Nucleotide Sequence Of Region Research Articles

Monoclonal antibodies against jellyfish collagen.

Collagens are abundant structural proteins found in both mammalian and marine species, and attractive biomaterials used in various fields. Jellyfish collagen-based products have become increasingly popular because of their clinically proven health benefits such as the effects of skin wound healing and immune stimulation. To develop detection tools for jellyfish collagen, we generated four monoclonal antibodies, MCOL1, 2, 3, and 4, by immunizing mice with moon jellyfish collagen. The nucleotide and amino acid sequences of the variable regions of the monoclonal antibodies were determined. The antibody-binding kinetics toward collagens from moon jellyfish were evaluated using a surface plasmon resonance (SPR) biosensor, and the binding specificity was evaluated in comparison with binding to collagens from edible jellyfish, fish scales, and pig and cow skins. MCOL1, 3, and 4 specifically bound to moon jellyfish collagen, whereas MCOL2 bound to both moon and edible jellyfish collagens. Considering the results showing that the SPR responses of MCOL2 binding were greater than those seen with the other antibodies, MCOL2 could recognize the common and repetitive sequences of the two jellyfish collagens. Therefore, this monoclonal antibody will be most applicable for detecting jellyfish collagen.

Molecular identification of wood-decaying fungi of <i>Armillaria</i> genus widespread in Eastern Siberia and the Far East of Russia using ITS, IGS-1-1 and <i>Tef-1α</i> genetic markers

The genus Armillaria is an essential component of forest ecosystems playing very important ecological role in dead wood decomposition, but it often becomes a serious pathogen causing white root rot in trees. It is also known that Armillaria species significantly differ in the level of pathogenicity. Thus, accurate identification of Armillaria is critical for assessing the risk of tree disease. In this study we analyzed 28 Armillaria isolates from Siberia and the Far East using nucleotide sequences of ITS, IGS-1-1 and TEF-1α gene regions and generated phylogenetic trees based on maximum likelihood method. In total, four Armillaria species were identified: A borealis, A. cepistipes, A. ostoyae and A. gallica. A. borealis was the most frequent among collected isolates (18 out of 28 isolates). A. gallica, A. cepistipes and A. ostoyae were much less frequent with two, five and three isolates out of 28, respectively. Thedistribution of Armillaria species in Siberia and the Far East was described for the first time. It is concluded that further studies are necessary to determine the role of Armillaria in trees pathological dieback, and A. borealis should be a key focus.

Dengue virus type 3 infection in a traveler returning from Costa Rica to Japan in 2023

The number of dengue cases has increased dramatically in recent years. In Latin America, the number of cases and deaths in 2023 was the highest ever recorded. We report on a patient who had been infected with dengue virus during his stay in Costa Rica in September 2023, and developed the disease after returning to Japan. Plasma obtained from the patient was used for diagnosis and dengue virus serotyping by real-time PCR. The nucleotide sequence of the envelope region of dengue virus was then determined by the direct sequencing method, and this sequence was used for phylogenetic analyses. The patient was found to be infected with dengue virus type 3 genotype III. The sequence from the present case was more homologous with sequences registered in Florida, USA, associated with travel to Cuba in 2022 than with sequences registered in Costa Rica 10 years ago. The Pan American Health Organization reported that only dengue virus type 1 and 2 cases were reported in Costa Rica in 2019–2021, whereas dengue virus type 3 and 4 cases started being reported in 2022. In 2023, the reported numbers of cases with dengue virus types 3 and 4 exceeded those of dengue virus types 1 and 2. In addition, regional differences in endemic strains have been observed in Costa Rica. Our findings suggest that the dengue virus type 3 that infected the patient was more likely an influx of a strain that had been circulating in Caribbean countries such as Cuba in recent years, rather than a re-emergence of an indigenous virus in Costa Rica. The serotypes of dengue virus prevalent in Costa Rica have been changing since 2022. All four serotypes were prevalent in 2023, with a particularly sharp increase in the number of cases of dengue virus types 3 and 4. Future monitoring and surveillance are essential because changes in endemic serotypes can cause antibody-dependent enhancement, which can lead to severe dengue disease presentations.

