Nonidentical Sites Research Articles

Entropy in the Molecular Recognition of Membrane Protein-Lipid Interactions.

Understanding the molecular driving forces that underlie membrane protein-lipid interactions requires the characterization of their binding thermodynamics. Here, we employ variable-temperature native mass spectrometry to determine the thermodynamics of lipid binding events to the human G-protein-gated inward rectifier potassium channel, Kir3.2. The channel displays distinct thermodynamic strategies to engage phosphatidylinositol (PI) and phosphorylated forms thereof. The addition of a 4'-phosphate to PI results in an increase in favorable entropy. PI with two or more phosphates exhibits more complex binding, where lipids appear to bind two nonidentical sites on Kir3.2. Remarkably, the interaction of 4,5-bisphosphate PI with Kir3.2 is solely driven by a large, favorable change in entropy. Installment of a 3'-phosphate to PI(4,5)P2 results in an altered thermodynamic strategy. The acyl chain of the lipid has a marked impact on binding thermodynamics and, in some cases, enthalpy becomes favorable.

Bipartite interaction sites differentially modulate RNA-binding affinity of a protein complex essential for germline stem cell self-renewal.

In C. elegans, PUF proteins promote germline stem cell self-renewal. Their functions hinge on partnerships with two proteins that are redundantly required for stem cell maintenance. Here we focus on understanding how the essential partner protein, LST-1, modulates mRNA regulation by the PUF protein, FBF-2. LST-1 contains two nonidentical sites of interaction with FBF-2, LST-1 A and B. Our crystal structures of complexes of FBF-2, LST-1 A, and RNA visualize how FBF-2 associates with LST-1 A versus LST-1 B. One commonality is that FBF-2 contacts the conserved lysine and leucine side chains in the KxxL motifs in LST-1 A and B. A key difference is that FBF-2 forms unique contacts with regions N- and C-terminal to the KxxL motif. Consequently, LST-1 A does not modulate the RNA-binding affinity of FBF-2, whereas LST-1 B decreases RNA-binding affinity of FBF-2. The N-terminal region of LST-1 B, which binds near the 5' end of RNA elements, is essential to modulate FBF-2 RNA-binding affinity, while the C-terminal residues of LST-1 B contribute strong binding affinity to FBF-2. We conclude that LST-1 has the potential to impact which mRNAs are regulated depending on the precise nature of engagement through its functionally distinct FBF binding sites.

Abstract A085: Investigating real-world molecular testing within both clinical trial selected sites and surrounding sites to identify eligible study patients - a model for streamlined precision medicine clinical trial operations in oncology

Abstract Experimental Procedures: A growing number of oncology clinical trials require a somatic gene mutation/alteration for eligibility. Without prior and timely knowledge of the patient’s tumour molecular status, current practice is to determine this from a screening test during trial procedures. This can often lead to lengthy recruitment timelines, particularly for populations with rare selective biomarkers. Our approach was to investigate and quantify real-world genomic testing data both within and local to sites selected for two ongoing studies, in order to i). understand molecular testing trends within these sites and ii). investigate the feasibility of a data-driven approach to facilitate the referral of eligible patients from surrounding sites to study sites - through the quantification of patient potential based on relevant real-world molecular testing results. A one year data look-back period was applied, the target populations were i). patients diagnosed with advanced cholangiocarcinoma and testing positive for somatic FGFR2 rearrangements and ii). patients diagnosed with advanced bladder cancer and testing positive for somatic FGFR3 mutations or translocations. These parameters were selected as they represent the target patient populations for two ongoing clinical trials. Summary Results: For simplicity, selected results only in France are given in the table below - data on multiple other geographies also exists. Study population/molecular biomarkerNo. of selected trial sitesNo. of real-world molecular testing sitesNo. of patients with a positive result - all testing sites combinedNo. of matching (identical) sites - trial & molecular testing sitesNo. of non-matching (non-identical) sites within 50 kilometres of each other - trial & molecular testing sites Advanced Cholangiocarcinoma/FGFR21315332215 Advanced Bladder Cancer/FGFR316191,063423 Conclusions: These data have provided invaluable insights into real-world FGFR2/FGFR3 molecular testing within sites, giving an enhanced understanding of molecular testing trends. Additionally, new sites in relatively close proximity (50 kilometres) to trial sites with patient potential have been identified. Strategies are underway to consider the best approach to action these findings, i.e. develop a referral network from surrounding sites to trial sites and ultimately accelerate the recruitment of eligible patients into these ongoing clinical trials, which they otherwise may have been unaware of. Whilst the one year look back period applied was informative as a first step, the key to our future approach will be to identify new patients from prospective real-world molecular testing, and to recruit these patients into the relevant trial before they become otherwise ineligible, e.g. through changing tumour molecular status or death. This nascent approach has the potential to be expanded upon and become a more widespread – and necessary – approach to targeted therapy trials, leading to accelerated clinical development timelines and bringing efficacious new medicines to patients in need of these. With the emergence of broad genomic profiling, the availability of actionable, real-world molecular data to support clinical trial enrolment is also expected to grow. Citation Format: Michael G Cushion, Michael Bennett Rosenthal, Donald Benson, Jeffrey Hodge, Marion Brayer, Chang-I Wu. Investigating real-world molecular testing within both clinical trial selected sites and surrounding sites to identify eligible study patients - a model for streamlined precision medicine clinical trial operations in oncology [abstract]. In: Proceedings of the AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics; 2019 Oct 26-30; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2019;18(12 Suppl):Abstract nr A085. doi:10.1158/1535-7163.TARG-19-A085

