Nuclease-free Water Research Articles

Development and validation of a novel SYBR Green real-time RT-PCR assay for the detection of classical swine fever virus evaluated on different real-time PCR platforms

Classical swine fever is a highly contagious viral disease that causes significant economic losses in pig production on a global scale. The rapid dissemination of the virus and the variability of the clinical signs merit the development of swift and accurate classical swine fever virus (CSFV) detection methods, which can assist in disease control. The development and evaluation of a novel quantitative real-time RT-PCR assay for CSFV detection, based on SYBR Green coupled to melting curve analysis, is described. The analytical and diagnostic performances of the method using two real-time PCR instruments were compared. The assay was specific and detected the major genotypes of CSFV. The limit of detection in cell culture medium and serum was 0.1 TCID50/reaction, while in tissue homogenate for both platforms, it was 1 TCID50/reaction. The limit of detection was 1, 10 and 102 gene copies/μL when nuclease-free water, serum and tissue homogenate, respectively, were used as sample matrices for both instruments. The analysis of 108 tissue homogenate and serum samples from animals infected with CSFV naturally and experimentally and non-infected animals showed that the assay provided a highly sensitive and specific method for classical swine fever.

HDL3, but not HDL2, stimulates plasminogen activator inhibitor-1 release from adipocytes: the role of sphingosine-1-phosphate

Sphingosine-1-phosphate (S1P) is a bioactive lysophospholipid that regulates numerous key cardiovascular functions. High-density lipoproteins (HDLs) are the major plasma lipoprotein carriers of S1P. Fibrinolysis is a physiological process that allows fibrin clot dissolution, and decreased fibrinolytic capacity may result from increased circulating levels of plasminogen activator inhibitor-1 (PAI-1). We examined the effect of S1P associated with HDL subfractions on PAI-1 secretion from 3T3 adipocytes. S1P concentration in HDL3 averaged twice that in HDL2. Incubation of adipocytes with increasing concentrations of S1P in HDL3, but not HDL2, or with S1P complexed to albumin stimulated PAI-I secretion in a concentration-dependent manner. Quantitative RT-PCR revealed that S1P(1-3) are expressed in 3T3 adipocytes, with S1P(2) expressed in the greatest amount. Treatment of adipocytes with the S1P(1) and S1P(3) antagonist VPC23019 did not block PAI-1 secretion. Inhibiting S1P(2) with JTE-013 or reducing the expression of the gene coding for S1P(2) using silencing RNA (siRNA) technology blocked PAI-1 secretion, suggesting that the S1P(2) receptor mediates PAI-1 secretion from adipocytes exposed to HDL3 or S1P. Treatment with the phospholipase C (PLC) inhibitor U73122, the protein kinase C (PKC) inhibitor RO-318425, or the Rho-associated protein kinase (ROCK) inhibitor Y27632 all significantly inhibited HDL3- and S1P-mediated PAI-1 release, suggesting that HDL3- and/or S1P-stimulated PAI-1 secretion from 3T3 cells is mediated by activation of multiple, downstream signaling pathways of S1P(2).

Fragrant Dioxane Derivatives Identify β1-Subunit-containing GABAA Receptors

Nineteen GABA(A) receptor (GABA(A)R) subunits are known in mammals with only a restricted number of functionally identified native combinations. The physiological role of beta1-subunit-containing GABA(A)Rs is unknown. Here we report the discovery of a new structural class of GABA(A)R positive modulators with unique beta1-subunit selectivity: fragrant dioxane derivatives (FDD). At heterologously expressed alpha1betaxgamma2L (x-for 1,2,3) GABA(A)R FDD were 6 times more potent at beta1- versus beta2- and beta3-containing receptors. Serine at position 265 was essential for the high sensitivity of the beta1-subunit to FDD and the beta1N286W mutation nearly abolished modulation; vice versa the mutation beta3N265S shifted FDD sensitivity toward the beta1-type. In posterior hypothalamic neurons controlling wakefulness GABA-mediated whole-cell responses and GABAergic synaptic currents were highly sensitive to FDD, in contrast to beta1-negative cerebellar Purkinje neurons. Immunostaining for the beta1-subunit and the potency of FDD to modulate GABA responses in cultured hypothalamic neurons was drastically diminished by beta1-siRNA treatment. In conclusion, with the help of FDDs we reveal a functional expression of beta1-containing GABA(A)Rs in the hypothalamus, offering a new tool for studies on the functional diversity of native GABA(A)Rs.

