Nucleotide Sequence Of Region Research Articles

Isolation, Identification and Characterization of Phyllosticta citricarpa Causing Citrus Black Spot Disease in Benin

Citrus black spot is a major constraint to citrus production in Benin. Identification of the pathogen causing citrus black spot disease was carried out in the laboratory on symptomatic fruits. Fruit samples were collected from orchards in 4 citrus-growing agro-ecological zones. A total of 66 representative isolates of Phyllosticta sp. were obtained from isolation. Molecular analysis using PCR of the nucleotide sequences of the ITS regions with universal primers ITS1/ITS4 and specific primers GcF1/GcR and the phylogenetic tree showed that the sequences of all isolates obtained in the different agroecological zones were identical to those of Phyllosticta citricarpa. The pathogenicity test satisfied Koch's postulates by re-isolation of Phyllosticta citricarpa from inoculated fruits. A thorough study of genetic diversity and a full understanding of the behavior of P. citricarpa will pave the way for more targeted approaches to the prevention, control and sustainable management of citrus black spot disease in Benin.

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Canine Schistosomiasis in the West Coast: Heterobilharzia americana in Two Natural Intermediate Hosts Found in the Colorado River, California.

The emergence of infectious diseases presents a significant global health, economic, and security risk. Climate change can unexpectedly lead to the spread of pathogens, vectors, or hosts into new areas, contributing to the rise of infectious diseases. Surveillance plays a crucial role in monitoring disease trends and implementing control strategies. In this study, we document the first discovery of Heterobilharzia americana, a parasitic schistosome of mammals and its intermediate hosts Galba cubensis and Galba humilis along the banks of the Colorado River in California. We conducted multiple samplings of snails from various locations in the region with a previous history of canine schistosomiasis. Nucleotide sequencing of the multiple regions of the snails' and parasites' DNA revealed the coexistence of G. cubensis and G. humilis, both infected with H. americana. Phylogenetic analyses further validate the presence of H. americana in California, suggesting a wider distribution than previously reported. Our findings have implications for public health, veterinary medicine, and biodiversity conservation, contributing to developing effective control strategies to prevent the spread of this emerging infectious disease.

Hymenopellis areolata (Physalacriaceae: Agaricales), a new species from Margalla Hills National Park, Islamabad, Pakistan

During exploratory surveys of the fungal diversity in Margalla Hills National Park, Islamabad, we collected a new species of the genus Hymenopellis R.H.Petersen. This is the second report of any species of this genus from Pakistan. Hymenopellis areolata F.Razzaq & Khalid sp. nov. is characterized by an areolate pileus, small basidiospores, and transitional pileipellis (hymeniderm and epithelium) with small pileocystidia. Molecular phylogenetic analyses of the nucleotide sequences of nrITS and nrLSU regions, and morphological data support the description of this new species. A comparison with other closely related species confirmed that the newly described species is distinct from others.

Genetic inventory of rare and endemic plant species of the Baikal Region

Replenishment of databases with genetic information of various species is necessary to solve topical issues of their taxonomy and systematics. One way to obtain genetic data from herbarium vouchers is to determine the nucleotide sequences of individual nuclear and chloroplast regions, which are widely used for molecular identification and plant phylogeny. Rare and endemic plant species are often the least represented in the genetic databases. In this work, we studied endemic plant species: Astragalus angarensis, Hedysarum turczaninovii, Hedysarum zundukii, Oxytropis popoviana, Papaver popovii, Gueldenstaedtia verna, Tulipa uniflora, Eutrema cordifolium, Megadenia pygmaea, Mannagettaea hummelii which have different conservation status in the Irkutsk Region and in the Republic of Buryatia. For Papaver popovii and Astragalus angarensis, genetic data have been obtained for the first time; for other species, information on universal DNA barcodes has been supplemented. In addition, genetic differences between Mannagettaea from the Republic of Buryatia and the type species Mannagettaea hummelii Harry Sm. (China) were shown. More detailed study on Mannagettaea is necessary to clarify its species diversity. Thus, results obtained supplemented the genetic information of the vouchers of the species presented in the herbarium of the Siberian Institute of Plant Physiology and Biochemistry of the Siberian Branch of the Russian Academy of Sciences (SIPPB SB RAS). This DNA-barcoding expands application of the herbarium in integrative studies using genetic data and contributes to the further study of rare endemic species of the Baikal Region.