Synergistic Lethality of a Binary Inhibitor of Mycobacterium tuberculosis KasA.

We report GSK3011724A (DG167) as a binary inhibitor of β-ketoacyl-ACP synthase (KasA) in Mycobacterium tuberculosis Genetic and biochemical studies established KasA as the primary target. The X-ray crystal structure of the KasA-DG167 complex refined to 2.0-Å resolution revealed two interacting DG167 molecules occupying nonidentical sites in the substrate-binding channel of KasA. The binding affinities of KasA to DG167 and its analog, 5g, which binds only once in the substrate-binding channel, were determined, along with the KasA-5g X-ray crystal structure. DG167 strongly augmented the in vitro activity of isoniazid (INH), leading to synergistic lethality, and also synergized in an acute mouse model of M. tuberculosis infection. Synergistic lethality correlated with a unique transcriptional signature, including upregulation of oxidoreductases and downregulation of molecular chaperones. The lead structure-activity relationships (SAR), pharmacokinetic profile, and detailed interactions with the KasA protein that we describe may be applied to evolve a next-generation therapeutic strategy for tuberculosis (TB).IMPORTANCE Cell wall biosynthesis inhibitors have proven highly effective for treating tuberculosis (TB). We discovered and validated members of the indazole sulfonamide class of small molecules as inhibitors of Mycobacterium tuberculosis KasA-a key component for biosynthesis of the mycolic acid layer of the bacterium's cell wall and the same pathway as that inhibited by the first-line antitubercular drug isoniazid (INH). One lead compound, DG167, demonstrated synergistic lethality in combination with INH and a transcriptional pattern consistent with bactericidality and loss of persisters. Our results also detail a novel dual-binding mechanism for this compound as well as substantial structure-activity relationships (SAR) that may help in lead optimization activities. Together, these results suggest that KasA inhibition, specifically, that shown by the DG167 series, may be developed into a potent therapy that can synergize with existing antituberculars.

A Single Amino Acid Substitution Converts a Transmembrane Protein Activator of the Platelet-derived Growth Factor β Receptor into an Inhibitor

Receptors for PDGF play an important role in cell proliferation and migration and have been implicated in certain cancers. The 44-amino acid E5 protein of bovine papillomavirus binds to and activates the PDGFβ receptor (PDGFβR), resulting in oncogenic transformation of cultured fibroblasts. Previously, we isolated an artificial 36-amino acid transmembrane protein, pTM36-4, which transforms cells because of its ability to activate the PDGFβR despite limited sequence similarity to E5. Here, we demonstrated complex formation between the PDGFβR and three pTM36-4 mutants: T21E, T21Q, and T21N. T21Q retained wild type transforming activity and activated the PDGFβR in a ligand-independent manner as a consequence of binding to the transmembrane domain of the PDGFβR, but T21E and T21N were severely defective. In fact, T21N substantially inhibited E5-induced PDGFβR activation and transformation in both mouse and human fibroblasts. T21N did not prevent E5 from binding to the receptor, and genetic evidence suggested that T21N and E5 bind to nonidentical sites in the transmembrane domain of the receptor. T21N also inhibited transformation and PDGFβR activation induced by v-Sis, a viral homologue of PDGF-BB, as well as PDGF-induced mitogenesis and signaling by preventing phosphorylation of the PDGFβR at particular tyrosine residues. These results demonstrated that T21N acts as a novel inhibitor of the PDGFβR and validated a new strategy for designing highly specific short transmembrane protein inhibitors of growth factor receptors and possibly other transmembrane proteins.