Rapid identification of blaKPC-possessing Enterobacteriaceae by PCR/electrospray ionization-mass spectrometry

Rapid identification of blaKPC-possessing Enterobacteriaceae by PCR/electrospray ionization-mass spectrometry

Customized impedance spectroscopy device as possible sensor platform for biosensor applications

AbstractA new impedance spectroscopy unit is developed, fully customized to become a vital part of label free biosensor arrays with possible applications in DNA and protein sensing. Test measurements are conducted to explore the accuracy and specificity of the system, both under electronic lab conditions as well as under wet cell conditions with synthetic‐diamond based sensor electrodes. The impedance of seven resistors was monitored for 17 h and a maximum error <0.02% was found. Furthermore, the impedance of PBS at different concentrations was monitored for 60 min per concentration and a different impedance for each concentration was detected. The impedance is also monitored for NaOH, PBS and nuclease free water at different temperatures with a total duration of 60 min per fluid. Systematically different impedances for each temperature per fluid were found and the temperature coefficients were determined. All test measurements lead to results well within specification.

Nuclear Factor κB- and Specificity Protein 1-dependent p53-mediated Bi-directional Regulation of the Human Manganese Superoxide Dismutase Gene

Tumor suppressor p53 is known to activate certain sets of genes while suppressing others. However, whether p53 can both activate and suppress the same gene is unclear. To address this question, concentration-dependent p53 effect on the manganese superoxide dismutase (MnSOD) gene was investigated. By transfecting p53 in PC-3 cells, we demonstrate that low concentrations of p53 increase while high concentrations suppress MnSOD expression. The physiological relevance of this effect was determined in vitro and in vivo using combined UVB-mediated activation and small interference RNA-mediated suppression of p53. Results were consistent with the bi-directional effect of p53 on MnSOD expression. MnSOD-promoter/enhancer analysis demonstrates that p53 is suppressive to the promoter activity regardless of the presence or absence of putative p53 binding sites. However, a low level of p53 increases MnSOD gene transcription in the presence of the intronic-enhancer element, and this effect is dependent on nuclear-factor kappaB (NF-kappaB) binding sites. Expression of p53 enhances nuclear levels of p65 with corresponding increase in the DNA-binding activity of NF-kappaB as detected by electrophoretic mobility shift and chromatin immunoprecipitation assays. Transfection of p65 small interference RNA reduces the positive effect of p53 on MnSOD gene transcription. These data suggest that p65 can overcome the negative effect of p53 on MnSOD expression. However, when the level of p53 was further increased, the suppressive effect of p53 outweighed the positive effect of p65 and led to the suppression of MnSOD gene transcription. These results demonstrated that p53 can both suppress and induce MnSOD expression depending on the balance of promoter and enhancer binding transcription factors.

First Report of Xylella fastidiosa Associated with Oleander Leaf Scorch in Louisiana.

