Nematode Reproduction Research Articles

Microplastics effects on soil biota are dependent on their properties: A meta-analysis

Microplastics (MPs) pollution is identified as an important new global change factor potentially influencing ecosystem functions and services. MPs have been shown to strongly affect soil biota. However, whether soil biota respond differently to biodegradable and conventional MPs, and the generalizable pattern of responses of soil biota to MPs size, dose and the time of exposure to MPs remain poorly understood. Here we conducted a global-scale meta-analysis of 781 observations from 92 publications to investigate the effects of MPs on soil biota (i.e., microbiota and fauna). We also explored how soil biota respond to different experimental conditions (e.g., MPs properties and experimental duration). Results showed that MPs significantly increased soil microbial biomass, while decreased the growth and reproduction of soil fauna (nematodes, springtails and earthworms). However, MPs significantly decreased soil bacterial diversity (Shannon index) and shifted microbial community structure, and the effect of MPs on soil bacteria was more intense than that on soil fungi. The responses of soil biota were dependent on MPs types, sizes, concentrations and experimental duration. For example, biodegradable MPs had stronger impacts on soil microbial community, while had weaker negative impacts on soil fauna than conventional MPs. Likewise, smaller size of MPs appeared to have more adverse impacts on soil bacterial diversity, and the growth and reproduction of nematodes, but this trend was opposite in the reproduction of earthworms. Furthermore, the response of soil microbial community and fauna significantly correlated with the MPs concentration and experimental duration, suggesting that soil biota exposed to MPs for high concentrations and long periods were more vulnerable. Regardless of specific experimental conditions, these results highlight that prolonged MPs pollution may have considerable negative effects on the structure and function of soil biota and consequently affect the ability of soil ecosystems to provide ecosystem services and sustain human societies.

Biocontrol of Meloidogyne spp. in Solanum lycopersicum using a dual combination of Bacillus strains.

Root-knot nematodes (RKNs, Meloidogyne spp.) are obligate plant parasites that constitute a significant pest for agriculture worldwide. They penetrate the plant roots, reducing the uptake of water and nutrients, causing a significant impact on crop yield. One alternative on focus now for nematode management is biological control. Rhizobacteria within the Bacillus genus show multiple modes of action against plant-parasitic nematodes (PPNs) that can act alone or in combination. In this context, we evaluated a dual-strain bacteria combination (B. paralicheniformi FMCH001 and B. subtilis FMCH002) to reduce nematode infection in tomato plants. We evaluated mortality of larvae from Meloidogyne javanica in vitro, as well as eggs hatching after the treatment. Atraction, penetration, establishment, and reproduction assays in vitro or in pots in tomato plants infected with M. javanica and treated/ untreated with the dual-strain bacteria combination were also performed. Additionally, morphometric parameters comparing giant cells size from galls of treated and untreated plants by using confocal microscopy were also measured. The results showed that this combination of strains has nematicidal properties in the pre-infection phase by decreasing the egg-hatching, juvenile survival, and attractiveness to the roots. Furthermore, nematode establishment, gall formation, and, remarkably, giant cell development was severely impaired after the bacterial treatment, suggesting interference with morphogenetic mechanisms induced by the nematode during GCs development within the plant. Nematode reproduction in tomato plants was reduced independently of the application mode in soil, before or after bacterial treatment. The dual-strain combination was also effective against other PPNs (i.e. Pratylenchus spp.) and in different crops (soybean). Therefore, combining B. paralicheniformis FMCH001 and B. subtilis FMCH002 is an efficient agent for the biological control of Meloidogyne spp. by interfering with different stages of the nematode cycle as a result of multiple modes of action.

Manejo de nematoides-de-galha em quiabeiro por meio de enxertia em vinagreira-roxa e vinagreira-flor-de-veludo

Abstract The objective of this work was to evaluate the performance of okra grafted onto Hibiscus spp. in the presence and absence of three root knot nematode species. The experimental design was completely randomized in a 4x4 factorial arrangement with ten replicates. The first factor consisted of the following four rootstocks: kenaf (Hibiscus cannabinus), false roselle (Hibiscus acetosella), self-grafted, and non-grafted. The second factor was the inoculation of 5,000 eggs and second-stage juveniles of Meloidogyne incognita, Meloidogyne javanica, and Meloidogyne enterolobii in okra plants, plus an uninoculated control. Vegetative development, agronomic performance, and nematode reproduction were evaluated. The grafting of okra onto Hibiscus spp. in the presence of root-knot nematodes provided a greater plant height, scion length, fresh shoot mass, number of fruits, and yield, when compared with self-grafted and non-grafted plants. The averages of the root-knot nematode reproduction factor were low in the plants grafted onto Hibiscus spp., indicating that grafting in the presence of root-knot nematodes is capable of maintaining okra vegetative development and yield.