Calculation of cooperativity and equilibrium constants of ligands binding to G-quadruplex DNA in solution

Equilibrium model of a ligand binding with DNA oligomer has been considered as a process of small molecule adsorption onto a lattice of multiple binding sites. An experimental example has been used to verify the assertion that during saturation of the macromolecule by a ligand should expect effect of cooperativity due to changes in DNA conformation or the mutual influence between bound ligands. Such phenomenon cannot be entirely described by the classical stepwise complex formation model. To evaluate a ligand binding affinity and cooperativity of ligand–oligomer complex formation the statistical approach has been proposed. This new computational approach used to re-examine previously studded ligand binding towards DNA quadruplexes targets with multiple binding sites. The intrinsic equilibrium constants K1−3 of the mesotetrakis-(N-methyl-4-pyridyl)-porphyrin (TMPyP4) binding with the [d(T4G4)]4 and with the [AG3(T2AG3)3] quadruplexes and the correction for the mutual influence between bound ligands (cooperativity parameters ω) was determined from the Job plots based upon the nonlinear least-squares fitting procedure. The re-examination of experimental curves reveals that the equilibrium is affected by the positive cooperative (ω>1) binding of the TMPyP4 ligand with tetramolecular [d(T4G4)]4. However for an intramolecular antiparallel–parallel hybrid structure [AG3(T2AG3)3] the weak anti-cooperativity of TMPyP4 accommodation (ω<1) onto two from three nonidentical sites was detected.

Identification of nucleotides and amino acids that mediate the interaction between ribosomal protein L30 and the SECIS element

BackgroundRibosomal protein L30 belongs to the L7Ae family of RNA-binding proteins, which recognize diverse targets. L30 binds to kink-turn motifs in the 28S ribosomal RNA, L30 pre-mRNA, and mature L30 mRNA. L30 has a noncanonical function as a component of the UGA recoding machinery that incorporates selenocysteine (Sec) into selenoproteins during translation. L30 binds to a putative kink-turn motif in the Sec Insertion Sequence (SECIS) element in the 3’ UTR of mammalian selenoprotein mRNAs. The SECIS also interacts with SECIS-binding protein 2 (SBP2), an essential factor for Sec incorporation. Previous studies showed that L30 and SBP2 compete for binding to the SECIS in vitro. The SBP2:SECIS interaction has been characterized but much less is known about how L30 recognizes the SECIS.ResultsHere we use enzymatic RNA footprinting to define the L30 binding site on the SECIS. Like SBP2, L30 protects nucleotides in the 5’ side of the internal loop, the 5’ side of the lower helix, and the SECIS core, including the GA tandem base pairs that are predicted to form a kink-turn. However, L30 has additional determinants for binding as it also protects nucleotides in the 3’ side of the internal loop, which are not protected by SBP2. In support of the competitive binding model, we found that purified L30 repressed UGA recoding in an in vitro translation system, and that this inhibition was rescued by SBP2. To define the amino acid requirements for SECIS-binding, site-specific mutations in L30 were generated based on published structural studies of this protein in a complex with its canonical target, the L30 pre-mRNA. We identified point mutations that selectively inhibited binding of L30 to the SECIS, to the L30 pre-mRNA, or both RNAs, suggesting that there are subtle differences in how L30 interacts with the two targets.ConclusionsThis study establishes that L30 and SBP2 bind to overlapping but non-identical sites on the SECIS. The amino acid requirements for the interaction of L30 with the SECIS differ from those that mediate binding to the L30 pre-mRNA. Our results provide insight into how L7Ae family members recognize their cognate RNAs.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Magnetic interactions and electronic structure of uvarovite and andradite garnets. An ab initio all‐electron simulation with the CRYSTAL06 program