Oleander (Nerium oleander L.) is an evergreen shrub native to the Mediterranean Region and Southeast Asia. Despite being poisonous, it is a popular ornamental plant for use in landscapes, gardens, parks, roadsides, and highway medians. During the fall of 2008, several oleander plants with leaf scorch symptoms were observed at Arsenal Park in Baton Rouge, LA. Symptomatic oleander samples were also received from a commercial nursery in Baton Rouge, LA and a homeowner in Thibodeaux, LA. Symptoms resembled leaf scorch caused by Xylella fastidiosa Wells et al. and included chlorotic mottling of the leaves that started from the tips and margins and progressed toward the midribs. As disease developed, leaf tips and margins became necrotic. Severely infected plants defoliated and died. Leaf petioles from 13 samples (8 from Arsenal Park, 3 from the commercial nursery, and 2 from the homeowner) from symptomatic plants gave positive reactions for X. fastidiosa by ELISA (Agdia, Inc., Elkhart, IN). Leaf petioles from six healthy oleander plants gave a negative reaction for X. fastidiosa by ELISA. Isolation of X. fastidiosa was attempted from eight ELISA-positive and six ELISA-negative oleander samples. Leaf petioles weighing 0.05 g from each sample were used for isolation. The petioles were surface sterilized in 70% ethanol for 1.5 min and then in 2% sodium hypochlorite for 1.5 min, followed by three 1-min washes in sterile water. The petioles were chopped into small pieces under aseptic conditions and soaked in 500 μl sterile water for 30 min. One hundred microliters of the suspension were spread onto periwinkle wilt (PW) plates and incubated in the dark at 28°C. After incubation for 7 days, bacterial colonies typical of X. fastidiosa appeared on five of eight ELISA-positive sample plates. No colonies were observed on six ELISA-negative sample plates. Single colonies were transferred to fresh PW plates to obtain pure cultures. Bacterial colonies from five pure cultures were suspended in nuclease-free water and boiled for 10 min to obtain DNA. DNA from eight symptomatic and six healthy oleander plants was extracted with a DNeasy Plant Mini kit (Qiagen Inc., Valencia, CA) according to the manufacturer's guidelines. Primers (QHOLS-08 and QHOLS-05) (1) specific to the oleander strain of X. fastidiosa amplified a 274-bp portion of DNA from both symptomatic oleander tissues and pure culture of X. fastidiosa isolated from symptomatic tissue. No such amplification was observed in healthy tissue. These primers amplify a portion of DNA encoding a hypothetical protein of unknown function that has been shown to be unique to oleander strains of X. fastidiosa. The PCR product was sequenced and compared with the whole genome shotgun sequence of the oleander strain Ann-1 of X. fastidiosa (GenBank Accession No. AAAM03000099), which resulted in 100% identity with nucleotides 11343 to 11616 in contig 228. X. fastidiosa has been previously reported to cause oleander leaf scorch in California (3), Florida (4), and Texas (2). To our knowledge, this is the first report of X. fastidiosa associated with oleander leaf scorch in Louisiana, extending the geographic range of this important bacterial disease.

Different Genotypic Sapoviruses Detected in Two Simultaneous Outbreaks of Gastroenteritis among Schoolchildren in the Same School District in Hokkaido, Japan

Norovirus (NV) and sapovirus (SV) are members of the family Caliciviridae and are etiologic agents for acute gastroenteritis in humans (1,2). Presently, NV is the more causative of the two for the outbreak of gastroenteritis, whereas only a few outbreaks of SV have been reported. Acute gastroenteritis due to SV occurs mainly in infants and young children (2). Previously, we reported on outbreaks of SV-associated gastroenteritis in Hokkaido, Japan (3). Here, we describe two outbreaks that occurred almost simultaneously among schoolchildren in the same district in Hokkaido. The SV genomes were detected and differentiated into a genogroup I genotype 2 (GI/2) and a GI/3. The first outbreak (Outbreak 1) occurred at an elementary school between March 8 and 23 in 2009. A total of 48 schoolchildren developed gastroenteric symptoms such as vomiting and diarrhea. The second outbreak (Outbreak 2) occurred at a junior high school between March 11 and 23 in 2009. Finally, a total of 74 students suffered from gastroenteritis. These two outbreaks occurred in the same school district. Nine stool specimens from Outbreak 1 were collected from 1 to 13 days of illness, while 11 stool specimens from Outbreak 2 were collected from 1 to 8 days of illness. The epidemic curves of these two outbreaks are shown in Figs. 1 and 2. Each stool specimen was prepared as 10% emulsions with nuclease-free distilled water (Nippon Gene Co., Tokyo, Japan) and was centrifuged at 3,000 rpm for 20 min at 4°C. The supernatant was collected and transferred to microtubes, followed by centrifugation at 10,000 rpm for 10 min at 4°C. Extraction of viral RNA and reverse transcription (RT) were carried out as described previously (4). The cDNA was used for the polymerase chain reaction (PCR) and real-time PCR. Two sets of primers, P1/P3 and NV82/SM82/NV81, and another two sets of primers, COG1F/G1SKR and COG2F/ G2SKR, were used to amplify the polymerase and the capsid protein regions of the NV genome, respectively (5–8). To amplify the polymerase and capsid protein regions of the SV genome, the sets of primers SV-r-c/sapp36 and SV-F13/SVF14/SV-R13/SV-R14 were used. The conditions of PCR amplification were performed as described previously (4,9, 10). The PCR products were purified and directly sequenced using the Big Dye terminator cycle sequencing kit (Applied Biosystems, Foster City, Calif., USA). Nucleotide sequences determined in this study have been submitted to Genbank/ EMBL/DDBJ (accession no. AB518056 and AB518057). Multiple alignment and phylogenetic analyses were carried out based on partial capsid nucleotide sequences (approxiFig. 1. Number of patients and virus detection for norovirus (NV) and/ or sapovirus (SV) of gastroenteritis in Outbreak 1 from March 8 to 23, 2009. Specimens which were positive for NV and/or SV genomes were indicated. Two specimens which were collected in March 13 or 16 were positive for both NV and SV genomes.