The Caenorhabditis elegans cuticle plays an important role against toxicity to bisphenol A and bisphenol S.

Caenorhabditis elegans represents a favorite non-mammalian animal model, which is often used to study the effect of foreign substances on living organisms. Its epidermal barrier is a primary biological barrier that protects nematodes from the toxicity of chemicals. In this study, we investigated the effect of Bisphenol A (BPA), an endocrine disrupting chemical, and its structural analog Bisphenol S (BPS), which is often used as a substitute for BPA in some products, on the behavior of C. elegans wild type (N2) and C. elegans bli-1 mutant strain, which is characterized by the production of abnormal cuticle blisters. We found that exposure of C. elegans wild type (N2), as well as its mutant strain bli-1, to selected concentrations of BPA (0.1, 0.5, 1 and 5µM) and BPS (0.1, 0.5, 1 and 5µM) resulted in significant changes in reproduction, habituation behavior, and body length of nematodes. Based on our findings, we can conclude that BPS, which was supposed to be a safer alternative to BPA, caused almost identical detrimental effects on C. elegans behavior. Furthermore, compared to the wild type of C. elegans, these effects were more pronounced in the bli-1 strain, which is characterized by a mutation in an individual collagen gene responsible for proper cuticle formation, underlying the role of the epidermal barrier in bisphenol toxicity. Taken together, our data indicate the potential risks of using BPS as a BPA alternative.

First Report of Meloidogyne graminicola Naturally Infecting Cyperus difformis in China.

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) μm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) μm, stylet = 11.7 ± 1.5 (9.7 to 14.4) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) μm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) μm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) μm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) μm, BW = 16.9 ±1.7 (14.1 to 19.7) μm, stylet = 13.2 ± 0.6 (12.5 to 14.9) μm, DGO = 3.3 ± 0.5 (2.6 to 4.4) μm, tail = 71.6 ± 5.5 (65.1 to 82.0) μm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) μm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

Multiple stressor effects on a model soil nematode, Caenorhabditis elegans: Combined effects of the pathogen Klebsiella pneumoniae and zinc oxide nanoparticles

Research utilizing the model soil nematode Caenorhabditis elegans has revealed that agriculturally relevant nanoparticles (NP), such as zinc oxide NP (ZnONP), cause toxicity at low concentrations and disrupt molecular pathways of pathogen resistance. However, in most nanotoxicity assessments, model organisms are exposed to a single stressor but in nature organisms are affected by multiple sources of stress, including infections, which might exacerbate or mitigate negative effects of NP exposure. Thus, to expand our understanding of the environmental consequences of released NP, this project examined the synergistic/antagonistic effects of ZnONP on C. elegans infected with a common pathogen, Klebsiella pneumoniae. Individual exposures of C. elegans to ZnONP, zinc sulfate (Zn2+ ions) or K. pneumoniae significantly decreased nematode reproduction compared to controls. To assess the combined stress of ZnONP and K. pneumoniae, C. elegans were exposed to equitoxic EC30 concentrations of ZnONP (or Zn ions) and K. pneumoniae. After the combined exposure there was no decrease in reproduction. This complete elimination of reproductive toxicity was unexpected because exposures were conducted at EC30 Zn concentrations and reproductive toxicity due to Zn should have occurred. Amelioration of the pathogen effects by Zn are partially explained by the Zn impact on the K. pneumoniae biofilm. Quantitative assessments showed that external biofilm production and estimated colony forming units (CFU) of K. pneumoniae within the nematodes were significantly decreased. Taken together, our results suggest that during the combined exposure of C. elegans to both stressors Zn in ionic or particulate form inhibits K. pneumoniae ability to colonize nematode's intestine through decreasing pathogen biofilm formation. This highlights the unpredictable nature of combined stressor effects, calling into question the utility of exposures in simplified laboratory media.