Phylogenetic characteristics and recombination analysis of echovirus 5 associated with severe acute respiratory infection in China.

Echovirus 5 (E5) belongs to the enterovirus B (EV-B) species, which is one of the pathogens causing respiratory diseases. Only two whole genome sequences (WGSs) of E5 are available in GenBank, and few studies on E5 have been reported worldwide. In this study, human rhabdomyosarcoma (RD) cells were used to isolate E5 from respiratory samples associated with severe acute respiratory infection (SARI). The nucleotide sequence of the VP1 region and the WGSs of two E5 strains were sequenced using Sanger sequencing and high-throughput sequencing technology, respectively. Together with 31 E5 VP1 sequences and 2 WGSs downloaded from GenBank, a total of 33 complete VP1 sequences and 4 WGSs were used for genetic characterization and evolutionary analysis. Phylogenetic analysis revealed five genotypes (A-E) based on complete VP1 sequences. Evolutionary analysis showed that the time to the most recent common ancestor of E5 was approximately 1952 (95% highest posterior density [HPD] range, 1948-1953]), with a mean substitution rate of 7.74 × 10-3 subs/site/year (95% HPD range, 6.44-9.11 × 10-3). In addition, the WGS analyses showed that the nucleotide and amino acid similarities of the coding regions of the two strains obtained in this study with the prototype of the E5 strain Noyce were 80.2% and 97.2%, respectively. Recombination analysis showed that the two E5 strains may have intraspecific recombination with E6, EV-B85, and CVA9 serotypes in the nonstructural region. This study reports the isolation of E5 from SARI cases for the first time, and genetic characterization and evolutionary analysis provide valuable information on global E5 molecular epidemiology.IMPORTANCEThis study is the first report of echovirus 5 (E5) associated with severe acute respiratory infection and obtained the first E5 whole-genome sequence in China. Combined with the sequences available in the GenBank database, the first genotyping, phylogenetic characteristics, recombination, and genetic evolutionary analysis of E5 was performed in this study. Our findings providing valuable information on global E5 molecular epidemiology.

A polyphasic approach leading to the discovery of new taxa of terrestrial cyanobacteria for the flora of Ukraine

Several morphotypes of filamentous cyanobacteria were found in the terrestrial habitats of the Kharkiv Region (biological soil crusts) and in the vicinity of Kyiv (old concrete wall in the forest). Morphological and molecular characterization of four original strains revealed that they belong to recently described genera Wilmottia Strunecký, Elster et Komárek, Pycnacronema M.D. Martins et Branco, Myxacorys Pietrasiak et J.R. Johansen and Tildeniella Mai, J.R. Johansen et Pietrasiak. All of them are new to the flora of Ukraine. Besides the analysis of p-distances, the nucleotide sequence of the 16S-23S ITS region and the secondary structures of its most informative helices, we used in our phylogenetic analyses sequences of the 16S rRNA gene. All Ukrainian strains joined the clades of the corresponding genera with a high degree of support in the Bayesian and Maximum Likelihood analyses. However, their species-level identification gave ambiguous results. Reliable result was obtained only for the strain of genus Wilmottia. It was identified as Wilmottia murrayi (W. et G.S.West) Strunecký, Elster et Komárek. This is the first morphologically and molecularly confirmed record of this species in Europe. Two strains were identified as Pycnacronema cf. caatingensis and Tildeniella cf. torsiva due to their deviations from these species both in morphology and the 16S–23S ITS secondary structures. In the 16S rRNA gene–based phylogenetic analysis, original strain of the genus Myxacorys took separate position among the known species of this genus and also had a number of morphological differences from them. Therefore, it might represent a new species, but this cannot be proven due to the lack of a 16S-23S ITS sequence of the original strain. Detailed description of morphology of the studied strains with tabular review of corresponding species are given.