Regulation of odontogenic gene expression in dental stem cells

Introduction Barx1, Msx1,Pax9, Lhx8 and Runx2 are genes expressed in mesenchymal cells during the odontogenesis. Our investigation aimed to study the expression of these genes in different adult dental mesenchymal stem cells. SHED(Stem Cells from Human Exfoliated Deciduous teeth), SCAP(Stem Cells fro m Tooth Apical Papilla),DPA (Adult Pulp Stem Cells) and HTM (Human Embryonic Dental Mesenchymal Cells) were used. Regulation of gene expression in these cells by FGF and Wnt signalling pathways together with the effects of tooth matrix proteins was investigated. Materials and Methods Cells were grown in 6 well plates in 3 ml MSCGM medium (Lonza) containing Glutamax, 10% FBS and gentamicin Sulfate. Cells were grown to confluence and with 80% confluent, they were treated for 24 hours with either 20 ng per ml of BIO (Gsk3 inhibitor), 1.5μl per ml of porcine dental matrix proteins (EMD), 0.4μl per ml of Fgf8 and 4μl per ml of DMSO (control). RNA was extracted and purified according the RNeasy-kit-protocol from Qiagen. RNA quantitation was done using a Bio Photometer (Eppendorf) in 2:100 dilutions of the samples with nuclease-free water. Quantitative analysis was performed using Rotor Gene Q-serier softhware. 10μl of mixture was made with 5μl of Sensimixsyber green from Quantace, 0.2μl Fprimer, 0.2μl R-primer and 4.6μl of cDNA. Results QPCR for PEA3 and AXIN2 confirmed induction of FGF and canonical WNT signaling respectively. Complex patterns of changes in the levels of gene expression were observed that were both cell and treatment specific. One striking result was the induction of PAX9 expression in SHED cells following addition of EMD. Conclusions Data obtained can help to understand and imitate the natural process of embryonic tooth development using adult dental cells. For this reason we believe that the induction of Pax expression after EMD treatment of SHED cells warrants further investigation.

Improvement of RNA purification from infected tissues to explore the in vivo host–pathogen interactions with microarrays