Biological Management of Root Knot Nematode, Meloidogyne incognita through Bacterial Antagonists Infecting Tomato

Root-knot nematodes have wide host range, causing damage to many annual and perennial crops. More than 100 species of Meloidogyne are known in which Meloidogyne incognita (Kofoid and White) Chitwood is one of the most common and important plant parasitic nematode in tropical and subtropical regions of the world including Pakistan. This study was planned to investigate the interaction of Plant Growth Promoting Rhizobacteria and Pasteuria penetrans for the management of root knot nematode M. incognita on tomato in green house at 30 + 4 0C. Earthen pots 20 cm dia. having sterilized soil was mixed with Pasteuria penetrans root powder @ 103 spores per gm of soil. Three week old seedlings of tomato Money Maker were transplanted singly in pots. One week after transplanting, 30 ml of bacterial (Bacillus subtilis, Pseudomonas fluorescens and Enterobacter cloacae) suspension were applied in root zone. Seven days after application of PGPR, 2000 J2 were applied at root zone. The experiment was arranged in Completely Randomized Design and six treatments were replicated tenfold. Pasteuria penetrans alone or in different combinations with PGPR were applied. Pots with nematode and without PGPR, Pp and nematode were kept as control. Sixty days after nematode application, plants were harvested carefully. Data were recorded on plant growth parameters and nematode reproduction in terms of number of egg mass, number of females, number of galls and galling index (0-10). The plant treated with Enterobacter cloacae + Pp significantly suppressed the number of egg mass 69.38%, number of galls 68%, number of females 66.21% and galling index 56.82% compared to control resulting in improved growth over control. The treatments B. subtilis + Pp and P. fluorescens + Pp showed intermediary effect on both nematode reproduction and plant growth..Pasteuria penetrans was least observed effective in suppressing number of egg mass 57.53 %, number of females 55%, number of galls 55.73% and galling index 47.73%.

Molecular Characterization and Virus-Induced Gene Silencing of a Collagen Gene, Me-col-1, in Root-Knot Nematode Meloidogyne enterolobii.

Meloidogyne enterolobii, a highly pathogenic root-knot nematode species, causes serious damage to agricultural production worldwide. Collagen is an important part of the nematode epidermis, which is crucial for nematode shape maintenance, motility, and reproduction. In this study, we report that a novel collagen gene, Me-col-1, from the highly pathogenic root-knot nematode species Meloidogyne enterolobi was required for the egg formation of this pathogen. Me-col-1 encodes a protein with the size of 35 kDa, which is closely related to collagen found in other nematodes. Real-time PCR assays showed that the expression of Me-col-1 was highest in eggs and lowest in pre-parasitic second-stage juveniles (preJ2). Interestingly, knockdown of Me-col-1 did not compromise the survival rate of preJ2 but significantly reduced the egg production and consequentially caused 35.79% lower multiplication rate (Pf/Pi) compared with control. Our study provides valuable information for better understanding the function of collagen genes in the nematode life cycle, which can be used in the development of effective approaches for nematode control.

Efficacy of native strains of entomopathogenic nematode, Heterorhabditis indica against the fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae) from India

Abstract Background The fall armyworm, Spodoptera frugiperda (J. E. Smith) (Lepidoptera: Noctuidae), is a notorious polyphagous pest that has recently invaded India in 2018. Within a short period, this pest has spread throughout the country, causing a significant damage to maize. In order to manage this menace, farmers rely on chemical insecticides, but due to concealed feeding nature of this pest insecticides remain ineffective in reaching the target site. In this context, the present study aimed to isolate, characterize and evaluate the reproductive potential of the native strains of entomopathogenic nematode, Heterorhabditis indica against larval instars of S. frugiperda under laboratory conditions. Results Two strains of H. indica isolated and characterized from the rhizosphere of mango and curry leaf trees were designated as CICR-HI-MN and CICR-HI-CL, respectively. Both strains, CICR-HI-CL and CICR-HI-MN showed differential mortality against 3rd (LC50 value of 21.65, 48.91 IJs/larva), 4th (LC50 value of 25.46, 52.36 IJs/larva) and 5th (LC50 value of 59.20, 71.04 IJs/larva) instar larvae of S. frugiperda, respectively. The instar-wise mortality of S. frugiperda showed that 3rd instar was relatively more susceptible compared to 4th and 5th instar larvae. In terms of efficacy, CICR-HI-CL was almost twice effective than CICR-HI-MN when LC50 and LC95 values of 3rd instar larvae were compared. However, the reproductive potential of both the strains was significantly higher against 5th instar than the 3rd and 4th instar larvae. Strain CICR-HI-CL was more effective in larval mortality, while nematode reproduction was higher in CICR-HI-MN. Conclusions Native strains of H. indica evaluated in the present study were found effective against larval instars of fall armyworm, S. frugiperda. Higher reproduction on 5th instar larvae demonstrates the ability of these strains to multiply, sustain and perpetuate on late instars of this polyphagous pest and may serve as viable option in integrated pest management program.

