aphids, but not of the cucurbit-specialized aphids. Novel host plants induce adaptive changes in leg segments and host preference of aphids, suggesting the conversion of host specialization.

Multiphase characterization of wild Vigna associated root nodule bacteria from Japanese subtropical islands unveiled novel high temperature resistant Bradyrhizobium strains having high symbiotic compatibility with soybean and mungbean

ABSTRACT Vigna riukiuensis plant – a rare type of vigna, found only in Taiwan and the islands of Okinawa prefecture, Japan – possesses intrinsic property of high level of salt and heat tolerance. To understand the diversity and identify suitable rhizobia, multiphase characterization of root nodule bacteria associated with V. riukiuensis grown in Ishigaki and Iriomote Islands of Okinawa prefecture was performed. Multigene phylogenetic analysis of housekeeping genes based on 16S rRNA gene sequences, 16S-23S rRNA gene internal transcribed spacer (ITS) and 23S rRNA gene sequences identified three main groups closely similar to Bradyrhizobium japonicum, B. elkanii and B. jicamae family. However, analysis of symbiotic nifH and nodD1 genes and their phylogenetic trees showed similar topology, having only few discrepancies in comparison to the housekeeping gene phylogeny. Interestingly, for some of the isolates having similarity with B. elkanii, growth was observed at 40°C, which exceed the highest record for B. elkanii to the best of our knowledge. All the isolates were observed to have the capability of forming root nodules and fix nitrogen in their original host plant V. riukiuensis and two other crops: soybean and mungbean. Most of the isolates showed similar or higher nitrogen-fixing capability in comparison with B. diazoefficiens USDA110 in V. riukiuensis and V. radiata (mungbean), and Iri 5/6 in V. riukiuensis, Iri 5/12 in soybean and Ishi 7/2 in mungbean showed highest acetylene reduction assay (in µmol/h/gm nodule dry weight) activity, which was significantly higher than B. diazoefficiens USDA110. In addition, six isolates attained higher soybean biomass production compared with B. diazoefficiens USDA110, suggesting high symbiotic compatibility with soybean. Among them, Iri 5/7 of B. elkanii group contributed 29% higher soybean biomass production than B. diazoefficiens USDA110 and could grow at 40°C, hence it could be a promising soybean inoculant in the tropics. Abbreviations ARA: acetylene reduction assay, ISR: intergenic spacer regions, ITS: internal transcribed spacer

Extremely divergent host plant acceptance with gene flow between sympatric host races of the phytophagous ladybird beetle Henosepilachna diekei

AbstractEcological divergence alone can prevent the majority of gene flow in the absence of other forms of reproductive isolation. Although the importance of ecological divergence in promoting reproductive isolation has been broadly recognized, its net impact on speciation has rarely been estimated in the wild. The phytophagous ladybird beetle Henosepilachna diekei Jadwiszczak &amp; Wegrzynowicz includes two sympatric host races that are reproductively isolated solely by extreme specialization to either of the host plants Mikania micrantha Kunth (Asteraceae) or Leucas lavandulifolia Sm. (Lamiaceae) in West Java, Indonesia. To investigate the impact of differential host use as an isolating barrier, we carried out adult host acceptance tests and molecular population genetic analyses based on mitochondrial ND2 and nucleic ITS2 gene sequences using 13 wild populations of the host races, including four sympatric population pairs. Almost all individuals of these host races persistently accepted only the original host plant. We detected restricted but a degree of gene flow between these host races. A migration event occurred only in very recent time compared to their divergence time, indicating recent secondary contact of these host races in the surveyed area. These results reveal the remarkably large impact of host‐plant shift over almost the entire process of speciation and illustrate that ecological divergence has been maintained even under the presence of a certain degree of gene flow.

Potential for Acanthoscelides obtectus to Adapt to New Hosts Seen in Laboratory Selection Experiments.