Morphological characteristics and nucleotide sequence of ITS region and rbcL gene of Cu cang native taro

Cu cang taro cultivar in Thuan Chau district, Son La province is a precious indigenous genetic resource with high quality and well adapted to the characteristic natural conditions of Thuan Chau district, Son La province of Vietnam. However, Cu cang taro has been mixed with different cultivars in the locality. In this article, the authors presented morphological characteristics and nucleotide sequence of ITS(Internal Transcribed Spacer) region and rbcL gene of Cu cang taro in Thuan Chau district, Son La province. The ITS region and rbcL sequences isolated from Cu cang taro had sizes 506 and 630 bp. The results of similarity comparison on NCBI identified the DNA isolated from the ITS region, the rbcL gene of Cu cang taro is Colocasia esculenta species. The rbcL gene of Cu cang taro has 99.27% similarity with Colocasia esculenta var. antiquorum.

Serum components influence antibody reactivity to glycan and DNA antigens

We previously generated three types of anti-glycan monoclonal IgM antibodies that react with certain structures on the glycans of glycosphingolipids and glycoproteins. As the nucleotide sequences for the variable regions of these IgM antibodies showed homology with those of anti-DNA antibodies deposited in public databases, we analyzed the reactivity of the anti-glycan IgM antibodies to DNA by ELISA. We found that anti-α2,6-sialyl LacNAc IgM in the supernatant of a hybridoma culture cross-reacted with DNA, and after purification of the IgM by zirconia column chromatography, the highly purified IgM showed increased cross-reactivity to DNA. As most of the contaminating bovine serum proteins in the culture supernatant were removed by the purification process, it is likely that a part of the removed components influences antibody reactivity to DNA. Purified anti-DNA antibodies prepared from lupus model NZB/W F1 and MRL/lpr mouse sera and normal human serum were then analyzed, and similar results showing increased reactivity to DNA were obtained. Furthermore, ELISA using these purified antibodies and various carbohydrate antigens showed that the antigen-binding specificity of these antibodies was altered by the purification process from serum-containing antibody preparations. Our results indicate that mammalian serum contains components that strongly influence antibody reactivity to carbohydrate antigens, including DNA.

Molecular Diversity of Human Respiratory Syncytial Virus before and during the COVID-19 Pandemic in Two Neighboring Japanese Cities.

Human respiratory syncytial viruses (HRSVs) are divided into subgroups A and B, which are further divided based on the nucleotide sequence of the second hypervariable region (HVR) of the attachment glycoprotein (G) gene. Understanding the molecular diversity of HRSV before and during the coronavirus disease 2019 (COVID-19) pandemic can provide insights into the effects of the pandemic on HRSV dissemination and guide vaccine development. Here, we analyzed HRSVs isolated in Fukushima Prefecture from September 2017 to December 2021. Specimens from pediatric patients were collected at two medical institutions in neighboring cities. A phylogenetic tree based on the second HVR nucleotide sequences was constructed using the Bayesian Markov chain Monte Carlo method. HRSV-A (ON1 genotype) and HRSV-B (BA9 genotype) were detected in 183 and 108 specimens, respectively. There were differences in the number of HRSV strains within clusters prevalent at the same time between the two hospitals. The genetic characteristics of HRSVs in 2021 after the COVID-19 outbreak were similar to those in 2019. HRSVs within a cluster may circulate within a region for several years, causing an epidemic cycle. Our findings add to the existing knowledge of the molecular epidemiology of HRSV in Japan. IMPORTANCE Understanding the molecular diversity of human respiratory syncytial viruses during pandemics caused by different viruses can provide insights that can guide public health decisions and vaccine development.

Analysis of <i>BMP2</i> gene polymorphism of bone morphogenetic protein-2 in reindeer