Morphological and ecological traits of the rigid-leaved water crowfoot Ranunculus subrigidus (Batrachium, Ranunculaceae) in the Yenisei River (Siberia, Russia)

The study of water crowfoots in the Yenisei River confirmed the wide distribution of recently restored rigid-leaved North American-North Asian species Ranunculus subrigidus instead of previously mentioned European R. circinatus. The species identification as R. subrigidus was confirmed by the analysis of the ITS region nucleotide sequence and morphological data. In contrast to literature data, samples of this species collected in the Yenisei did not have sessile leaves, in half of the samples, the length between first and second bifurcation was greater than the maximum of 0.2 cm previously described for the species, in some of the samples, internodes were shorter than the leaves, also different types of pubescence were observed on plant shoot parts. The conditions under which this species grows in the Yenisei River differ from the previously reported ones, primarily, in such parameters as the water hardness and the flow regime. At the city of Krasnoyarsk, seasonal development of R. subrigidus is affected by the Krasnoyarsk Hydroelectric Power Plant. The paper presents a geobotanical description of the Yenisei River plant communities dominated by and containing R. subrigidus.

Isolation, Identification and Characterization of Phyllosticta citricarpa Causing Citrus Black Spot Disease in Benin

Citrus black spot is a major constraint to citrus production in Benin. Identification of the pathogen causing citrus black spot disease was carried out in the laboratory on symptomatic fruits. Fruit samples were collected from orchards in 4 citrus-growing agro-ecological zones. A total of 66 representative isolates of Phyllosticta sp. were obtained from isolation. Molecular analysis using PCR of the nucleotide sequences of the ITS regions with universal primers ITS1/ITS4 and specific primers GcF1/GcR and the phylogenetic tree showed that the sequences of all isolates obtained in the different agroecological zones were identical to those of Phyllosticta citricarpa. The pathogenicity test satisfied Koch's postulates by re-isolation of Phyllosticta citricarpa from inoculated fruits. A thorough study of genetic diversity and a full understanding of the behavior of P. citricarpa will pave the way for more targeted approaches to the prevention, control and sustainable management of citrus black spot disease in Benin.

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Canine Schistosomiasis in the West Coast: Heterobilharzia americana in Two Natural Intermediate Hosts Found in the Colorado River, California.

The emergence of infectious diseases presents a significant global health, economic, and security risk. Climate change can unexpectedly lead to the spread of pathogens, vectors, or hosts into new areas, contributing to the rise of infectious diseases. Surveillance plays a crucial role in monitoring disease trends and implementing control strategies. In this study, we document the first discovery of Heterobilharzia americana, a parasitic schistosome of mammals and its intermediate hosts Galba cubensis and Galba humilis along the banks of the Colorado River in California. We conducted multiple samplings of snails from various locations in the region with a previous history of canine schistosomiasis. Nucleotide sequencing of the multiple regions of the snails' and parasites' DNA revealed the coexistence of G. cubensis and G. humilis, both infected with H. americana. Phylogenetic analyses further validate the presence of H. americana in California, suggesting a wider distribution than previously reported. Our findings have implications for public health, veterinary medicine, and biodiversity conservation, contributing to developing effective control strategies to prevent the spread of this emerging infectious disease.

Hymenopellis areolata (Physalacriaceae: Agaricales), a new species from Margalla Hills National Park, Islamabad, Pakistan

During exploratory surveys of the fungal diversity in Margalla Hills National Park, Islamabad, we collected a new species of the genus Hymenopellis R.H.Petersen. This is the second report of any species of this genus from Pakistan. Hymenopellis areolata F.Razzaq & Khalid sp. nov. is characterized by an areolate pileus, small basidiospores, and transitional pileipellis (hymeniderm and epithelium) with small pileocystidia. Molecular phylogenetic analyses of the nucleotide sequences of nrITS and nrLSU regions, and morphological data support the description of this new species. A comparison with other closely related species confirmed that the newly described species is distinct from others.

Effects of Lactiplantibacillus plantarum CCFM1214 and Ligilactobacillus salivarius CCFM1215 on halitosis: a double-blind, randomized controlled trial.