Effective pest management strategies for a targeted pest species must rely on accurate, reliable and reproducible estimates of population dynamics. Importance of such approaches is even more conspicuous when assessing pest’s potential to utilize other stored products. Using an experimental evolution approach, we have focused our attention on a common bean pest, the seed beetle (Acanthoscelides obtectus). We looked into the potential to invade and sustain population growth on two suboptimal host plants (chickpeas and mung beans). Such an approach simulates steps of the host-shift process in storages. By analyzing population dynamics during initial encountering with a new host plant, we detected a population drop for both novel hosts. However, transgenerational development in a novel environment resulted in a constant population growth in chickpeas, but not in mung bean populations. Reversal of chickpea selected populations to original host plant has led to a severe decrease in population parameters due to low viability of immatures, while the opposite trend was detected in mung bean populations. This paper highlights the importance of good practice in estimating population dynamics for economically important species. With special emphasis on storage pest species, we discuss how this approach can be useful for estimating invading potential of pest insects.

First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

First report of Turnip crinkle virus infecting garlic mustard (Alliaria petiolata) in Germany

In May 2018, three samples of wild garlic mustard (Alliaria petiolata, Brassicaceae) were collected from a private garden in Koenigslutter, Germany. While sample EPV_18_002 was asymptomatic apart from slight yellowing, samples EPV_18_003 and EPV_18_004 showed stunting, yellowing, necrosis and severe crinkling (Figs. 1-3). It was possible to mechanically transmit the suspected virus from all three samples to Nicotiana benthamiana; the same systemic symptoms of leaf crinkling, rolling and yellowing appeared seven days post infection on all plants, and the plants died in the second week. Infected N. benthamiana leaves were analysed by electron microscopy and icosahedral particles of c. 30 nm in diameter were observed that reacted with antibodies (Julius Kuehn Institute, reference number JKI-1177) raised against a UK isolate of Turnip crinkle virus (TCV) (Fig. 4). To obtain the full viral genome, dsRNA was extracted from symptomatic N. benthamiana leaves (inoculated from sample EPV_18_002) using a Viral dsRNA Extraction Mini Kit for Plant Tissue (iNtRON, South Korea) and sent for library preparation and sequencing on Illumina NovaSeq 6000 platform (2times150 bp) at Eurofins GATC Biotech GmbH, Germany. Using Geneious Prime (2019.0.4), the raw reads were quality trimmed, filtered, error corrected and normalised, followed by de novo assembly. A BLASTn search of the generated contigs confirmed the presence of eight contigs (131 to 4,057nt) with nucleotide (nt) identities of 82.3% to 86.7% to TCV (NC_003821); there was no indication of the presence of satellite RNAs. The full genome of the German TCV isolate (JKI ID 29306) was assembled using this reference genome. The complete genome of TCV-JKI-29306 was 4,061 nt (accession no. MK301398). The presence of TCV was confirmed in all three original samples by RT-PCR using OneTaq One-Step RT-PCR Kit (NEB, USA) with the primer pair (HZ632 5'-AAAGGCAAAACTGGGTGGGA-3' and HZ633 5'-TAAAGTTTGCGGCTAGGGG -3') generating a 339 bp fragment. In further comparisons using MUSCLE (3.8.425, Edgar, 2), the German TCV isolate shared 82.8% nt identity to NC_003821 and 82.6% to AY312063 (Table 1). Additionally, the protein sequences of the different TCV genes shared identities of 75.0 to 90.7% to the proteins of NC_003821 and AY312063 (Table 1). According to ICTV criteria, these data indicate the presence of a novel TCV strain (Rochon et al., 4). TCV belongs to the genus Betacarmovirus (family Tombusviridae). It infects members of the Brassicaceae family causing crop losses (Broadbent & Heathcote, 1; Lister, 3). To our knowledge, this is the first report of a TCV strain from Germany occurring on garlic mustard. Although TCV is one of the model organisms in plant virology and therefore well studied, there is surprisingly little literature available on occurrence, host range and impact of this virus. As the original host plants appeared as weeds in a private garden (approximately 40 plants with a minority displaying symptoms), the impact of TCV in Germany and other countries on cultivated crop plants is currently unknown. This work was financed by the Euphresco network 2015-F-172 “NGSdetect”. Y. Gaafar was supported by the GERLS scholarship.

The plant-growth-promoting actinobacteria of the genus Nocardia induces root nodule formation in Casuarina glauca.