The BMP2 gene of reindeer was study by Sanger sequencing. The BMP2 gene is involved in the formation of bone tissue and skeletal muscle in mammals. The BMP2 gene is associated with an increase in height, size, and body weight in productive animals. For the first time, the nucleotidesequence of the coding and regulatory regions of the BMP2 gene was determined in populations of wild and domestic reindeer.As a result, a segment of the reindeer BMP2 candidate gene was sequence, including the first untranslated and second exons. Loci with low (exon1) and high (exon2) degree of polymorphism identified.Single nucleotide mismatches with the reference genome (white-tailed deer (Odocoileus virginianus texanus) genome) identified, which can be used for phylogenetic analysis of the evolution of orthologue genes, as well as for genetic identification of species. Twelve polymorphic loci of two types were identified: in/del and SNP. The most significant substitutions were also determined in accordance with the change in the amino acid composition of the protein and the chemical properties of the replaced amino acids. Calculations were made of the occurrence of genotypes and alleles according to the identified variants of genetic polymorphism in the analyzed populations of reindeer (Nenets and Evenk breeds, wild reindeer).The object of research was wild and domestic reindeer on the farms of the Taimyr Peninsula and Evenkia. The material for the study was DNA isolated by the classical phenol method from the blood of domestic reindeer of two breeds - Nenets (n=20) and Evenki (n=20), as well as from tissue samples of wild reindeer (n=20).The aim of the study was to search for and select potential variants of genetic polymorphism in the BMP2 gene as molecular genetic markers that can be recommend for use in the practice of reindeer breeding to increase meat productivity.For the first time, the nucleotide sequence of significant regions of the reindeer BMP2 gene was determined. The polymorphic loci in the BMP2 gene identified as a result of the studies had differences in the frequency of occurrence of alleles of mutant and wild types in the studied samples of domestic reindeer of the Nenets and Evenk breeds, as well as in the sample of wild reindeer. Differences in occurrence indicate the effect of selection factors on the region of the BMP2 gene. The revealed genetic variability of the studied region in reindeer breeds contrasting in productivity is a preliminary confirmation of the influence of genetic polymorphism in the BMP2 gene on the variability of phenotypes in terms of height and weight indicators. Indicators of growth and live weight are key to the formation of the meat productivity of reindeer. The results of studies of the effect of BMP2 gene polymorphism on growth and weight parameters in other animal species suggest that some of the identified variants of genetic polymorphism in the studied region of the BMP2 gene may turn out to be casual mutations that can affect the formation of quantitative traits in domestic reindeer.

Criticism and bibliography: Zmitrovich I. V., Perelygin V. V., Zharikov M. V. Nomenclature and rank correlation of higher taxa of eukaryotes. Мoscow: INFRA-M, 2022. 183 p. ISBN 978-5-16-018531-6. (Book series “Folia Cryptogamica Petropolitana”. № 8)

The monograph titled "Nomenclature and Rank Correlation of Eukaryotic Higher Taxa," written by I.V. Zmitrovich, V.V. Perelygin, and M.V. Zharikov, has a unique feature - it is addressed to both theoretical biologists dealing with problems of systematics and practitioners who develop issues of industrial microbiology, bioengineering, and biomedicine. It unites these areas of biology through systematics, which, as academician A.L. Takhtajan said, is the basis and pinnacle of biology.
 Modern progress in molecular biology allows for the precise determination of the relationship between organisms based on the diagnostic nucleotide sequences of important genome regions, leading to important discoveries. For example, Pneumocystis carinii, which was long considered a protozoan and classified as a sporozoan, turned out to be a fungus related to some yeast groups. This information was demanded by pharmacologists who know which antibiotics are effective against fungal infections. However, an excessive flow of scientific information can hinder the systematization and classification according to the existing paradigm of information hysteresis. Changes in systematics happen so quickly that Internet classifiers cannot keep up with them. In addition, there are many competing versions of classification, which makes it difficult to find the optimal solution for a user who does not follow the latest developments in systematics. This can be time-consuming and resource-intensive, making the classification process more complicated.
 The authors of this monograph aim to systematize all new data expressed in recent years in the field of eukaryotic classification, to determine the consensus of experts' opinions, and to identify those moments on which consensus has not been reached. This mainly concerns the taxonomic rank of groups, which reflects the degree of their differences. To determine the rank of large groups, it is necessary to carefully consider the topology of the enormous eukaryotic tree from different perspectives. Each research group working in different areas of this tree research takes into account its overall topology, but the amount of information is so large that there is not always enough time for a complete and detailed review. However, the authors of this monograph conducted such a review, conveying to the reader the rank structure of the system of eukaryotes, the development of which is based on modern phylogenetic classification.
 It is important to note that the next stage of the authors' work on systematics will be further research on the development of algorithms for managing microbial communities in different environmental conditions with different sets of limiting factors to implement the useful properties of microorganisms with different secretory activity. The book contains an extensive auxiliary apparatus, including interesting notes discussing various issues such as the priority of domestic researchers in discovering the antibiotic activity of Penicillium, the "Florida hypothesis" of the origin of fungi, and a detailed presentation of the group of fungus-like protists oomycetes.

