ND2 Gene Research Articles

Characterization of Four Complete Mitogenomes of Monolepta Species and Their Related Phylogenetic Implications.

Monolepta is one of the diverse genera in the subfamily Galerucinae, including 708 species and 6 sub-species worldwide. To explore the information on the mitogenome characteristics and phylogeny of the section "Monoleptites", especially the genus Monolepta, we obtained the newly completed mitochondrial genomes (mitogenomes) of four Monolepta species using high-throughput sequencing technology. The lengths of these four new mitochondrial genomes are 16,672 bp, 16,965 bp, 16,012 bp, and 15,866 bp in size, respectively. All four mitochondrial genomes include 22 transfer RNA genes (tRNAs), 13 protein-coding genes (PCGs), 2 ribosomal RNA genes (rRNAs), and one control region, which is consistent with other Coleoptera. The results of the nonsynonymous with synonymous substitution rates showed that ND6 had the highest evolution rate, while COI displayed the lowest evolution rate. The substitution saturation of three datasets (13 PCGs_codon1, 13 PCGs_codon2, 13 PCGs_codon3) showed that there was no saturation across all datasets. Phylogenetic analyses based on three datasets (ND1, 15 genes of mitogenomes, and 13 PCGs_AA) were carried out using maximum likelihood (ML) and Bayesian inference (BI) methods. The results showed that mitogenomes had a greater capacity to resolve the main clades than the ND1 gene at the suprageneric and species levels. The section "Monoleptites" was proven to be a monophyletic group, while Monolepta was a non-monophyletic group. Based on ND1 data, the newly sequenced species whose antennal segment 2 was shorter than 3 were split into several clades, while, based on the mitogenomic dataset, the four newly sequenced species had close relationships with Paleosepharia. The species whose antennal segment 2 was as long as 3 were split into two clades, which indicated that the characteristic of "antennal segment 2 as long as 3" of the true "Monolepta" evolved multiple times in several subgroups. Therefore, to explore the relationships among the true Monolepta, the most important thing is to perform a thorough revision of Monolepta and related genera in the future.

Discovery of a new species of the subgenus Japonigekko (Squamata, Gekkonidae, Gekko) from the Hengduan Mountains, southwestern China: the best Japonigekko mountaineer.

A new Gekko (subgenus Japonigekko) species, Gekkoalpinus sp. nov., is described from the Jinsha River Basin in southwestern China, between the border of Mangkang County, Xizang Autonomous Region and Batang County, Sichuan Province, according to the integrative taxonomic results combining molecular data and morphological characters obtained from the type series comprising 11 specimens. Our molecular phylogeny inferred from the mitochondrial 16S and ND2 gene fragments indicated that this new species is most closely related to Gekkojinjiangensis, but a considerable amount of genetic divergence exists between them (p-distance: 3.6%-4.1% (16S) and 7.1%-9.1% (ND2)). The new species can be distinguished from its congeners via a combination of series morphological characters. The discovery of this new species marks the highest altitudinal range (2400 to 2542 m a.s.l.) recorded for the subgenus Japonigekko and also represents a new provincial record for the genus in Xizang Autonomous Region.

Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication

Background: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like Rat Meat (RM). Aim: This study aims to develop a Real-Time Polymerase Chain Reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs. Methods: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples. Results: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other 8 species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in 8 marketed beef meatball samples. Conclusion: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

A new species of Hemiphyllodactylus (Squamata, Gekkonidae) from southwest Yunnan, China.

A new species of gekkonid, Hemiphyllodactylusgengmaensissp. nov., is described based on six specimens from Gengma Dai and Wa Autonomous County, Yunnan, China. The new species can be distinguished from its congeners by a significant genetic divergence of greater than 9.7% in the mitochondrial ND2 gene and a combination of the following characters: a maximum SVL of 43.24mm; 8 or 9 chin scales; six circumnasal scales; 2 or 3 internasal scales; 9-11 supralabial scales; 8 or 9 infralabial scales; 11-18 dorsal scales; 8-10 ventral scales; a manual lamellar formula of 5-5-5-4 or 5-6-5-4 and a pedal lamellar formula of 5-5-6-5; 20-25 precloacal and femoral pore-bearing scales contiguous in males; dark postorbital stripes or striping on body; dark dorsal transverse blotches present; and a brown postsacral mark bearing anteriorly projecting arms. The discovery of this new species brings the number of Hemiphyllodactylus species in China to 15.