The purpose of this study was to evaluate the effects of known probiotic species Lactiplantibacillus plantarum CCFM1214 and Ligilactobacillus salivarius CCFM1215 on halitosis, the oral status, and the oral microbiome. In a double-blind, randomized controlled trial that lasted for five weeks, 43 participants were divided into an oral probiotics group and a control group and given probiotics or control powder for the first four weeks, with the fifth week being the discontinuation period. 33 participants (probiotics group = 21, control group = 12) completed the entire experiment in the end. Oral samples were taken as part of oral health examinations during the baseline period (day 0) and four weeks after (day 28). The nucleotide sequence of the V3-V4 region of 16S rRNA was determined to examine the impact of intervention and time on the oral microbiome. The effects of L. plantarum CCFM1214 and L. salivarius CCFM1215 on the number of Fusobacterium nucleatum in gingival crevicular fluid (GCF) samples of participants were detected by quantitative PCR. After the intervention, L. plantarum CCFM1214 and L. salivarius CCFM1215 significantly reduced the levels of volatile sulfur compounds (VSCs) and the quantity of F. nucleatum in GCF samples, where the average DNA copy number per ng (log) of F. nucleatum decreased from 7.12 ± 0.04 to 6.01 ± 0.09. The β diversity of the probiotics group, on the whole, tended to be more concentrated and stable after the intervention. In addition, after probiotic intervention, the abundance of Lactobacillus and Bifidobacterium increased, while the abundance of Fusobacterium, Acinetobacter, Porphyromonas, and Aggregatibacter decreased significantly. In general, L. plantarum CCFM1214 and L. salivarius CCFM1215 can alleviate halitosis and considerably lower the value of VSCs and improve the oral microbiota in participants with halitosis.

Applications of the Third-Generation DNA Sequencing Technology to the Identification of Spoilage Microorganisms in the Brewing Industry.

A new nanopore sequencing-based method has been developed for the detection and identification of a wider range of microorganisms. This method uses universal primers to identify virtually all the bacterial or yeast/fungal species via the amplification and nucleotide sequencing of common ribosomal DNA regions. The simplicity of its protocol makes the method suitable for both small and large breweries.

Genetic inventory of rare and endemic plant species of the Baikal Region

Replenishment of databases with genetic information of various species is necessary to solve topical issues of their taxonomy and systematics. One way to obtain genetic data from herbarium vouchers is to determine the nucleotide sequences of individual nuclear and chloroplast regions, which are widely used for molecular identification and plant phylogeny. Rare and endemic plant species are often the least represented in the genetic databases. In this work, we studied endemic plant species: Astragalus angarensis, Hedysarum turczaninovii, Hedysarum zundukii, Oxytropis popoviana, Papaver popovii, Gueldenstaedtia verna, Tulipa uniflora, Eutrema cordifolium, Megadenia pygmaea, Mannagettaea hummelii which have different conservation status in the Irkutsk Region and in the Republic of Buryatia. For Papaver popovii and Astragalus angarensis, genetic data have been obtained for the first time; for other species, information on universal DNA barcodes has been supplemented. In addition, genetic differences between Mannagettaea from the Republic of Buryatia and the type species Mannagettaea hummelii Harry Sm. (China) were shown. More detailed study on Mannagettaea is necessary to clarify its species diversity. Thus, results obtained supplemented the genetic information of the vouchers of the species presented in the herbarium of the Siberian Institute of Plant Physiology and Biochemistry of the Siberian Branch of the Russian Academy of Sciences (SIPPB SB RAS). This DNA-barcoding expands application of the herbarium in integrative studies using genetic data and contributes to the further study of rare endemic species of the Baikal Region.

Phylogenetic characteristics and recombination analysis of echovirus 5 associated with severe acute respiratory infection in China.