Actinorhizal plants form a symbiotic association with the nitrogen-fixing actinobacteria Frankia. These plants have important economic and ecological benefits including land reclamation, soil stabilization, and reforestation. Recently, many non-Frankia actinobacteria have been isolated from actinorhizal root nodules suggesting that they might contribute to nodulation. Two Nocardia strains, BMG51109 and BMG111209, were isolated from Casuarina glauca nodules, and they induced root nodule-like structures in original host plant promoting seedling growth. The formed root nodule-like structures lacked a nodular root at the apex, were not capable of reducing nitrogen and had their cortical cells occupied with rod-shaped Nocardiae cells. Both Nocardia strains induced root hair deformation on the host plant. BMG111209 strain induced the expression of the ProCgNin:Gus gene, a plant gene involved in the early steps of the infection process and nodulation development. Nocardia strain BMG51109 produced three types of auxins (Indole-3-acetic acid [IAA], Indole-3-Byturic Acid [IBA] and Phenyl Acetic Acid [PAA]), while Nocardia BMG111209 only produced IAA. Analysis of the Nocardia genomes identified several important predicted biosynthetic gene clusters for plant phytohormones, secondary metabolites, and novel natural products. Co-infection studies showed that Nocardia strain BMG51109 plays a role as a "helper bacteria" promoting an earlier onset of nodulation. This study raises many questions on the ecological significance and functionality of Nocardia bacteria in actinorhizal symbioses.

Frankia irregularis sp. nov., an actinobacterium unable to nodulate its original host, Casuarina equisetifolia, but effectively nodulates members of the actinorhizal Rhamnales.

A red pigmented actinobacterium designated G2T, forming extremely branched vegetative hyphae, vesicles and mutilocular sporangia, was isolated from Casuarina equisetifolia nodules. The strain failed to nodulate its original host plant but effectively nodulated members of actinorhizal Rhamnales. The taxonomic position of G2T was determined using a polyphasic approach. The peptidoglycan of the strain contained meso-diaminopimelic acid as diagnostic diamino acid, galactose, glucose, mannose, rhamnose, ribose and xylose. The polar lipid pattern consisted of phosphatidylinositol (PI), diphosphatidylglycerol (DPG), glycophospholipids (GPL1-2), phosphatidylglycerol (PG), aminophospholipid (APL) and unknown lipids (L). The predominant menaquinones were MK-9 (H4) and MK-9 (H6) while the major fatty acids were iso-C16 : 0, C17 : 1ω8c and C15 : 0. The size of the genome of G2T was 9.5 Mb and digital DNA G+C content was 70.9 %. The 16S rRNA gene showed 97.4-99.5 % sequence identity with the type strains of species of the genus Frankia. Digital DNA -DNA hybridisation (dDDH) values between G2T and its nearest phylogenetic neighbours Frankia elaeagniand Frankia discariaewere below the threshold of 70 %. On the basis of these results, strain G2T (=DSM 45899T=CECT 9038T) is proposed to represent the type strain of a novel species Frankia irregularis sp. nov.

Maladaptive host choice by an alien leaf miner Phyllonorycter leucographella (Lepidoptera: Gracillariidae) has the potential to limit its invasiveness

Alien phytophagous insects are often introduced along with their host plants, creating opportunities for troublesome invasions. Yet, not all of them are able to successfully colonize novel host plants. In this study, we investigated host selection by the alien leaf miner Phyllonorycter leucographella (Zeller, 1850) on both its original host and novel host plants in the insect's alien range. We predicted that this insect's percentage infestation of the original host would be positively related to its specific leaf area (SLA), because high-SLA leaves are nutritious and have thin cuticles, traits related to high offspring developmental success. We further hypothesized that this host selection process would apply in the selection of novel host plants. Our results show that this leaf miner selects leaves of its original host plant, Pyracantha coccinea, according to their SLA values. The SLA value was also positively related to the probability of P. leucographella infesting and successfully developing on novel host plants. The selection of high-SLA plants by the moth leads to a high developmental success on novel host plants in the first (summer) generation, but it is likely to be maladaptive in the second (overwintering) generation, because in temperate Europe, high SLA values are associated with deciduous plants that shed their leaves in autumn. It is likely that the apparent maladaptive selection of novel host plants by P. leucographella reduces the invasiveness of this pest by preventing its establishment on native plants.