Rickettsiae are Gram-negative alpha proteobacteria and arthropod-borne disease agents of spotted fevers and typhus [1]. Because of their obligate intracellular lifestyle, the molecular mechanisms involved in their pathogenicity are still poorly understood. To circumvent the difficulties in working with these bacteria, rickettsial genomes have been sequenced, thus allowing further postgenomic studies. DNA microarrays can be considered as powerful tools to understand the host–pathogen interactions in the course of infectious diseases. Exploring the RNA profiles of both host and pathogen promises to improve our knowledge of the infectious process, thus favouring the development of preventive or therapeutic strategies [2]. While published studies mainly focused on the eukaryotic response, the complementary picture, i.e. the bacterial response, was poorly analysed because of several technical limitations [3]. The transcriptomic analysis of R. conorii was recently performed by microarrays [4]. This bacterium is responsible for Mediterranean spotted fever (MSF), a disease characterised by a skin lesion called eschar caused by the bite of its vector, the brown dog tick, Rhipicephalus sanguineus [5]. The aim of this work was to analyse the transcriptome pattern of rickettsiae within such eschars using the same strategy based on the removal of eukaryotic contaminants coupled with subsequent random amplification of cDNA. Our goal was also to recover eukaryotic RNA from the same sample, thus considering both sides of the host–pathogen interaction. Preliminary assays were performed using rabbit eschars generated by the sub-cutaneous inoculation of purified bacteria (not shown). Human eschars were collected by sterile scalpel excision from patients suffering from MSF and immediately placed at 4 C overnight in 1 mL of RNA Later (Qiagen, Valencia, California, USA) before storage at )80 C. The biopsies were rapidly decontaminated by a 5-min incubation in iodated alcohol and 1 min washing in nuclease free water. The tissues excised in small pieces were mechanically lysed with tungsten beads and using the Mixer Mill MM3 (Qiagen), before enzymatic digestion with proteinase K. The total RNA was extracted from resulting lysates using the RNeasy Micro kit (Qiagen). Eukaryotic RNA was removed from the total RNA sample using the MicroEnrich Kit (Ambion, Austin, Texas, USA) as described [4]. To recover the eukaryotic RNA from the same sample, the beads were then mixed in TE buffer pH 8 and heated for 1 min at 95 C. The supernatants were collected and precipitated with alcohol. The bacterial RNA was retro-transcribed using random primers and amplified with the Genomiphi kit (GE Healthcare, Piscataway, New Jersey, USA), while human RNA was amplified using poly d(T) primers with T7 polymerase (Agilent, Santa Clara, California, USA). To check for the quality of amplification, PCR were performed on cDNA using primers targeting the rrs gene from R. conorii (FGGCTCAGAACGAACGCTATC ⁄R-GTTAGCTGCGAAACCGAAAG) and the eukaryotic actin gene (F-GGACTTCGAGCAAGAGATGG ⁄R-AGCACTGTGTTGGCGTACAG), respectively. Hybridisations of prokaryotic cDNA were achieved following Cy3 or Cy5 labelling of R. conorii from eschars and using bacteria grown in vero cells as control. R. conorii microarrays were obtained from Agilent (‘Custom microarray’ design) and processed as described [6]. Hybridisations of human microarrays (Agilent) were performed with one colour labelling as recommended. The electrophoregrams obtained with the Bioanalyzer (Agilent) indicated that the extraction of Corresponding author and reprint requests: P. Renesto, Universite de la Mediterranee, URMITE IRD-CNRS 6236, Faculte de Medecine, 27 Bd Jean Moulin, 13385 Marseille, cedex 05, France E-mail: patricia.renesto@univmed.fr

MiR-146a Is Critical for Endotoxin-induced Tolerance

The human toll-like receptor 4 (TLR4) pathway is activated in response to lipopolysaccharide (LPS), and subsequent signal transductions lead to the production of cytokines such as tumor necrosis factor-α (TNF-α) by innate immune cells. Defects in innate immune response may contribute to the overproduction of TNF-α leading to systemic inflammation and diseases. Thus, the innate immune response needs to be tightly regulated by elaborate mechanisms to control its onset and termination. LPS tolerance is a state of hyporesponsiveness to subsequent LPS challenge and is achieved by monocytic cells after prolonged exposure to LPS. In this report, kinetics of endotoxin-responsive microRNAs expression analysis revealed a unique pattern of gradual increase for miR-146a starting 4 h after LPS stimulation in THP-1 cells and continued up to 35-fold over 24 h. Conversely, TNF-α increased up to 4 h and then decreased gradually implicating a negative correlation with miR-146a progression. The characteristic up-regulation of miR-146a toward subsequent LPS challenge in THP-1 cells was studied. Strikingly, microRNA expression analysis during the tolerized state of THP-1 cells showed only miR-146a overexpression suggesting its important role in LPS tolerance. In addition, LPS tolerance was dependent on a LPS-priming dose and associated miR-146a up-regulation. LPS-tolerized cells were observed to regain responsiveness in TNF-α production 22 h after LPS removal correlating with a decrease in miR-146a level. Transfection of miR-146a into THP-1 cells mimicked LPS priming, whereas transfection of miR-146a inhibitor largely abolished LPS tolerance. Thus our studies demonstrated that miR-146a is critical for the in vitro monocytic cell-based endotoxin tolerance.

Direct Damage to the Backbone of DNA Oligomers Is Influenced by the OH Moiety at Strand Ends, by the Type of Base, and by Context

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.

A Tumor Sorting Protocol that Enables Enrichment of Pancreatic Adenocarcinoma Cells and Facilitation of Genetic Analyses

Molecular profiling of human cancer is complicated by both stromal contamination and cellular heterogeneity within samples from tumor biopsies. In this study, we developed a tissue-processing protocol using mechanical dissociation and flow cytometric sorting that resulted in the respective enrichment of stromal and tumor fractions from frozen pancreatic adenocarcinoma samples. Molecular profiling of DNA from the sorted populations using high-density single nucleotide polymorphism arrays revealed widespread chromosomal loss of heterozygosity in tumor fractions but not in either the stromal fraction or unsorted tissue specimens from the same sample. Similarly, a combination of KRAS mutations and chromosomal copy number changes at key pancreatic cancer loci, such as CDK2NA and TP53, was detected in a substantial proportion of the tumor fractions but not in matched stromal fractions from the same sample. This approach to tissue processing could greatly expand the amount of archived tissue that is available for molecular profiling of human cancer and enable a more accurate diagnosis of genetic alterations in patient samples.