Echovirus 5 (E5) belongs to the enterovirus B (EV-B) species, which is one of the pathogens causing respiratory diseases. Only two whole genome sequences (WGSs) of E5 are available in GenBank, and few studies on E5 have been reported worldwide. In this study, human rhabdomyosarcoma (RD) cells were used to isolate E5 from respiratory samples associated with severe acute respiratory infection (SARI). The nucleotide sequence of the VP1 region and the WGSs of two E5 strains were sequenced using Sanger sequencing and high-throughput sequencing technology, respectively. Together with 31 E5 VP1 sequences and 2 WGSs downloaded from GenBank, a total of 33 complete VP1 sequences and 4 WGSs were used for genetic characterization and evolutionary analysis. Phylogenetic analysis revealed five genotypes (A-E) based on complete VP1 sequences. Evolutionary analysis showed that the time to the most recent common ancestor of E5 was approximately 1952 (95% highest posterior density [HPD] range, 1948-1953]), with a mean substitution rate of 7.74 × 10-3 subs/site/year (95% HPD range, 6.44-9.11 × 10-3). In addition, the WGS analyses showed that the nucleotide and amino acid similarities of the coding regions of the two strains obtained in this study with the prototype of the E5 strain Noyce were 80.2% and 97.2%, respectively. Recombination analysis showed that the two E5 strains may have intraspecific recombination with E6, EV-B85, and CVA9 serotypes in the nonstructural region. This study reports the isolation of E5 from SARI cases for the first time, and genetic characterization and evolutionary analysis provide valuable information on global E5 molecular epidemiology.IMPORTANCEThis study is the first report of echovirus 5 (E5) associated with severe acute respiratory infection and obtained the first E5 whole-genome sequence in China. Combined with the sequences available in the GenBank database, the first genotyping, phylogenetic characteristics, recombination, and genetic evolutionary analysis of E5 was performed in this study. Our findings providing valuable information on global E5 molecular epidemiology.

A polyphasic approach leading to the discovery of new taxa of terrestrial cyanobacteria for the flora of Ukraine

Several morphotypes of filamentous cyanobacteria were found in the terrestrial habitats of the Kharkiv Region (biological soil crusts) and in the vicinity of Kyiv (old concrete wall in the forest). Morphological and molecular characterization of four original strains revealed that they belong to recently described genera Wilmottia Strunecký, Elster et Komárek, Pycnacronema M.D. Martins et Branco, Myxacorys Pietrasiak et J.R. Johansen and Tildeniella Mai, J.R. Johansen et Pietrasiak. All of them are new to the flora of Ukraine. Besides the analysis of p-distances, the nucleotide sequence of the 16S-23S ITS region and the secondary structures of its most informative helices, we used in our phylogenetic analyses sequences of the 16S rRNA gene. All Ukrainian strains joined the clades of the corresponding genera with a high degree of support in the Bayesian and Maximum Likelihood analyses. However, their species-level identification gave ambiguous results. Reliable result was obtained only for the strain of genus Wilmottia. It was identified as Wilmottia murrayi (W. et G.S.West) Strunecký, Elster et Komárek. This is the first morphologically and molecularly confirmed record of this species in Europe. Two strains were identified as Pycnacronema cf. caatingensis and Tildeniella cf. torsiva due to their deviations from these species both in morphology and the 16S–23S ITS secondary structures. In the 16S rRNA gene–based phylogenetic analysis, original strain of the genus Myxacorys took separate position among the known species of this genus and also had a number of morphological differences from them. Therefore, it might represent a new species, but this cannot be proven due to the lack of a 16S-23S ITS sequence of the original strain. Detailed description of morphology of the studied strains with tabular review of corresponding species are given.

Morphological characteristics and nucleotide sequence of ITS region and rbcL gene of Cu cang native taro

Cu cang taro cultivar in Thuan Chau district, Son La province is a precious indigenous genetic resource with high quality and well adapted to the characteristic natural conditions of Thuan Chau district, Son La province of Vietnam. However, Cu cang taro has been mixed with different cultivars in the locality. In this article, the authors presented morphological characteristics and nucleotide sequence of ITS(Internal Transcribed Spacer) region and rbcL gene of Cu cang taro in Thuan Chau district, Son La province. The ITS region and rbcL sequences isolated from Cu cang taro had sizes 506 and 630 bp. The results of similarity comparison on NCBI identified the DNA isolated from the ITS region, the rbcL gene of Cu cang taro is Colocasia esculenta species. The rbcL gene of Cu cang taro has 99.27% similarity with Colocasia esculenta var. antiquorum.