Molecular and morphometric data provide evidence of intraspecific variation in shape and pigmentation pattern in Otocinclus cocama (Siluriformes: Loricariidae) across major river drainages.

Otocinclus cocama, a uniquely colored species of the loricariid catfish genus Otocinclus described solely from the type locality in the lower Ucayali River in northern Peru, is reported occurring in the Tigre River, a tributary to the Marañón River that drains a different section of the Andean Mountain range in the western Amazon. Both populations differ in the number of dark bars spanning the flanks of the body, and we investigated whether these morphotypes constitute distinct species. The body shapes of populations from the Tigre and Ucayali rivers were compared using geometric morphometrics. Although principal component analysis detected a broad overlap between populations, multivariate analysis of variance and linear driscriminat analysis revealed a subtle differentiation between the populations of the two hydrographic basins. Average body shape of the Ucayali River population tend to be slightly higher than that of the Tigre River, with the caudal peduncle stretched vertically in the Ucayali population. Multivariate regression of shape and centroid size revealed an allometric effect of 10.7% (p < 0.001), suggesting that the variation between Tigre and Ucayali populations was purely shape variation. Molecular data of coI, cytb, nd2, and 16S mitochondrial genes indicated a nucleotide diversity range from 0.001 to 0.003, and haplotypic diversity range from 0.600 ± 0.11 to 0.79 ± 0.07. The median-joining haplotype network for the concatenated matrix exhibited two divergent haplogroups related to the geographic area and separated by <10 mutational steps. The molecular species delimitation methods based on distance (automatic barcode gap discovery and assemble species by automatic partitioning) recovered two molecular lineages evolving independently, being one of the lineages formed by individuals from both populations. Tree-based methods (generalized mixed Yule coalescent and Bayesian implementation of the Poisson tree process) recovered similar topologies and supported single lineage recognition. Methods of molecular delimitation of species disclosed the high similarity between the two populations of Otocinclus cocama, further supported by the presence of old haplotypes common to both groups which could indicate that the populations still maintain gene flow. Although the morphological data reveal a subtle variation between both river basins, the molecular data suggest a weak population structuration based on hydrographic areas, but not different species lineages, therefore Otocinclus cocama is composed of a single lineage with two distinct morphotypes.

Genetic Diversity of Kırklareli Honey Bee (Apis mellifera L.) Populations in Thrace Region of Turkey: Identification of Mitochondrial COI and ND5 Gene Regions

The main goal of genetic resource conservation is to keep as much genetic diversity as possible within each species. In this respect, some difficulties in the protection of honey bee gene resources make it necessary to reveal the genetic structures of the subspecies and the genetic relationships between the subspecies. In this study, Kırklareli honey bee populations which were officially registered as an ecotype of Turkey’s honey bee (Apis mellifera L.) gene resources by the Republic of Turkey, Ministry of Agriculture and Forestry, were examined in the COI and ND5 genes of mitochondrial DNA. The restriction fragment length polymorphism (RFLP) together with the polymerase chain reaction (PCR) was used to define Apis mellifera populations. A total of 117 worker bee samples were used which were collected from mostly the Kırklareli province. A newly found single nucleotide polymorphism (SNP), G→A transition in the COI gene region formed a novel NcoI restriction site resulting in a new haplotype. This new haplotype has been abbreviated as haplotype C. As a result of the COI/SspI digestion, the previously reported C haplotype was determined. No restriction was found with the treatment of COI/StyI enzyme. On the other hand, as a result of ND5/AluI restriction, 2 restriction site and previously reported haplotype C was obtained in all of the studied samples. No restriction was screened with ND5/FokI and ND5/HincII enzymes in the whole samples, only a reported uncut B haplotype was observed. Within this study, novel genetic information has been revealed for the Kırklareli honey bee ecotype registered as the Thrace honey bee of Turkey’s honey bee gene resources. Moreover, detailed studies with larger sample sizes should be conducted to characterize the origin and the subspecies of Kırklareli honey bees in detail. It is thought that this study will be useful in the identification and registration of the Kırklareli honey bees to be carried out in the future, and also in the creation of a database.

Taxonomic review of the Calotesversicolor complex (Agamidae, Sauria, Squamata) in China, with description of a new species and subspecies.