AbstractThe ground‐state electronic structure of a number of magnetic phases of the garnets andradite (Ca3Fe2Si3O12) and uvarovite (Ca3Cr2Si3O12) has been investigated at the density functional theory level of approximation using the periodic ab initio code CRYSTAL. An all‐electron Gaussian‐type basis has been used in conjunction with the B3LYP hybrid functional. The exchange coupling constants between the first (J1a and J1b differentiating the two nonidentical sites), second (J2), and third (J3) nearest neighbors have been evaluated and are found to be in good agreement with the experimental data that is available for andradite. As a consequence of both the different J1a to J1b ratio and the opposite sign of J2 in the two minerals, different antiferromagnetic (AF) ground states are found for uvarovite and andradite, which is in agreement with experimental observation. Strong support for the additivity and transferability of the J constants is provided by calculations in which Cr and Fe ions are embedded in the related grossular structure. The mechanism for the stabilization of the AF states is discussed within the Anderson theory of superexchange; the kinetic energy gain in the AF states is calculated, and the spin density maps and profiles are examined. Density of states, charge density maps, and Mulliken population data complete the analysis of the electronic structure. © 2009 Wiley Periodicals, Inc. Int J Quantum Chem, 2010

Mechanism of Strand-Specific Smooth Muscle α-Actin Enhancer Interaction by Purine-Rich Element Binding Protein B (Purβ)

Expression of the smooth muscle alpha-actin gene in growth-activated vascular smooth muscle cells and stromal fibroblasts is negatively regulated by members of the Pur family of single-stranded DNA/RNA-binding proteins. In particular, Puralpha and Purbeta are postulated to repress transcription by forming helix-destabilizing complexes with the sense strand of an asymmetric polypurine-polypyrimidine tract containing a canonical MCAT enhancer motif in the 5' region of the gene. Herein, we establish the mechanism of Purbeta binding to the purine-rich strand of the enhancer using quantitative methods and purified components. Initial evaluation of DNA-binding specificity and equilibrium stoichiometry via colorimetric-, autoradiographic-, and fluorescence-based assays suggested that Purbeta interacts with two distinct G/A-rich sites within the nominal single-stranded enhancer element to form a high-affinity 2:1 protein:DNA complex. Statistical mechanical analyses of band shift titrations of the nominal element in conjunction with DNase I footprint titrations of the extended smooth muscle alpha-actin 5'-flanking region demonstrated that assembly of the nucleoprotein complex likely occurs in a sequential, cooperative, and monomer-dependent fashion. Resolution of the microscopic energetics of the system indicated that monomer association with two nonidentical sites flanking the core MCAT motif accounts for the majority of the intrinsic binding affinity of Purbeta with intersite cooperativity contributing an approximately 12-fold increase to the stability of the nucleoprotein complex. These findings offer new insights into the mechanism, energetics, and sequence determinants of Purbeta repressor binding to a biologically relevant, contractile phenotype-regulating cis-element while also revealing the thermodynamic confines of putative Purbeta-mediated effects on DNA structure.

Ligand-binding studies on light riboflavin synthase from Bacillus subtilis.

Light riboflavin synthase of Bacillus subtilis is a trimer of identical subunits. The enzyme catalyzes the transfer of a four-carbon moiety from one molecule of 6,7-dimethyl-8-ribityllumazine to a second molecule of this compound. Binding of substrate and product analogues to the enzyme was studied by analytical ultra-centrifugation and fluorescence titration. The ligands used in these experiments inhibit the enzyme activity competitively. Each enzyme subunit was shown to bind two molecules each of various analogues of the enzyme substrate, 6,7-dimethyl-8-ribityllumazine, at nonidentical sites. On the other hand, each subunit binds only one molecule of the product, riboflavin, or 5-nitroso-6-ribitylamino-2,4(1H,3H)-pyrimidinedione, an analogue of the second product. The complex of the enzyme with the substrate analogue, 7-methyl-8-ribityllumazine, was studied by absorbance and difference absorbance measurements. The data suggest that binding of the lumazine to the donor site of the enzyme involves a nucleophilic attack at carbon 7 of the lumazine ring with formation of a covalent hydrate or a related structure.

Analysis of the mechanism by which the small-molecule CCR5 antagonists SCH-351125 and SCH-350581 inhibit human immunodeficiency virus type 1 entry.