SGK1 Phosphorylation of IκB Kinase α and p300 Up-regulates NF-κB Activity and Increases N-Methyl-D-aspartate Receptor NR2A and NR2B Expression

Serum- and glucocorticoid-inducible kinase 1 (SGK1) is a downstream target of phosphatidylinositol 3-kinase signaling, and it regulates various cellular and physiological functions, but the SGK1 substrate proteins and genes regulated by SGK1 are less known. Here we have identified IkappaB kinase alpha (IKKalpha) as a novel substrate of SGK1 by using biochemical and bioinformatic approaches. SGK1 directly phosphorylates IKKalpha at Thr-23 and indirectly activates IKKalpha at Ser-180. Furthermore, SGK1 enhanced nuclear factor kappaB (NF-kappaB) activity and up-regulated N-methyl-d-aspartate receptor NR2A and NR2B expression through activation of IKKalpha at Thr-23 and Ser-180, and these two residues play an equally important role in mediating these effects of SGK1. Although SGK1 does not phosphorylate IKKbeta, IKKbeta activity is still required for IKK complex activation and for SGK1 phosphorylation and activation of NF-kappaB. In addition, SGK1 increased the acetylation of NF-kappaB through phosphorylation of p300 at Ser-1834, and this also leads to NF-kappaB activation and NR2A and NR2B expression. Moreover, an endogenous stimulus of SGK1, insulin, increased IKKalpha and NF-kappaB phosphorylation as well as NF-kappaB acetylation and NF-kappaB activity, but SGK1 small interfering RNA transfection blocked these effects of insulin. In examination of the functional significance of the SGK1-IKKalpha-NF-kappaB signaling pathway, we found that transfection of the IKKalpha double mutant (IKKalphaT23A/S180A) to rat hippocampus antagonized SGK-1-mediated spatial memory facilitation. Our results together demonstrated novel substrate proteins of SGK1 and novel SGK1 signaling pathways. Activation of these signaling pathways enhances NR2A and NR2B expression that is implicated in neuronal plasticity.

99 EFFECT OF SUPPRESSION OF BOVINE DNA METHYLTRANSFERASE 1 ON EMBRYONIC DEVELOPMENT AND EXPRESSION OF IMPRINTED GENES

DNA methyltransferase 1 (DNMT1) is believed to be involved in DNA methylation, which is a well-characterized epigenetic modulator shown to have essential functions in germ line and embryonic genome imprinting. This study was conducted to investigate the consequences of suppressing and inhibiting DNMT1 on the development, level of apoptosis, and expression of imprinted genes in pre-implantation bovine embryos. In vitro-produced zygotes were categorized into 4 groups; namely, those injected with Smartpool siRNA (SpsiRNA; Dharmacon Inc., Chicago, IL) (n = 800), 5aza-2′-deoxycytidine (5-AZA; Sigma, St. Louis, MO) (n = 864), nuclease-free water (n = 850), and uninjected control (n = 755). The mRNA expression data were generated using RT-PCR based on the relative standard curve method employing glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as a normalizer. Apoptotic index (API) was calculated by dividing the number of apoptotic cells to total cell number. The proportion of 2-, 4-, 8-cell and 2-, 4-, 8-, and 16-cell embryos was assessed 48 and 72 h, respectively, post-micro injection (pmi), whereas blastocyst rate was assessed at Day 8 pmi. Data on embryonic development and the relative mRNA abundance were analyzed using ANOVA followed by a multiple pair-wise mean comparison using Tukey test. The proportion of 2-, 4-, and 8-cell embryos at 48 h pmi was not significant among treatment groups. However, the proportion of the 8-cell embryos was significantly lower (P < 0.05) in SpsiRNA (16.3 ± 4.5) and 5-AZA injected groups (17.7 ± 4.9) compared with water-injected (26.8 ± 2.9) and uninjected controls (30.7 ± 6.2). The lowest total blastocyst rate (P < 0.05) was observed in the 5-AZA treatment group (16.9 ± 4.9) compared with SpsiRNA (23.4 ± 2.1) and water-injected (24.1 ± 5.3) and uninjected controls (29.4 ± 2.1). Microinjection of SpsiRNA reduced the target mRNA by 80 and 50% in 8-cell and blastocyst stage embryos, respectively, compared with uninjected control, and the protein expression level was also reduced at 8-cell embryos as confirmed by Western blotting. Injection of 5-AZA had no significant effect on mRNA or protein expression. The greatest API (P < 0.05) was found in SpsiRNA (4.2 ± 2.0) and 5-AZA (4.1 ± 1.7) injected groups compared with water-injected (2.8 ± 2.1) and uninjected controls (2.9 ± 2.3). The relative expression study also showed that microinjection of SpsiRNA and 5-AZA increased the expression of IGF2 (by 67 and 55%), IGF2R (29 and 30%), and IGFPB-4 (22 and 24%), respectively, compared with uninjected control, without affecting the expression of both IGF2R and IGFPB-4. In conclusion, suppression of DNMT1 resulted in lower proportion of 8-cell embryos, reduced blastocyst rate, and increased apoptotic index, and affected the expression of some imprinted genes, demonstrating a critical role of this gene in bovine embryonic development.