Nematicidal potential of Macrotyloma axillare 'Java' extract against Meloidogyne javanica and its metabolic profile

Plants produce chemical compounds with high nematicidal activity and potential for large-scale application in nematode control. The purpose of this study was to identify chemical compounds in crude extract of Macrotyloma axillare 'Java' and investigate their inhibitory effects on Meloidogyne javanica . Crude methanolic extract was fractionated into hexane, dichloromethane, ethyl acetate , and hydromethanol fractions. Chemical characterization of dichloromethane, ethyl acetate, and hydromethanol fractions was performed by dereplication using high-resolution mass spectrometry. The inhibitory activity of samples on the hatching of second-stage juveniles (J2) was tested at concentrations of 0%, 0.05%, 0.5%, and 5% (0, 500, 5000, 50000 ppm) and on nematode penetration and reproduction on soybean at 0.1% (1000 ppm). Distilled water was used as control in nematicidal assays. Several compounds belonging to the groups of organic acids, phenolic acids , fatty acids, flavonoids , pterocarpans, terpenoids, and sugars were identified. All fractions and concentrations reduced J2 hatching, reaching a plateau at 0.05%. Crude methanolic extract and dichloromethane and ethyl acetate fractions decreased M. javanica penetration at 10 days after inoculation, and all fractions reduced nematode penetration and female numbers at 30 days after inoculation. Extract fractions also reduced total nematode numbers, providing 49–95% control of the nematode. M. axillare 'Java' extract is rich in nematicidal compounds and has toxic effects on M. javanica , inhibiting J2 hatching and nematode penetration, development, and reproduction on soybean. • Macrotyloma axillare 'Java' is a plant that can be used to control nematodes. • 'Java' extract reduces penetration, development and reproduction of Meloidogyne javanica in soybean. • 135 compounds were identified in the 'Java' extract. • The chemical compounds of 'Java' show toxicity to Meloidogyne javanica .

Reação de genótipos de alho a Ditylenchus dipsaci e aspectos relacionados com a produtividade em área naturalmente infestada

ABSTRACT The stem and bulb nematode, Ditylenchus dipsaci, is one of the main problems which affects garlic crop in Brazil; however, information on the host status of the crop to the pathogen is scarce. Thus, the aim of this study was to evaluate the host status of 11 garlic genotypes to Ditylenchus dipsaci and their productivity in experiments conducted under controlled conditions and in the field. In a greenhouse, diverse genetic materials were evaluated for nematode reproduction factor (RF). At the same time, the nematode reproduction, damage caused and productivity of these same genotypes were evaluated in an area naturally infested. In the greenhouse, ‘AM-PC Farias’, ‘Quitéria’, ‘BRS Hozan’, ‘Peruano’, ‘Chonan’ and ‘Moz 114’ were resistant; and, under field conditions, in these same genotypes, the nematode showed the lowest rates of reproduction in the soil (RF= 0.2 to 10.77) and in the tissues (1 to 3,893 specimens/plant), and there were the lowest percentages of symptomatic (0 to 48.66%) and dead (4.17 to 19.57%) plants. Higher productivities (4.32 to 11.05 t/ha) and bulb weight (13.12 to 58.63 g) were obtained with ‘AM-PC Farias’, ‘Quitéria’ and ‘AM-Erenice’; however, only in ‘AM-PC Farias’ and in ‘BRS Hozan’ we observed lower population levels of D. dipsaci in bulb peels (110 and 0.1 specimens/g, respectively).