Human immunodeficiency virus type 1 (HIV-1) entry is mediated by the consecutive interaction of the envelope glycoprotein gp120 with CD4 and a coreceptor such as CCR5 or CXCR4. The CCR5 coreceptor is used by the most commonly transmitted HIV-1 strains that often persist throughout the course of infection. Compounds targeting CCR5-mediated entry are a novel class of drugs being developed to treat HIV-1 infection. In this study, we have identified the mechanism of action of two inhibitors of CCR5 function, SCH-350581 (AD101) and SCH-351125 (SCH-C). AD101 is more potent than SCH-C at inhibiting HIV-1 replication in primary lymphocytes, as well as viral entry and gp120 binding to cell lines. Both molecules also block the binding of several anti-CCR5 monoclonal antibodies that recognize epitopes in the second extracellular loop of CCR5. Alanine mutagenesis of the transmembrane domain of CCR5 suggests that AD101 and SCH-C bind to overlapping but nonidentical sites within a putative ligand-binding cavity formed by transmembrane helices 1, 2, 3, and 7. We propose that the binding of small molecules to the transmembrane domain of CCR5 may disrupt the conformation of its extracellular domain, thereby inhibiting ligand binding to CCR5.

Mn2+ binding to factor VIII subunits and its effect on cofactor activity.

Metal ions, such as Ca2+ and Mn2+, are necessary for the generation of cofactor activity following reconstitution of factor VIII from its isolated light chain (LC) and heavy chain (HC). Titration of EDTA-treated factor VIII with Mn2+ showed saturable binding with high affinity (K(d) = 5.7 +/- 2.1 microM) as detected using a factor Xa generation assay. No significant competition between Ca2+ and Mn2+ for factor VIII binding (K(i) = 4.6 mM) was observed as measured by equilibrium dialysis using 20 microM Ca2+ and 8 microM factor VIII in the presence of 0-1 mM Mn2+. The intersubunit affinity measured by fluorescence energy transfer of an acrylodan-labeled LC (fluorescence donor) and fluorescein-labeled HC (fluorescence acceptor) in the presence of 20 mM Mn2+ (K(d) = 53.0 +/- 17.1 nM) was not significantly different from the affinity value previously obtained in the absence of metal ion (K(d) = 53.8 +/- 14.2 nM). The sensitization of phosphorescence of Tb3+ bound to factor VIII subunits was utilized to detect Mn2+ binding to the subunits. Mn2+ inhibited the phosphorescence of Tb3+ bound to HC and LC, as well as the HC-derived A1 and A2 subunits with a relatively wide range of estimated inhibition constant values (K(i) values = 169-1147 microM), whereas Ca2+ showed no effect on Tb3+ phosphorescence. These results suggest that factor VIII cofactor activity can be generated by Mn2+ binding to site(s) on factor VIII that are different from the high-affinity Ca2+ binding site. However, like Ca2+, Mn2+ did not alter the affinity for HC and LC association. Thus, Mn2+appears to generate factor VIII cofactor activity by a similar mechanism as observed for Ca2+following its association at nonidentical sites on the protein.

Structural aspects of mullite-type NaAl9O14 studied by 27Al and 23Na solid-state MAS and DOR NMR techniques

23 Na and 27Al MAS and DOR NMR spectra are reported for the mullite-type crystalline compound NaAl9O14 and its amorphous precursor using a range of applied magnetic fields (8.45–16.9 T). The crystalline compound is shown by 27Al NMR to contain aluminium in one octahedral and two tetrahedral sites, a distribution consistent with expectations based on a recent Rietveld structure determination. By contrast, two approximately equally populated non-identical Na sites can be distinguished by 23Na NMR. Spectral simulation indicates these sites to be of slightly different distortion but of similar isotropic chemical shift. This result is not consistent with the average Pbam structure deduced from Rietveld X-ray analysis, in which the two possible Na sites are symmetrically equivalent. These measurements illustrate the ability of NMR techniques to distinguish small variations in atomic environment which are not resolved in the averaged X-ray structure.

Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA-recognition domains.

This study concerns chimeric restriction enzymes that are hybrids between a zinc finger DNA-binding domain and the non-specific DNA-cleavage domain from the natural restriction enzyme FOK:I. Because of the flexibility of DNA recognition by zinc fingers, these enzymes are potential tools for cleaving DNA at arbitrarily selected sequences. Efficient double-strand cleavage by the chimeric nucleases requires two binding sites in close proximity. When cuts were mapped on the DNA strands, it was found that they occur in pairs separated by approximately 4 bp with a 5' overhang, as for native FOK:I. Furthermore, amino acid changes in the dimer interface of the cleavage domain abolished activity. These results reflect a requirement for dimerization of the cleavage domain. The dependence of cleavage efficiency on the distance between two inverted binding sites was determined and both upper and lower limits were defined. Two different zinc finger combinations binding to non-identical sites also supported specific cleavage. Molecular modeling was employed to gain insight into the precise location of the cut sites. These results define requirements for effective targets of chimeric nucleases and will guide the design of novel specificities for directed DNA cleavage in vitro and in vivo.