A Disease-causing Point Mutation in Human Mitochondrial tRNAMet Results in tRNA Misfolding Leading to Defects in Translational Initiation and Elongation

The mitochondrial tRNA genes are hot spots for mutations that lead to human disease. A single point mutation (T4409C) in the gene for human mitochondrial tRNA(Met) (hmtRNA(Met)) has been found to cause mitochondrial myopathy. This mutation results in the replacement of U8 in hmtRNA(Met) with a C8. The hmtRNA(Met) serves both in translational initiation and elongation in human mitochondria making this tRNA of particular interest in mitochondrial protein synthesis. Here we show that the single 8U-->C mutation leads to a failure of the tRNA to respond conformationally to Mg(2+). This mutation results in a drastic disruption of the structure of the hmtRNA(Met), which significantly reduces its aminoacylation. The small fraction of hmtRNA(Met) that can be aminoacylated is not formylated by the mitochondrial Met-tRNA transformylase preventing its function in initiation, and it is unable to form a stable ternary complex with elongation factor EF-Tu preventing any participation in chain elongation. We have used structural probing and molecular reconstitution experiments to examine the structures formed by the normal and mutated tRNAs. In the presence of Mg(2+), the normal tRNA displays the structural features expected of a tRNA. However, even in the presence of Mg(2+), the mutated tRNA does not form the cloverleaf structure typical of tRNAs. Thus, we believe that this mutation has disrupted a critical Mg(2+)-binding site on the tRNA required for formation of the biologically active structure. This work establishes a foundation for understanding the physiological consequences of the numerous mitochondrial tRNA mutations that result in disease in humans.

Role of a Pro-sequence in the Secretory Pathway of Prothyrotropin-releasing Hormone

The biogenesis of rat thyrotropin releasing hormone (TRH) involves the processing of its precursor (proTRH) into five biologically active TRH peptides and several non-TRH peptides where two of them had been attributed potential biological functions. This process implicates 1) proper folding of proTRH in the endoplasmic reticulum after its biosynthesis and exit to the Golgi apparatus and beyond, 2) initial processing of proTRH in the trans Golgi network and, 3) sorting of proTRH-derived peptides to the regulated secretory pathway. Previous studies have focused on elucidating the processing and sorting determinants of proTRH. However, the role of protein folding in the sorting of proTRH remains unexplored. Here we have investigated the role in the secretion of proTRH of a sequence comprising 22 amino acid residues, located at the N-terminal region of proTRH, residues 31-52. Complete deletion of these 22 amino acids dramatically compromised the biosynthesis of proTRH, manifested as a severe reduction in the steady state level of proTRH in the endoplasmic reticulum. This effect was largely reproduced by the deletion of only three amino acid residues, 40PGL42, within the proTRH31-52 sequence. The decreased steady state level of the mutant DeltaPGL was due to enhanced endoplasmic reticulum-associated protein degradation. However, the remnant of DeltaPGL that escaped degradation was properly processed and sorted to secretory granules. Thus, these results suggest that the N-terminal domain within the prohormone sequence does not act as "sorting signal" in late secretion; instead, it seems to play a key role determining the proper folding pathway of the precursor and, thus, its stability.