Hexapeptides from mammalian inhibitory hormone hunt activate and inactivate nematode reproduction.

Biopurification has been used to disclose an evolutionarily conserved inhibitory reproductive hormone involved in tissue mass determination. A (rat) bioassay-guided physicochemical fractionation using ovine materials yielded via Edman degradation a 14-residue amino acid (aa) sequence. As a 14mer synthetic peptide (EPL001) this displayed antiproliferative and reproduction-modulating activity, while representing only a part of the native polypeptide. Even more unexpectedly, a scrambled-sequence control peptide (EPL030) did likewise. Reproduction has been investigated in the nematode Steinernema siamkayai, using a fermentation system supplemented with different concentrations of exogenous hexapeptides. Peptide structure-activity relationships have also been studied using prostate cancer and other mammalian cells in vitro, with peptides in solution or immobilized, and via the use of mammalian assays in vivo and through molecular modelling. Reproduction increased (x3) in the entomopathogenic nematode Steinernema siamkayai after exposure to one synthetic peptide (IEPVFT), while fecundity was reduced (x0.5) after exposure to another (KLKMNG), both effects being dose-dependent. These hexamers are opposite ends of the synthetic peptide KLKMNGKNIEPVFT (EPL030). Bioactivity is unexpected as EPL030 is a control compound, based on a scrambled sequence of the test peptide MKPLTGKVKEFNNI (EPL001). EPL030 and EPL001 are both bioinformatically obscure, having no convincing matches to aa sequences in the protein databases. EPL001 has antiproliferative effects on human prostate cancer cells and rat bone marrow cells in vitro. Intracerebroventricular infusion of EPL001 in sheep was associated with elevated growth hormone in peripheral blood and reduced prolactin. The highly dissimilar EPL001 and EPL030 nonetheless have the foregoing biological effects in common in mammalian systems, while being divergently pro- and anti-fecundity respectively in the nematode Caenorhabditis elegans. Peptides up to a 20mer have also been shown to inhibit the proliferation of human cancer and other mammalian cells in vitro, with reproductive upregulation demonstrated previously in fish and frogs, as well as nematodes. EPL001 encodes the sheep neuroendocrine prohormone secretogranin II (sSgII), as deduced on the basis of immunoprecipitation using an anti-EPL001 antibody, with bespoke bioinformatics. Six sSgII residues are key to EPL001's bioactivity: MKPLTGKVKEFNNI. A stereospecific bimodular tri-residue signature is described involving simultaneous accessibility for binding of the side chains of two specific trios of amino acids, MKP & VFN. An evolutionarily conserved receptor is conceptualised having dimeric binding sites, each with ligand-matching bimodular stereocentres. The bioactivity of the 14mer control peptide EPL030 and its hexapeptide progeny is due to the fortuitous assembly of subsets of the novel hormonal motif, MKPVFN, a default reproductive and tissue-building OFF signal.

Integrated Management of Meloidogyne Incognita and Soilborne Fungi Infecting Cucumber Under Protected Cultivation.

Relative efficacy of various approaches for management of Meloidogyne incognita and the soilborne fungus Fusarium oxysporum f. sp. cucumerinum has been tested in cucumber under protected cultivation conditions for two seasons. Management practices, namely, chemicals (fumigant, nonfumigant, and fungicide), organic amendments (neem cake, leaves, and oil opted as soil and seed treatment), and biocontrol agents (egg-parasitic fungus and Purpureocillium lilacinum), were combined for the management of the disease complex in a randomized block design. Two significant parameters were measured: plant growth parameters (shoot length, dry shoot weight, dry root weight, and yield) and disease parameters (galls per plant, final nematode population, egg masses per plant, and fungal incidence). All treatments significantly improved plant growth parameters and reduced nematode reproduction as compared to untreated check. The integration of formalin and neem oil seed treatment favors the low root galling index compared to all other treatments in both the seasons. Formalin and neem oil seed treatment reduced the nematode population and fungal incidence, and increased the yield of cucumber during both the seasons.

Can Beauveria bassiana reduce the root lesion nematode, Pratylenchus thornei, infection on wheat?