Synthesis, molecular structure and reactivity of a new dicopper(II) benzimidazole complex with non-identical copper(II) sites

The dinucleating ligand ethylene glycol-bis(β-aminoethyl ether) N,N,N′N′-tetrakis[2-(1-ethylbenzimidazoyl)] (EGTB-Et, 1) has been synthesized in good yield by the condensation of 1,2-diaminobenzene with ethylene glycol-bis(β-aminoethyl ether) N,N,N′,N′-tetraacetic acid. This ligand was used to synthesize the dinuclear Cu II diacetonitrile complex [Cu 2(EGTB-Et)(CH 3CN) 2](ClO 4) 4·2CH 3CN ( 2). The X-ray structure shows two distinct square pyramidal Cu II centres with each Cu II ion bound by two benzimidazole nitrogen atoms, one amine nitrogen atom, an ether oxygen atom and one acetinitrile nitrogen atom. The Cu--Cu separation is 5.809A˚. Spectral titration of 2 with sodium acetate or sodium cyanide results in new complexes with terminal acetate or cyano groups. X-band EPR spectra of a powdered sample and an acetonitrile solution of 2 show isotropic signals with g = 2.10 and 2.14, respectively. The gDM s = 2 transition at g ∼ 4.5 expected for magnetically coupled Cu II ions is not observed for either the powder or acetonitrile solution samples of 2. Based on the EPR spectra, the room-temperature magnetic moment (μ effCu= 2.16BM) and the X-ray structure, no orbital overlap between the magnetic d x 2 - y 2 orbital of Cu(2) and the magnetic d x 2 - y 2 orbital of Cu(1) occurs requiring the two Cu II centres to be uncoupled. Therefore, 2 is a dinuclear Cu II complex with non-interacting Cu II centres in non-identical sites.

The differential antagonism by bicuculline and SR95531 of pentobarbitone-induced currents in cultured hippocampal neurons

In voltage clamped cultured hippocampal neurons, application of γ-aminobutyric acid (GABA) or pentobarbitone induced chloride current in a dose-dependent manner. The dose dependence of these agonists were well described by ED 50 and Hill coefficients of 14.7 ± 7 μM and 1.2 ± 0.5, and 299 ± 17.3 μM and 1.6 ± 0.1, for GABA and pentobarbitone, respectively. The effects of two GABA A receptor antagonists, bicuculline and 2-(3-carboxypropyl)-3-amino-6-methoxyphenyl-pyridazinium bromide (SR95531) were evaluated by coapplication of increasing concentrations of the antagonists with a fixed equipotent (approximately ED 30) dose of GABA or pentobarbitone. Both bicuculline and SR95531 blocked the GABA induced current with ID 50 and Hill coefficients of 0.74 ± 0.07 μM and 0.96 ± 0.07, and 0.44 ± 0.02 μM and 1.22 ± 0.06, respectively. Bicuculline similarly blocked the pentobarbitone induced current with a ID 50 and Hill coefficient of 0.69 ± 0.04 μM and 1.2 ± 0.1. However, pentobarbitone induced current was poorly blocked by SR95531 retaining 86.5% of current amplitude at a concentration of SR95531, 200 times the IC 50 for GABA induced current. Current induced by etomidate, another intravenous general anesthetic with GABA A receptor agonistic property, is likewise resistant to SR95531 blockade. Three-dimensional modeling of bicuculline and SR95531 with alignment of the molecules along the suggested GABA-receptor binding moiety indicates that these two antagonist molecules have distinct steric properties. We suggest that GABA and pentobarbitone act at nearby but non-identical sites on the hippocampal GABA A receptor to open the chloride ionophore, and that these sites can be distinguished by bicuculline and SR95531. This is the first demonstration that the prototypic GABA A site antagonists bicuculline and SR95531 have different effects on currents induced by GABA and pentobarbitone.