Serum components influence antibody reactivity to glycan and DNA antigens

We previously generated three types of anti-glycan monoclonal IgM antibodies that react with certain structures on the glycans of glycosphingolipids and glycoproteins. As the nucleotide sequences for the variable regions of these IgM antibodies showed homology with those of anti-DNA antibodies deposited in public databases, we analyzed the reactivity of the anti-glycan IgM antibodies to DNA by ELISA. We found that anti-α2,6-sialyl LacNAc IgM in the supernatant of a hybridoma culture cross-reacted with DNA, and after purification of the IgM by zirconia column chromatography, the highly purified IgM showed increased cross-reactivity to DNA. As most of the contaminating bovine serum proteins in the culture supernatant were removed by the purification process, it is likely that a part of the removed components influences antibody reactivity to DNA. Purified anti-DNA antibodies prepared from lupus model NZB/W F1 and MRL/lpr mouse sera and normal human serum were then analyzed, and similar results showing increased reactivity to DNA were obtained. Furthermore, ELISA using these purified antibodies and various carbohydrate antigens showed that the antigen-binding specificity of these antibodies was altered by the purification process from serum-containing antibody preparations. Our results indicate that mammalian serum contains components that strongly influence antibody reactivity to carbohydrate antigens, including DNA.

Molecular Diversity of Human Respiratory Syncytial Virus before and during the COVID-19 Pandemic in Two Neighboring Japanese Cities.

Human respiratory syncytial viruses (HRSVs) are divided into subgroups A and B, which are further divided based on the nucleotide sequence of the second hypervariable region (HVR) of the attachment glycoprotein (G) gene. Understanding the molecular diversity of HRSV before and during the coronavirus disease 2019 (COVID-19) pandemic can provide insights into the effects of the pandemic on HRSV dissemination and guide vaccine development. Here, we analyzed HRSVs isolated in Fukushima Prefecture from September 2017 to December 2021. Specimens from pediatric patients were collected at two medical institutions in neighboring cities. A phylogenetic tree based on the second HVR nucleotide sequences was constructed using the Bayesian Markov chain Monte Carlo method. HRSV-A (ON1 genotype) and HRSV-B (BA9 genotype) were detected in 183 and 108 specimens, respectively. There were differences in the number of HRSV strains within clusters prevalent at the same time between the two hospitals. The genetic characteristics of HRSVs in 2021 after the COVID-19 outbreak were similar to those in 2019. HRSVs within a cluster may circulate within a region for several years, causing an epidemic cycle. Our findings add to the existing knowledge of the molecular epidemiology of HRSV in Japan. IMPORTANCE Understanding the molecular diversity of human respiratory syncytial viruses during pandemics caused by different viruses can provide insights that can guide public health decisions and vaccine development.

Analysis of <i>BMP2</i> gene polymorphism of bone morphogenetic protein-2 in reindeer