Caloteswangisp. nov., a new species of the agamid genus Calotes Cuvier, 1817, from southern China and northern Vietnam, is described. This species can be distinguished from all known congeners by a combination of morphological characteristics and genetic divergence in the mitochondrial tRNA, ND2, and CO1 genes. Molecular phylogenetic analysis revealed that the new species was formed as a monophyletic group and that considerable genetic divergence existed between its congeners (minimum p-distance, 4.6%). Caloteswangisp. nov. is distinguished by a combination of the following characteristics: average SVL < 90 mm for adult males; 10-14 dorsal eyelid scales; scales on side of neck and adjacent shoulder area pointing obliquely upward; keels on neck scales weakly to strongly developed; fold in front of the shoulder absent; pair of dark triangular patches extending from the front of the shoulder to the jaw angles; and orange coloration of the tongue. Caloteswangisp. nov. is similar to C.irawadi but differs in having scales between the nasal shield and the orbit and a fourth toe with a claw that can reach between the eyes and tympanum (even to the snout when hind the limbs are adpressed forward). Phylogenetic analyses revealed two well-supported subspecies, Lineages A and B in C.wangisp. nov., with mean uncorrected p-distances between them of 2%. We propose that Lineage A, which is mainly from the central and southern Wuzhi Mountains on Hainan Island, is a subspecies, C.w.hainanensisssp. nov. Lineage B mainly comprises individuals from other sites on the island plus the adjacent mainland, and is described as subspecies, C.w.wangissp. nov. A diagnostic key to all Calotes species of China is also provided.

On the specific status of Scelimena spicupennis and a new record of S. discalis from China with mitochondrial genome characterization (Orthoptera, Tetrigidae)

The genus Scelimena Serville (Orthoptera: Tetrigidae) from China is reviewed. One species, Scelimena spicupennis Zheng &amp; Ou, 2003 (China: Yunnan) is redescribed, and a new record of Scelimena discalis (Hancock, 1915) from China is given. An annotated identification key for Chinese species of the genus Scelimena is provided. Mitochondrial genes of S. spicupennis and S. discalis were sequenced and annotated. The sizes of the two sequenced mitogenomes are 17,552 bp (S. discalis), and 16,069 bp (S. spicupennis), respectively. All of the PCGs started with the typical ATN (ATT, ATC or ATG) or TTG codon and most ended with complete TAA or TAG codon, with the exception of the ND5 gene, which terminated with an incomplete T. The mitochondrial genomes for these two recorded species are provided, and the constructed phylogenetic tree supports their morphological taxonomic classification. The topology of the phylogenetic tree showed that three species of Scelimena were clustered into one branch and formed a monophyletic and a holophyletic group.

Leber's hereditary optic neuropathy: Update on the novel genes and therapeutic options.

A maternal inheritance disorder called Leber's hereditary optic neuropathy (LHON) is the most common primary mitochondrial deoxyribonucleic acid (DNA) disorder. In most studies, there are more male patients than female patients, which contradicts the usual pattern in mitochondrial hereditary diseases. This suggests that nuclear DNA (nDNA) may influence the degeneration of retinal ganglion cells (RGCs) in LHON. The primary cause of this is dysfunction in complex I of the electron transport chain, leading to ineffective adenosine triphosphate (ATP) production. In addition to MT-ND4 or MT-ND1 mutations, genes such as PRICKLE3 , YARS2 , and DNAJC30 , which come from nDNA, also play a role in LHON. These three genes affect the electron chain transport differently. PRICKLE3 interacts with ATP synthase (complex V) at Xp11.23, while YARS2 is a tyrosyl-tRNA synthetase 2 involved in mitochondria . DNAJC30 mutations result in autosomal recessive LHON (arLHON). Understanding how genes impact the disease is crucial for developing new treatments. Idebenone has been approved for treating LHON and has shown safety and efficacy in clinical trials. Mesenchymal stem cell-based therapy has also emerged as a potential treatment for LHON by transferring mitochondria into target cells. Gene therapy research focuses on specific gene mutations, and the wild-type ND4 gene target in the adeno-associated viruses (AAV) vector has shown promise in clinical trials as a potential treatment for LHON.