Metrological support of sequence analysis of nucleic acids

Metrological support for the process of molecular genetic identification is provided. An establishment of a nucleotide sequence is the general aim in nucleic acids analysis. A nucleotide sequence of DNA/RNA is the key information which gives an idea of the role and functioning of nucleic acids in living systems, as well as it allows establishing the origin of biological objects during molecular genetic identification. The molecular genetic identification is based on modern methods of research in the sequencing of DNA, which is inherited from generation to next generation of living organisms. DNA sequence comparison in some cases is mandatory to establish the authenticity of biological objects and to determine biological affiliation or kinship with other biological objects. The problems of metrological support of molecular genetic identification by Sanger DNA sequencing using fluorescently labeled reaction terminators and the use of capillary electrophoresis on the example of fish identification are considered. Metrological support of the process includes the use of such definitions as a nucleotide (the nucleic acid monomer), a sequence of nucleotides of nucleic acids. Also, it involves the procedures used in certified methods, a standard sample of a known DNA sequence of an approved type, and a genetic analyzer.Standard Reference Materials of a fragment of human mitochondrial DNA was developed, approved, entered into the Federal registry. The tests of the domestic genetic analyzer Nanophore 05 were carried out. Two measurement procedures “The measurement methodology the partial nucleotide sequence of the control region of mitochondrial DNA of fish (families Acipenseridae and Polyodontidae) by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” and “The measurement methodology the nucleotide sequence of the 5’ region of the mitochondrial COI gene of water biological resources by Sanger sequencing with fluorescently-labeled terminators and using capillary electrophoresis” were tested and certified. The results are relevant to research in biological sciences, the food industry, biotechnology, and DNA forensics.

Mitochondrial DNA Polymorphism in HV1 and HV2 Regions and 12S rDNA in Perimenopausal Hypertensive Women.

Estrogens enhance cellular mitochondrial activity. The diminution of female hormones during menopause may have an effect on the mitochondrial genome and the expression of mitochondrial proteins. Hence, oxidative stress and the pro-inflammatory state contribute to the formation of systemic illnesses including arterial hypertension (AH). This study aimed to determine the types and frequency of mutations in the mitochondrial DNA (mtDNA) nucleotide sequence in the hypervariable regions 1 and 2 (HV1 and HV2) and the 12S RNA coding sequence of the D-loop in postmenopausal women with hypertension. In our study, 100 women were investigated, 53 of whom were postmenopausal and 47 of whom were premenopausal (53.9 ± 3.7 years vs. 47.7 ± 4.2 years, respectively). Of those studied, 35 premenopausal and 40 postmenopausal women were diagnosed with AH. A medical checkup with 24 h monitoring of blood pressure (RR) and heart rate was undertaken (HR). The polymorphism of the D-loop and 12S rDNA region of mtDNA was examined. Changes in the nucleotide sequence of mtDNA were observed in 23% of the group of 100 women. The changes were identified in 91.3% of HV1 and HV2 regions, 60.9% of HV1 segments, 47.5% of HV2 regions, and 43.5% of 12S rDNA regions. The frequency of nucleotide sequence alterations in mtDNA was substantially higher in postmenopausal women (34%) than in premenopausal women (10.6%), p = 0.016. A higher frequency of changes in HV1 + HV2 sections in postmenopausal women (30.2%) compared to the premenopausal group (10.6%) was detected, p = 0.011. Only postmenopausal women were found to have modifications to the HV2 segment and the 12S rDNA region. After menopause, polymorphism in the mtDNA region was substantially more frequent in women with arterial hypertension than before menopause (p = 0.030; 37.5% vs. 11.5%). Comparable findings were observed in the HV2 and HV1 regions of the AH group (35% vs. 11.5%), p = 0.015, in the HV1 segment (25% vs. 11.5%), p = 0.529, and in the HV2 segment, 12S rDNA (25% vs. 0%). More than 80% of all changes in nucleotide sequence were homoplasmic. The mtDNA polymorphisms of the nucleotide sequence in the HV1 and HV2 regions, the HV2 region alone, and the 12S RNA coding sequence were associated with estrogen deficiency and a more severe course of arterial hypertension, accompanied by symptoms of adrenergic stimulation.