The BMP2 gene of reindeer was study by Sanger sequencing. The BMP2 gene is involved in the formation of bone tissue and skeletal muscle in mammals. The BMP2 gene is associated with an increase in height, size, and body weight in productive animals. For the first time, the nucleotidesequence of the coding and regulatory regions of the BMP2 gene was determined in populations of wild and domestic reindeer.As a result, a segment of the reindeer BMP2 candidate gene was sequence, including the first untranslated and second exons. Loci with low (exon1) and high (exon2) degree of polymorphism identified.Single nucleotide mismatches with the reference genome (white-tailed deer (Odocoileus virginianus texanus) genome) identified, which can be used for phylogenetic analysis of the evolution of orthologue genes, as well as for genetic identification of species. Twelve polymorphic loci of two types were identified: in/del and SNP. The most significant substitutions were also determined in accordance with the change in the amino acid composition of the protein and the chemical properties of the replaced amino acids. Calculations were made of the occurrence of genotypes and alleles according to the identified variants of genetic polymorphism in the analyzed populations of reindeer (Nenets and Evenk breeds, wild reindeer).The object of research was wild and domestic reindeer on the farms of the Taimyr Peninsula and Evenkia. The material for the study was DNA isolated by the classical phenol method from the blood of domestic reindeer of two breeds - Nenets (n=20) and Evenki (n=20), as well as from tissue samples of wild reindeer (n=20).The aim of the study was to search for and select potential variants of genetic polymorphism in the BMP2 gene as molecular genetic markers that can be recommend for use in the practice of reindeer breeding to increase meat productivity.For the first time, the nucleotide sequence of significant regions of the reindeer BMP2 gene was determined. The polymorphic loci in the BMP2 gene identified as a result of the studies had differences in the frequency of occurrence of alleles of mutant and wild types in the studied samples of domestic reindeer of the Nenets and Evenk breeds, as well as in the sample of wild reindeer. Differences in occurrence indicate the effect of selection factors on the region of the BMP2 gene. The revealed genetic variability of the studied region in reindeer breeds contrasting in productivity is a preliminary confirmation of the influence of genetic polymorphism in the BMP2 gene on the variability of phenotypes in terms of height and weight indicators. Indicators of growth and live weight are key to the formation of the meat productivity of reindeer. The results of studies of the effect of BMP2 gene polymorphism on growth and weight parameters in other animal species suggest that some of the identified variants of genetic polymorphism in the studied region of the BMP2 gene may turn out to be casual mutations that can affect the formation of quantitative traits in domestic reindeer.

Criticism and bibliography: Zmitrovich I. V., Perelygin V. V., Zharikov M. V. Nomenclature and rank correlation of higher taxa of eukaryotes. Мoscow: INFRA-M, 2022. 183 p. ISBN 978-5-16-018531-6. (Book series “Folia Cryptogamica Petropolitana”. № 8)

The monograph titled "Nomenclature and Rank Correlation of Eukaryotic Higher Taxa," written by I.V. Zmitrovich, V.V. Perelygin, and M.V. Zharikov, has a unique feature - it is addressed to both theoretical biologists dealing with problems of systematics and practitioners who develop issues of industrial microbiology, bioengineering, and biomedicine. It unites these areas of biology through systematics, which, as academician A.L. Takhtajan said, is the basis and pinnacle of biology.
 Modern progress in molecular biology allows for the precise determination of the relationship between organisms based on the diagnostic nucleotide sequences of important genome regions, leading to important discoveries. For example, Pneumocystis carinii, which was long considered a protozoan and classified as a sporozoan, turned out to be a fungus related to some yeast groups. This information was demanded by pharmacologists who know which antibiotics are effective against fungal infections. However, an excessive flow of scientific information can hinder the systematization and classification according to the existing paradigm of information hysteresis. Changes in systematics happen so quickly that Internet classifiers cannot keep up with them. In addition, there are many competing versions of classification, which makes it difficult to find the optimal solution for a user who does not follow the latest developments in systematics. This can be time-consuming and resource-intensive, making the classification process more complicated.
 The authors of this monograph aim to systematize all new data expressed in recent years in the field of eukaryotic classification, to determine the consensus of experts' opinions, and to identify those moments on which consensus has not been reached. This mainly concerns the taxonomic rank of groups, which reflects the degree of their differences. To determine the rank of large groups, it is necessary to carefully consider the topology of the enormous eukaryotic tree from different perspectives. Each research group working in different areas of this tree research takes into account its overall topology, but the amount of information is so large that there is not always enough time for a complete and detailed review. However, the authors of this monograph conducted such a review, conveying to the reader the rank structure of the system of eukaryotes, the development of which is based on modern phylogenetic classification.
 It is important to note that the next stage of the authors' work on systematics will be further research on the development of algorithms for managing microbial communities in different environmental conditions with different sets of limiting factors to implement the useful properties of microorganisms with different secretory activity. The book contains an extensive auxiliary apparatus, including interesting notes discussing various issues such as the priority of domestic researchers in discovering the antibiotic activity of Penicillium, the "Florida hypothesis" of the origin of fungi, and a detailed presentation of the group of fungus-like protists oomycetes.