BackgroundLimited number of control methods against root-lesion nematodes has increased the search for alternative management strategies. Due to secondary metabolites such as toxins and enzymes secreted by the entomopathogenic fungus, Beauveria bassiana, the number of studies on nematicidal potentials on many plant parasitic nematodes has increased. Almost no work was done on the nematicidal activity of B. bassiana, which is widely used as a bio-insecticide, on the root lesion nematode, Pratylenchus thornei, commonly found on wheat in Turkey. In the present study, it was aimed to determine the pathogenicity of two native B. bassiana isolates (BIM-001 and BY2) obtained from Turkey against P. thornei on wheat under controlled conditions.ResultsSpore suspension of B. bassiana isolates affected P. thornei soil, root, final nematode density and reproduction rate at different degrees according to spore concentration. The soil, root, total nematode density, and reproduction rate in the control on İkizce cv. were 1234.0 adult + larvae/500 g soil, 1105.0 adult + larvae/per pot, 2341.0 (soil + root density) and 5.8 (PF(final nematode density/PI (initial inoculum density)), respectively. It was determined that these parameter values were at the lowest at 108 spore/ml than other concentrations in both isolates of B. bassiana. In 108 spore/ml concentrations of BIM-001 isolate, while P. thornei soil, root, total nematode density, and reproduction rate on İkizce were 641.7 adult + larvae/500 g soil, 930.9 adult + larvae/per pot, 1572.6 (soil + root density) and 3.9 (PF/PI), respectively, these parameter values were found to be 645.2 adult + larvae/500 g soil, 849.0 adult + larvae/per pot, 1492.2 (soil + root density) and 3.6 (PF/PI) at 108 spore/ml concentrations of BY2 isolate. It was observed that the reproduction rate of P. thornei decreased at 108 spore/ml concentration of BIM-001 and BY2 isolates compared to the control.ConclusionNative B. bassiana isolates of BIM-001 and BY2 reduced P. thornei on wheat and the concentration was important for the pathogenicity of B. bassiana. While the reproduction rate of P. thornei at 108 and 107 spores/ml concentrations in both isolates decreased than the control. At 106 spore/ml concentration it was found similar to the control. Even though B. bassiana is known as an effective biocontrol agent against insects and some plant-parasitic nematodes, more detailed studies should be done on its effect on P. thornei.

Susceptibility and host potential of six cucurbit crops to Meloidogyne enterolobii, M. floridensis, M. hapla, M. incognita and M. javanica

Summary Cucurbits are economically important crops and very susceptible to root-knot nematodes (Meloidogyne spp.; RKN) in Florida. A series of glasshouse and field trials were conducted to evaluate the susceptibility and host potential of different cucurbit crops to different RKN species. We tested the sensitivity of six cucurbit crops (squash, cucumber, cantaloupe, watermelon, smooth and angled luffa) that are commonly grown in Florida to some of the major RKN species, Meloidogyne enterolobii, M. floridensis, M. hapla, M. incognita and M. javanica under glasshouse conditions. In addition, cucumber, squash and zucchini were also tested in two field trials. Meloidogyne incognita was more damaging to all six tested cucurbit crops than M. javanica and M. floridensis in terms of gall index, eggs (root system)−1, eggs (g root)−1 and reproduction factor. In another experiment, the same cucurbit crops suffered greater damage and allowed higher reproduction of M. enterolobii as compared to M. javanica. Meloidogyne hapla caused little damage to all six cucurbit crops and had low reproduction rates, with highest root gall ratings and reproduction for cucumber and cantaloupe, and lowest for watermelon and squash. Meloidogyne enterolobii, M. floridensis, M. incognita and M. javanica caused higher root gall ratings on cucumber and watermelon than on squash, cantaloupe and luffa. This was also noted in the field trials, where cucumber had consistently higher gall indices than squash and zucchini. Root-knot nematode reproduction rates were the highest on squash and cucumber, especially with M. incognita and M. enterolobii. While all cucurbits were good hosts for all tested RKN species, significant differences were noted among cucurbit crops and RKN species.