Identification and Pathogenicity of the Soybean Root Rot Pathogen in Arid Conditions

Soy is an important oilseed crop in Kazakhstan. However, its yield is significantly reduced due to an increase in the development of fungal diseases with soil infection. This study aims to identify the root rot pathogen in soybean varieties in Western Kazakhstan and assess its pathogenicity. Samples of soybean roots to determine the root rot pathogen were selected at the experimental plots of the Aktobe agricultural experimental station in 2021. Genetic analysis of isolates observed on potato dextrose agar medium from soybean root slices was carried out using the sequencing reaction of internal transcribed spacer region nucleotide sequences using the Big Dye Terminator protocol (applied biosystems) with a further comparison of data with the Gen bank database. A test for the pathogenicity of the identified isolates of the fungus was carried out. Statistical data processing was carried out using the R-studio software according to the nonparametric Kruskal Wallis test. Phylogenetic analysis of samples of soybean affected by root rot showed that the main biotic agent causing root rot was the imperfect fungus Fusarium equiseti. Sequencing of the highly informative internal transcribed spacer region of fungal isolates allowed identifying strains 1 and 2 belonging to the species Fusarium equiseti. The pathogenicity test established that isolates of the Fusarium equiseti fungus caused discoloration of seedlings and plant roots and necrosis in soybean seedlings.

Molecular Epidemiology Reveals the Co-Circulation of Two Genotypes of Coxsackievirus B5 in China.

Coxsackievirus B5 (CVB5) is an important enterovirus B species (EV-Bs) type. We used the full-length genomic sequences of 53 viral sequences from the national hand, foot, and mouth disease surveillance network in the Chinese mainland (2001-2021). Among them, 69 entire VP1 coding region nucleotide sequences were used for CVB5 genotyping and genetic evolution analysis. Phylogenetic analysis based on a data set of 448 complete VP1 sequences showed that CVB5 could be divided into four genotypes (A-D) worldwide. Sequences from this study belonged to genotypes B and D, which dominated transmission in the Chinese mainland. Two transmission lineages of CVB5 have been discovered in the Chinese mainland, lineage 2 was predominant. Markov chain Monte Carlo analysis indicated that the tMRCA of CVB5 in the Chinese mainland could be traced to 1955, while the global trend could be traced to 1862, 93 years earlier than China. The evolution rate of CVB5 was higher in the Chinese mainland than worldwide. The spatiotemporal dynamics analysis of CVB5 assessed that virus transportation events were relatively active in Central, Northeast, North and Northwest China. Recombination analysis revealed frequent intertypic recombination in the non-structural region of CVB5 genotypes B and D with the other EV-Bs, revealing eight recombination lineages. Our study showed the molecular evolution and phylogeography of CVB5 that could provide valuable information for disease prevention.

Outbreak of Parasitic Dinoflagellate Piscinoodinium sp. Infection in an Endangered Fish from India: Arulius Barb (Dawkinsia arulius).

Freshwater velvet disease is caused by the dinoflagellate parasite, Piscinoodinium sp. This parasite has been reported in tropical and subtropical fishes, and it can cause devastating losses. Moreover, Piscinoodinium sp. is identified as one of the least studied finfish parasites, and the available molecular information about this parasite is meager. Recently, Piscinoodinium sp. was responsible for the 100% cumulative mortality of the captive-bred F1 generation of Arulius barb (Dawkinsia arulius), an endangered freshwater fish native to India. The trophont stages of the parasite were observed in the skin and gills of the affected fish. The total DNA was extracted from the trophonts collected from the affected Arulius barb and the partial nucleotide sequence of the rDNA complex region (2334 bp) was amplified using PCR. The amplified PCR product exhibited a high sequence identity (97.61%) with Piscinoodinium sp. In the phylogenetic analysis of the SSU rDNA, Piscinoodinium sp. emerged as a separate clade from other dinoflagellate species. This is the first report of the infection of Piscinoodinium sp. in Arulius barb and the molecular information generated from this study can serve as a baseline to study the diversity of the parasite in India. Furthermore, the impact of this parasite among wild fish stock is not known, and this parasite needs further research focus to generate more molecular information and to understand the host-pathogen interaction.