Restoring Waning Production of Volatile Organic Compounds in the Endophytic Fungus Hypoxylon sp. (BS15).

Certain endophytic fungi belonging to the Hypoxylon genus have recently been found to produce volatile organic compounds (VOCs) that have potential relevance as hydrocarbon fuels. Here, a recently discovered Hypoxylon sp. (BS15) was demonstrated to also produce VOCs, but with diminished VOC production after an extended period of in vitro growth. Restoring VOC production was partially achieved by growing BS15 in growth media containing finely ground woody tissue from the original host plant (Taxodium distichum). In an effort to isolate VOC production modulators, extracts from this woody tissue were made by sequentially extracting with dichloromethane, methanol, and water. Both the dichloromethane and water extracts were found to modulate VOC production, while the methanol extract had no effect. Surprisingly, the woody tissue remaining after exhaustive extraction was also shown to act as a VOC production modulator when included in the growth media, with changes observed in the production of four compounds. This woody tissue also induced production of two compounds not observed in the original BS15 extract. Filter paper had the same modulating effect as exhaustively extracted woody tissue, suggesting the modulation was perhaps due to cellulose degradation products. Overall, this study demonstrated that VOC production in BS15 can be influenced by multiple compounds in the woody tissue rather than a single modulator.

Investigating the Role of Endophytic Fungi in Gentiana scabra bge. by Cross-Growth Period Inoculation.

Gentiana scabra Bge. (gentian) is a Chinese medicinal plant. Endophytic fungi from the roots of gentian were isolated and cross-growth period inoculation was performed to study the roles of three Trichoderma spp. strains (F1, F2, and F9) in their original host plant. In treatments inoculated with F1, F2, and F9, gentiopicroside content increased 33.6, 23.7 and 13% than that in the control. Strains F1, F2, and F9 could also improve polysaccharide content by more than 6.6, 18.7 and 30% compared to the control. The incidence of spot blight in gentian inoculated with F1, F2, and F9 decreased by 31.2, 26.7 and 8.5%. Inconsistent changes in the activity of the three enzymes (superoxide dismutase, catalase and peroxidase) were observed when the plants were attacked by pathogens or inoculated with fungi. High enzymatic activity did not reflect mild disease. Cross-growth period inoculation, which takes into account the original living environment (gentian plant as "substrate" and different microorganisms as symbionts) of endophytic fungi, provides a new idea for studying effects of endophytes on their original hosts. This is the first research about the role of endophytic fungi in Gentiana scabra bge. in vivo.

Virulence variation of cucurbit powdery mildews in the Czech Republic – population approach

Kosman diversity models were applied to analyses of virulence (disease reaction patterns) variation of 115 isolates of two cucurbit powdery mildew (CPM) species, Golovinomyces orontii (Go) and Podosphaera xanthii (Px), collected in the Czech Republic from 2010 through 2012. Diversity within and distances between Go and Px populations and each other in a spatio-temporal context and with regard to original host plant species were analyzed based on virulence patterns of individual isolates on a set of 21 melon (Cucumis melo L.) race differential genotypes. Significant differentiation among the Go and Px pathogen populations was revealed, and the results clearly demonstrate and confirm that the set of differential C. melo genotypes is well composed because of high differentiation capacity. Differentiation of pathogens among years was significant for both species. No significant difference between Go isolates from different host plant species was established due to high variability among Go isolates, but there was significant host-specific differentiation among Px isolates. Differentiation of pathogens among regions was not detected. These results revealed high virulence variation in isolates of Go and Px, and their spatio-temporal fluctuations. High diversity in virulence of Go isolates supports the treatment of Go as a complex of different (sub)species with distinct virulence factors. Similar relationships of selected Go isolates in a UPGMA dendrogram in a previously reported multigene phylogenetic tree support the logic and suitability of the Kosman assignment based approach to population studies of organisms with asexual or mixed modes of reproduction. The approach applied in this study provides a complex view of virulence structures of powdery mildew populations, and when combined with race determination and denomination on melon, it may serve as a base to understandvirulence variation of these CPM species from a spatio-temporal viewpoint.