Metrological support of sequence analysis of nucleic acids

Metrological support for the process of molecular genetic identification is provided. An establishment of a nucleotide sequence is the general aim in nucleic acids analysis. A nucleotide sequence of DNA/RNA is the key information which gives an idea of the role and functioning of nucleic acids in living systems, as well as it allows establishing the origin of biological objects during molecular genetic identification. The molecular genetic identification is based on modern methods of research in the sequencing of DNA, which is inherited from generation to next generation of living organisms. DNA sequence comparison in some cases is mandatory to establish the authenticity of biological objects and to determine biological affiliation or kinship with other biological objects. The problems of metrological support of molecular genetic identification by Sanger DNA sequencing using fluorescently labeled reaction terminators and the use of capillary electrophoresis on the example of fish identification are considered. Metrological support of the process includes the use of such definitions as a nucleotide (the nucleic acid monomer), a sequence of nucleotides of nucleic acids. Also, it involves the procedures used in certified methods, a standard sample of a known DNA sequence of an approved type, and a genetic analyzer.Standard Reference Materials of a fragment of human mitochondrial DNA was developed, approved, entered into the Federal registry. The tests of the domestic genetic analyzer Nanophore 05 were carried out. Two measurement procedures “The measurement methodology the partial nucleotide sequence of the control region of mitochondrial DNA of fish (families Acipenseridae and Polyodontidae) by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” and “The measurement methodology the nucleotide sequence of the 5’ region of the mitochondrial COI gene of water biological resources by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” were tested and certified. The results are relevant to research in biological sciences, the food industry, biotechnology, and DNA forensics.

Mitochondrial DNA Polymorphism in HV1 and HV2 Regions and 12S rDNA in Perimenopausal Hypertensive Women.

Estrogens enhance cellular mitochondrial activity. The diminution of female hormones during menopause may have an effect on the mitochondrial genome and the expression of mitochondrial proteins. Hence, oxidative stress and the pro-inflammatory state contribute to the formation of systemic illnesses including arterial hypertension (AH). This study aimed to determine the types and frequency of mutations in the mitochondrial DNA (mtDNA) nucleotide sequence in the hypervariable regions 1 and 2 (HV1 and HV2) and the 12S RNA coding sequence of the D-loop in postmenopausal women with hypertension. In our study, 100 women were investigated, 53 of whom were postmenopausal and 47 of whom were premenopausal (53.9 ± 3.7 years vs. 47.7 ± 4.2 years, respectively). Of those studied, 35 premenopausal and 40 postmenopausal women were diagnosed with AH. A medical checkup with 24 h monitoring of blood pressure (RR) and heart rate was undertaken (HR). The polymorphism of the D-loop and 12S rDNA region of mtDNA was examined. Changes in the nucleotide sequence of mtDNA were observed in 23% of the group of 100 women. The changes were identified in 91.3% of HV1 and HV2 regions, 60.9% of HV1 segments, 47.5% of HV2 regions, and 43.5% of 12S rDNA regions. The frequency of nucleotide sequence alterations in mtDNA was substantially higher in postmenopausal women (34%) than in premenopausal women (10.6%), p = 0.016. A higher frequency of changes in HV1 + HV2 sections in postmenopausal women (30.2%) compared to the premenopausal group (10.6%) was detected, p = 0.011. Only postmenopausal women were found to have modifications to the HV2 segment and the 12S rDNA region. After menopause, polymorphism in the mtDNA region was substantially more frequent in women with arterial hypertension than before menopause (p = 0.030; 37.5% vs. 11.5%). Comparable findings were observed in the HV2 and HV1 regions of the AH group (35% vs. 11.5%), p = 0.015, in the HV1 segment (25% vs. 11.5%), p = 0.529, and in the HV2 segment, 12S rDNA (25% vs. 0%). More than 80% of all changes in nucleotide sequence were homoplasmic. The mtDNA polymorphisms of the nucleotide sequence in the HV1 and HV2 regions, the HV2 region alone, and the 12S RNA coding sequence were associated with estrogen deficiency and a more severe course of arterial hypertension, accompanied by symptoms of adrenergic stimulation.