40P The detection and quantification of different sequence-variable NPM1 mutations using RNase H-dependent PCR (rhPCR)

Molecular diagnostics for the detection and characterization of genetic variants is based in the majority of cases on PCR technology. Since the primers and probes are designed according to the nucleotide sequence of the DNA region for the specific mutation, PCR technology can only be applied if the mutation is well known. In cases where the mutated region of a gene may have variable sequences, different between patients, a set of primers for each sequence variant is necessary, which involves a large volume of work.

Molecular Detection and Characterization of Trypanosomes Infecting Traditionally Managed Cattle in the Tropic Warm Sub-Humid Zone of Nigeria

Abstract Traditionally managed cattle constitutes the main source of animal protein to humans in Nigeria. However, seasonal migration in search of pasture exposes them to several vector-borne infections such as the African Animal Trypanosomosis (AAT), which limits their productivity. In this study, blood samples from 130 cattle in Plateau and Nasarawa states collected from May to June, 2021 were examined by the Polymerase Chain Reaction (PCR) and sequencing methods to determine the prevalence of pathogenic trypanosomes. Overall, the DNA of T. vivax was detected in 19 out of the 130 (14.6 %) samples examined by the PCR. However, using the micro-hematocrit centrifugation technique, motile haemoparasites were detected in only six (4.6 %, confidence interval [CI] 0.5—6.9 %) of the samples. The higher prevalence of T. vivax was recorded in samples sourced from the abattoir than in samples submitted from the field in Plateau state (16.7 % versus 11.5 %). However, the reverse was the case in Nasarawa state (2.9 % versus 37.5 %). The difference in prevalence of T. vivax between the abattoir and field samples was significant (P = 0.009) in Nasarawa state, but not in Plateau state (P = 0.55). The mean PCV (Packed Cell Volume) of the trypanosome infected animals was lower than that of the non-infected animals, but the difference was not significant (P = 0.29). The internal transcribe spacer region (ITS) nucleotide sequences of T. vivax generated in this study were 100 % identical to each other and formed a monophyletic cluster with the sequences of T. vivax from different countries in the GenBank. AAT remains a major constraint to profitable cattle production and food security in Nigeria and deserves more attention.

Mechanisms of action of cytoplasmic microRNAs. Part 1. Mechanisms of interaction of microRNA and mRNA molecules. Influence of microRNAs on translation

The scientific review presents the mechanisms of action of cytoplasmic miRNAs, namely the relationship between miRNA and mRNA molecules and the influence of miRNAs on translation. To write the article, information was searched using Scopus, Web of Science, MEDLINE, PubMed, Google Scholar, Embase, Global Health, The Cochrane Library, CyberLeninka databases. The authors state that the interaction of microRNA and mRNA requires the presence in the region of the 3'-end of the mRNA molecule of small nucleotide sequences — miRNA regulatory elements, which are complementary to the sequences of the “seed” region of microRNA. It is known that only six nucleotide matches in the “seed” region (position 2–8) are required to initiate the interaction of microRNA with the mRNA target. It is emphasized that the interaction of miRNA with mRNA depends on the availability of the mRNA binding site. The authors suggest that accessory proteins are involved in the interaction of microRNA and mRNA. It is known that the process of mRNA and miRNA hybridization depends on the presence of SNP. Scientists believe that the main function of cytoplasmic miRNAs is to regulate the activity of protein synthesis. It is presented that microRNAs can repress and activate the mRNA translation process. In addition, some miRNAs are able to both inhibit and enhance the translation of mRNA depending on specific local conditions and the spectrum of microenvironmental factors. Thus, the mechanism of action of cytoplasmic miRNAs is realized due to the interaction of miRNAs and mRNAs, which is due to the presence of complementary nucleotide sequences of special regions. The interaction of miRNAs with mRNAs depends on the availability of the mRNA binding site, the involvement of accessory proteins, and the presence of SNP. Violations of microRNA-mRNA interactions lead to the development of pathological processes. Cytoplasmic miRNAs perform their main function, namely the regulation of protein synthesis activity, due to miRNA-mediated repression and activation of mRNA translation.