Isolation and identification of endophytic bacteria associated with kiwifruit and their biocontrol potential against Meloidogyne incognita

BackgroundRoot-knot nematodes (RKNs) cause severe losses in kiwifruit-growing regions. The endophytic bacteria could be biological agents for nematodes management. The aim of this study was the isolation and identification of endophytic bacteria from kiwifruit orchards and the evaluation of their antagonistic ability against RKN in greenhouse conditions.ResultsIn this study, the population of nematode and the bacterial strains were isolated from kiwifruit roots and leaves in the Mazandaran and Guilan provinces of Iran. Molecular experiments were conducted to identify and confirm the bacterial isolates and RKN species. Also, the effects of bacterial isolates on nematode reproduction factors (number of galls, egg masses, and second-stage juveniles, J2) and growth parameters of kiwifruit plants were determined. The RKN was confirmed as Meloidogyne incognita by molecular identification. Also, the endophytic bacteria were identified based on supplementary experiments and molecular analyses. A total of 31 bacterial endophytes were identified to be including 12 genera of Bacillus, Pseudomonas, Staphylococcus, Exiguobacterium, Sphingomonas, Agrobacterium, Variovorax, Pantoea, Microbacterium, Streptomyces, Chryseobacterium, and Chitinophaga. Generally, Bacillus and Pseudomonas were the dominant genera that included 29.03 and 22.58% of total isolated bacteria, respectively. In vitro screening assays, P. ananatis 121.en and P. chlororaphis 54.en displayed considerable antagonistic ability on J2 mortality of M. incognita and were selected for greenhouse surveys. The isolates displayed a significant reduction in the number of galls and egg masses on roots and juvenile’s population in pot soil. Moreover, 121.en and 54.en strains significantly increased growth parameters including root fresh weight and shoot fresh weight than the control kiwifruit seedlings.ConclusionsThe bacterial endophytes are safe and have a low risk of managing the RKNs and can be effective microbial bio-fertilizers for improving kiwifruit plant growth under RKNs infections.

The biochemical changes in two moderately resistant and highly susceptible tomato cultivars at the later stages of Meloidogyne javanica infection

Summary The most effective method of managing root-knot nematodes is employing resistant and tolerant cultivars. Investigating biochemical changes can help determine the cause of resistance or susceptibility of plants to nematodes. In this study, resistance levels of some tomato cultivars, ‘ALYSTE F-1’, ‘ARYZA F-1’, ‘Early Urbana’, ‘Rutgers’, ‘Dutch Mobil’ and ‘Hungarian Mobil’, were evaluated based on nematode reproduction indices under glasshouse conditions. After selecting the most susceptible and resistant cultivar, comparisons of activity of defence enzymes (guaiacol peroxidase, catalase, ascorbate peroxidase, superoxide dismutase, polyphenol oxidase and phenylalanine ammonia-lyase), and phenolic and lignin contents in leaves and roots were investigated. Analysis of nematode reproductive traits revealed that ‘ALYSTE F-1’ had the lowest number of galls per root system, egg masses per root system, eggs per root system, and second-stage juveniles per 1.5 kg of soil and, consequently, the lowest number of nematode populations. Finally, ‘ALYSTE F-1’ and ‘Dutch Mobil’ (based on reproduction factor, gall index and resistance index) were selected as moderately resistant and highly susceptible cultivars, respectively, for biochemical analysis. Biochemical analysis of leaves and roots showed that most of the defence compounds in ‘ALYSTE F-1’ were higher than ‘Dutch Mobil’. These results also showed that ‘ALYSTE F-1’ reacted to nematode attack more rapidly than ‘Dutch Mobil’.

The DNA methylation landscape of the root-knot nematode-induced pseudo-organ, the gall, in Arabidopsis, is dynamic, contrasting over time, and critically important for successful parasitism.