ATP-dependent 17β-Estradiol 17-(β-D-Glucuronide) Transport by Multidrug Resistance Protein (MRP): INHIBITION BY CHOLESTATIC STEROIDS

In addition to its ability to confer resistance to a range of natural product type chemotherapeutic agents, multidrug resistance protein (MRP) has been shown to transport the cysteinyl leukotriene, LTC4, and several other glutathione (GSH) S-conjugates. We now demonstrate that its range of potential physiological substrates also includes cholestatic glucuronidated steroids. ATP dependent, osmotically sensitive transport of the naturally occurring conjugated estrogen, 17 beta-estradiol 17-(beta-D-glucuronide) (E(2)17 beta G), was readily demonstrable in plasma membrane vesicles from populations of MRP-transfected HeLa cells (Vmax 1.4 nmol mg-1 min-1, K(m) 2.5 micron). The involvement of MRP was confirmed by demonstrating that transport was completely inhibited by a monoclonal antibody specific for an intracellular conformational epitope of the protein. MRP-mediated transport of LTC4, was competitively inhibited by E(2)17 beta G (K(i(app)) 22 micron), despite the lack of structural similarity between these two substrates. Competitive inhibition of [3H]E(2)17 beta G transport was also observed with a number of other cholestatic conjugated steroids. All of these compounds prevented photolabeling of MRP with [3H]LTC4, demonstrating that the cholestatic steroid and leukotriene conjugates compete either for the same or possibly overlapping sites on the protein. Consistent with the presence of overlapping but non-identical sites, studies using chemotherapeutic drugs to inhibit MRP-mediated E(2)17 beta G transport indicated that daunorubicin had the highest relative potency of the drugs tested, whereas it was the least potent inhibitor of LTC4 transport. Non-cholestatic steroids glucuronidated at the 3 position of the steroid nucleus, such as 17 beta-estradiol 3-(beta-D-glucuronide), did not compete for transport of E(2)17 beta G by MRP, nor did they inhibit photolabeling of the protein with [3H]LTC4. These data identify MRP as a potential transporter of cholestatic conjugated estrogens and demonstrate site-specific requirements for glucuronidation of the steroid nucleus.

Binding sites on microtubules of kinesin motors of the same or opposite polarity.

The kinesin motor proteins translocate toward either the plus or minus end of microtubules (MTs). Competitive microtubule binding assays were carried out with monomeric motor domains of the minus-end-directed nonclaret disjunctional (Ncd) and Kar3 and the plus-end-directed kinesin heavy chain (KHC) to determine whether motors of the same or opposite polarity compete for binding sites on MTs and to test the idea that motor polarity is determined by differences in binding sites on MTs of the motors. The stoichiometries of binding were approximately 1 motor:1 tubulin heterodimer for all three motors. Ncd and Kar3, both minus-end motors, severely inhibited the binding of one another to MTs, as predicted theoretically for binding of the two motors to the same site on MTs, indicating that the binding sites on MTs of Ncd and Kar3 are the same or overlap extensively. Motors of opposite polarity, KHC and Ncd or KHC and Kar3, showed partial or complete inhibition of binding to MTs under different experimental protocols. The differences in binding behavior could be due to experimental conditions or be inherent in the nature of motor binding to MTs. Alternatively, differences in KHC and Ncd or Kar3 binding sites on MTs may exist such that the motors bind to partially overlapping but nonidentical sites on MTs. These differences in binding sites may be related to the opposite polarity of translocation on MTs of the motors.

Isolation and characterization of a d-glucose/xylose isomerase from a new thermophilic strain Streptomyces sp. (PLC)

A thermostable d-xylase isomerase from a newly isolated thermophilic Streptomyces sp. (PLC) strain is described. The enzyme was purified to homogeneity. It is a homotetramer with a native molecular mass of 183 kDa and a subunit molecular mass of 46 kDa. The enzyme has a K m of 35 mM for d-xylose and also accepts d-glucose as substrate, however, with a tenfold higher K m (0.4 M) and half the maximum velocity. Both the activity and stability of this d-xylose isomerase depend strongly on divalent metal ions. Two metal ions bind per subunit to non-identical sites. Mg2+, Mn2+ and Co2+ are of comparable efficiency for the d-xylose isomerase reaction. Con2+ is the most efficient cofactor for d-glucose isomerization. The enzyme remains fully active up to 95°C. The activity decreases at 53°C in the presence of Co2+ and Mg2+ with a half-life of 7 and 9 days respectively. In the presence of Mn2+ the enzyme activity remains constant for at least 10 days and at 70°C 50% of the activity is lost after 5 days.