Saint Patrick, what about legless lizards? Tracing the mitochondrial affiliation and possible origin of Anguis (Squamata: Anguidae) population in Ireland

Abstract Ireland is home to only one native lizards’ species, the viviparous lizard and one of the few areas of the world where there are no native snakes. However, since the end of the 19th century, there have been reports indicating the presence of legless lizards, Anguis fragilis Linnaeus, 1758 population whose origin is unknown. As this genus has been intensively studied genetically and taxonomically in the past decade, we have decided to investigate newly obtained mtDNA sequences (ND2 gene) to trace affiliation of the Anguis population in Ireland. We genetically examined 12 individuals from the Burren area (western Ireland) and compared them to available data. The Irish population was identified as belonging to A. fragilis, specifically to the most common haplotype of the Illyrian-Central European haplogroup. This genetic affiliation is shared by populations across a wide European region, including the western Balkans, Spain, France, western Hungary, Austria, Germany, Latvia, Poland, the Czech Republic, Russia, Sweden, Norway, and Great Britain. Our findings showed that the Irish population does not exhibit unique mitochondrial variability. This haplotype is present across the range of the species, including Great Britain, which is not in contrast with the earlier hypothesis that nearby populations from this area, along with human-mediated introductions, could be the source of Anguis populations in Ireland. This is thus potentially the first documented case of Anguis introduction out of the native range. However, further research, including broader sampling in Great Britain and genomics, is required to determine and trace its exact origin.

Its all in the name: Another new Cyrtodactylus Gray (Squamata: Gekkonidae) from northern Mizoram, North-east India.

A new species of Cyrtodactylus is described from Vairengte town, situated in the Kolasib District of Mizoram State, north-eastern India. The new species is found to be a member of Indo-Burman Cyrtodactylus khasiensis clade based on ND2 gene sequences and morphological parameters, such as number of precloacal pores, mid-ventral scale rows, paravertebral tubercles on the trunk, dorsal tubercle rows, subdigital lamellae on pes and subcaudal scalation, making it the sixth endemic Cyrtodactylus from Mizoram and twenty second from north-east India. Moreover, phylogenetic evidence suggests the new species to be sister to the recently described C. aaronbaueri, and morphological analyses also reveal marginal separation between the two species based on the PCA of infralabials, lamellae on fingers and toes, paravertebral tubercles on the trunk, and dorsal tubercle rows.

A new species of the genus Cnemaspis Strauch, 1887 (Squamata: Gekkonidae) from the higher elevations of Tamil Nadu, India

In this study, we present the description of a previously undocumented species of Cnemaspis found in the region of Tamil Nadu, India. Molecular analysis of the species reveals its placement within the Cnemaspis beddomei Theobald, 1876 clade, with a range of genetic divergence on the ND2 gene, spanning from 9.5% to 30.2% in comparison to its congeners. Although bearing a resemblance to the well-known Cnemaspis ornata Beddome, 1870, the new species exhibits a distinct set of non-overlapping morphological characteristics that set it apart. These findings are supported by molecular data, solidifying the distinction between the newly described species and its close relatives.

Adaptive evolution of mitochondrial genomes in Triplophysa cavefishes

Extreme conditions in caves pose survival challenges for cave dwellers, who gradually develop adaptive survival features. Cavefishes are one of the most successful animals among cave dwellers. Triplophysa cavefishes are an important group of cavefishes, and they show remarkable adaptability to the extreme environments of caves. However, there is a limited understanding of their adaptation mechanisms. In this study, eight complete mitochondrial genomes of Triplophysa cavefishes were newly obtained, and their genomic characteristics, including the base composition, base bias, and codon usage, were analyzed. Phylogenetic analysis was carried out based on 13 mitochondrial protein-coding genes from 44 Nemacheilidae species. This showed that Triplophysa cavefishes and non-cavefishes separate into two reciprocally monophyletic clades, suggesting a single origin of the cave phenotype. Positive selection analysis strongly suggested that the selection pressure in cavefishes is higher than that in non-cavefishes. Furthermore, the ND5 gene in cavefishes showed evidence of positive selection, which suggests that the gene may play an important role in the adaptation of cavefishes to the cave environment. Protein structure analysis of the ND5 subunit implied that the sites of positive selection in cavefishes might allow them to acquire lower ND5 protein stability, compared to that in non-cavefishes, which might help the accumulation of nonsynonymous (mildly deleterious) mutations. Together, our study revealed the genetic signatures of cave adaptation in Triplophysa cavefishes from the perspective of energy metabolism.