Root-knot nematodes (RKNs) induce giant cells (GCs) within galls which are characterized by large-scale gene repression at early stages. However, the epigenetic mechanism(s) underlying gene silencing is (are) still poorly characterized. DNA methylation in Arabidopsis galls induced by Meloidogyne javanica was studied at crucial infection stages (3 d post-infection (dpi) and 14 dpi) using enzymatic, cytological, and sequencing approaches. DNA methyltransferase mutants (met1, cmt2, cmt3, cmt2/3, drm1/2, ddc) and a DNA demethylase mutant (ros1), were analyzed for RKN resistance/tolerance, and galls were characterized by confocal microscopy and RNA-seq. Early galls were hypermethylated, and the GCs were found to be the major contributors to this hypermethylation, consistent with the very high degree of gene repression they exhibit. By contrast, medium/late galls showed no global increase in DNA methylation compared to uninfected roots, but exhibited large-scale redistribution of differentially methylated regions (DMRs). In line with these findings, it was also shown that DNA methylation and demethylation mutants showed impaired nematode reproduction and gall/GC-development. Moreover, siRNAs that were exclusively present in early galls accumulated at hypermethylated DMRs, overlapping mostly with retrotransposons in the CHG/CG contexts that might be involved in their repression, contributing to their stability/genome integrity. Promoter/gene methylation correlated with differentially expressed genes encoding proteins with basic cell functions. Both mechanisms are consistent with reprogramming host tissues for gall/GC formation. In conclusion, RNA-directed DNA methylation (RdDM; DRM2/1) pathways, maintenance methyltransferases (MET1/CMT3) and demethylation (ROS1) appear to be prominent mechanisms driving a dynamic regulation of the epigenetic landscape during RKN infection.

Screening of the nematicidal potential of some spice extracts against root-knot nematode, Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 (Tylenchida: Meloidogynidae)

Experiments were conducted in the laboratories and greenhouses of Plant Protection Department, Agricultural Faculty, Ondokuz Mayıs University in 2018 and 2019 to investigate the nematicidal effects of aqueous extracts of 13 spices on Meloidogyne arenaria (Neal, 1889) Chitwood, 1949 (Tylenchida: Meloidogynidae). Spice extract concentrations of 0.5, 1 and 2% were tested in laboratory experiments for inhibition of egg hatching, mortality and immobility of second-stage juveniles (J2s). When used at a concentration of 2%, clove, Syzygium aromaticum L. (Myrtales: Myrtaceae) caused the greatest immobility and mortality of J2s. The extracts had a lesser effect on J2s than the egg hatching. For the pot experiment, five effective spices extracts were selected based on the laboratory experiments. These extracts were applied at 2% to 200 g of soil inoculated with 3,000 nematode eggs then susceptible tomato seedlings were transplanted into the soil. Forty-five days after inoculation, the gall index and the quantity of nematode eggs on roots were determined and reproduction factor of nematode calculated. All extracts, except cumin, Cuminum cyminum L. (Apiales: Apiaceae), reduced root gall index and the reproduction factor when compared to control. Basil, Ocimum basilicum L. (Lamiales: Lamiaceae) extract reduced nematode reproduction the greatest degree, followed by turmeric, Curcuma longa L. (Zingiberales: Zingiberaceae) and clove extracts.

Bio-management of rice root-knot nematode, M. graminicola by using various organic amendments and bio-control agents on rice nursery

A screen house experiment was conducted during kharif season, 2020-21 to know the effect of organic amendments and bio-agents (alone and in combination) in comparison with chemical on the population of rice root-knot nematode (Meloidogyne graminicola) in rice. Nursery was grown in 5 kg soil capacity earthen pan filled with infested soil having initial nematode population 285 J2/200 cc soil. Seeds of the rice (Variety- Pusa 1121) were soaked in tap water for 24 h and the sprouted seeds were sown in pots. Hundred seeds of rice were sown in each pot and each treatment was replicated four times. Organic amendments (neem cake and FYM) and bio-agents (Pseudomonas fluorescens, Purpureocillium lilacinum and Trichoderma viride) were added 10 days before sowing. Weighted amount of bio-agents was mixed in neem cake and FYM for enrichment with 7-10 days waiting period. Carbofuran (Furadan 3G) was added at time of sowing. The earthen pots without organic amendments, bio-agents and chemical were treated as control. Observations on plant growth parameters (seedling length in cm fresh and dry seedling weight in g) and nematode multiplication (number of galls/20 seedling, number of eggs/20 seedling and final nematode population in the soil/200 cc soil) were made at transplanting time. The plant parameters were maximum and significantly highest in treated nursery (neem cake @ 50 g/pot + Pseudomonas fluorescens @ 50 g/pot) under screen house conditions. Nematode reproduction and multiplication parameters such as number of galls/seedling, number of eggs/seedling and final nematode population were significantly reduced in neem cake @ 50 g/pot + Pseudomonas fluorescens @ 50 g/pot.