RNA Interference Screen to Identify Pathways That Enhance or Reduce Nonviral Gene Transfer During Lipofection

Some barriers to DNA lipofection are well characterized; however, there is as yet no method of finding unknown pathways that impact the process. A druggable genome small-interfering RNA (siRNA) screen against 5,520 genes was tested for its effect on lipofection of human aortic endothelial cells (HAECs). We found 130 gene targets which, when silenced by pooled siRNAs (three siRNAs per gene), resulted in enhanced luminescence after lipofection (86 gene targets showed reduced expression). In confirmation tests with single siRNAs, 18 of the 130 hits showed enhanced lipofection with two or more individual siRNAs in the absence of cytotoxicity. Of these confirmed gene targets, we identified five leading candidates, two of which are isoforms of the regulatory subunit of protein phosphatase 2A (PP2A). The best candidate siRNA targeted the PPP2R2C gene and produced a 65% increase in luminescence from lipofection, with a quantitative PCR-validated knockdown of approximately 76%. Flow cytometric analysis confirmed that the silencing of the PPP2R2C gene resulted in an improvement of 10% in transfection efficiency, thereby demonstrating an increase in the number of transfected cells. These results show that an RNA interference (RNAi) high-throughput screen (HTS) can be applied to nonviral gene transfer. We have also demonstrated that siRNAs can be co-delivered with lipofected DNA to increase the transfection efficiency in vitro.

The Homotetrameric Phosphoseryl-tRNA Synthetase from Methanosarcina mazei Exhibits Half-of-the-sites Activity

Synthesis of cysteinyl-tRNA(Cys) in methanogenic archaea proceeds by a two-step pathway in which tRNA(Cys) is first aminoacylated with phosphoserine by phosphoseryl-tRNA synthetase (SepRS). Characterization of SepRS from the mesophile Methanosarcina mazei by gel filtration and nondenaturing mass spectrometry shows that the native enzyme exists as an alpha4 tetramer when expressed at high levels in Escherichia coli. However, active site titrations monitored by ATP/PP(i) burst kinetics, together with analysis of tRNA binding stoichiometry by fluorescence spectroscopy, show that the tetrameric enzyme binds two tRNAs and that only two of the four chemically equivalent subunits catalyze formation of phosphoseryl adenylate. Therefore, the phenomenon of half-of-the-sites activity, previously described for synthesis of 1 mol of tyrosyl adenylate by the dimeric class I tyrosyl-tRNA synthetase, operates as well in this homotetrameric class II tRNA synthetase. Analysis of cognate and noncognate reactions by ATP/PP(i) and aminoacylation kinetics strongly suggests that SepRS is able to discriminate against the noncognate amino acids glutamate, serine, and phosphothreonine without the need for a separate hydrolytic editing site. tRNA(Cys) binding to SepRS also enhances the capacity of the enzyme to discriminate among amino acids, indicating the existence of functional connectivity between the tRNA and amino acid binding sites of the enzyme.

Goodpasture Antigen-binding Protein and Its Spliced Variant, Ceramide Transfer Protein, Have Different Functions in the Modulation of Apoptosis during Zebrafish Development

Human Goodpasture antigen-binding protein (GPBP) is an atypical protein kinase that phosphorylates the Goodpasture auto-antigen, the alpha3 chain of collagen IV. The COL4A3BP gene is alternatively spliced producing two protein isoforms: GPBP and GPBPDelta26. The latter lacks a serine-rich domain composed of 26 amino acid residues. Both isoforms also function as ceramide transfer proteins (CERT). Here, we explored the function of Gpbp and GpbpDelta26/CERT during embryogenesis in zebrafish. We cloned both splice variants of the zebrafish gene and found that they are differentially expressed during development. We used antisense oligonucleotide-mediated loss-of-function and synthetic mRNA-based gain-of-function approaches. Our results show that the loss-of-function phenotype is linked to cell death, evident primarily in the muscle of the somites, extensive loss of myelinated tracks, and brain edema. These results indicate that disruption of the nonvesicular ceramide transport is detrimental to normal embryonic development of somites and brain because of increased apoptosis. Moreover, this phenotype is mediated by Gpbp but not GpbpDelta26/CERT, suggesting that Gpbp is an important factor for normal skeletal muscle and brain development.