Exploring Mitochondrial DNA Heteroplasmy in a Mouse Model of Sickle Cell Disease

BACKGROUND: Mitochondria are important in the pathology of sickle cell disease (SCD). They are abnormally retained in sickle red blood cells (RBCs) and the likely source of cell-free mitochondrial DNA (mtDNA), an erythrocytic-DAMP that triggered formation of neutrophil extracellular traps (Tumburu et al, 2022). Acquired mutations in the mitochondrial genome, referred to mtDNA heteroplasmy, are emerging markers of aging and inflammation. Using whole genome sequence data from peripheral blood DNA, we previously established that patients with SCD not only have increased mtDNA heteroplasmy, but the burden also varied with the sickle genotype [Ahmad et. al, 2021]. The burden of mtDNA heteroplasmy is known to vary across different organs and tissues. Here, we utilized the Townes mouse model of SCD to explore differential mtDNA heteroplasmy burden across the different tissues and sickle genotypes in SCD. METHODS: Genomic DNA was extracted from 9 different organs (heart, brain, muscle, kidney, blood, bone marrow, liver, lungs, spleen) of littermate mice (3 male and 3 female) of three genotypes (HbAA, HbAS, HbSS) in three replica sets (total number of mice = 18, 9 different tissue samples per mouse, total sample number = 162). Mitochondria DNA was enriched from genomic DNA by long range PCR in 2 amplicons of 9kb and 7kb sizes (Misa Hirose et al, 2018). The enriched mtDNA PCR amplicons were mixed together and subjected to library preparation for deep sequencing using Illumina platform. Sequence reads aligned to mtDNA were mapped and called for variants using LoFreq variant calling tool. RESULTS: Of the 162 samples, 1 sample (HbAA, lung) was excluded from analysis due to low coverage. Using LoFreq variant caller tool (VAF cut-off 4% &amp; Coverage Filter 3500X), and after removing the repeating variants, 11 unique variants spanning 16kb mouse mitochondrial genome, were found in 106 of the 161 (65.8%) samples. The variants were differentially distributed across the tissues and genotypes with the variant at mito-position 9820 (MT: 9820) being most frequent, present in 19, 16 and 18 samples in AA, AS and SS mice, respectively (Fig. 1). Two variants at MT: 11866 and MT: 6881 were shared between AA and AS mice. Four variants were unique to SS mice: MT: 6753 in COX1 gene causing Phe476-Leu substitution, MT: 6794 in intergenic region upstream to COX2 gene, MT: 1220 in intergenic region upstream to ND1 gene, and MT425 in regulatory/D-Loop region (Table -1). The SS-unique variants were present in all tissues except for Cox1 Phe476-Leu (MT: 6753), a single variant that was found only in the spleen. Overall, HbSS had the highest concentration of variants distributed among 41/54 (75.9%) followed by AS 38 /54 (70.3 %) and AA 27/53 (50.9%). Female mice had higher mtDNA heteroplasmy burden compared to male mice in all genotypes. Across all genotypes and tissues, spleen had the highest number of variants (16.03%) and liver, the lowest (9.4%). CONCLUSION: In keeping with data in patients with SCD, HbSS mice had the highest mtDNA heteroplasmic burden followed by HbAS and HbAA genotypes. Four mito-variants were unique to HbSS. We also found differentially higher mtDNA heteroplasmic burden in splenic tissues and speculate that this could arise from metabolic stress conditions in the spleen.

Phylogenetic analysis of Aciagrion Selys (Odonata: Coenagrionidae)

ABSTRACT Odonates are useful biological indicators of environmental health because of their pollution-free habitat requirements and amphibiotic life cycle. Due to habitat destruction by industrial development, there is a need to name these odonates and obtain their genetic data to be used in understanding their evolutionary history for biodiversity conservation. Aciagrion is a poorly known and taxonomically difficult genus of oriental damselflies. Species of this genus cannot be distinguished on the basis of morphological characters alone as they are morphologically similar to the damselflies of other genera (Ischnura and Amphiallagma) and may also be referred to as cryptic species. Here, therefore, molecular studies are carried out to distinguish the species of this genus. The phylogenetic relationships of five species of genus Aciagrion have been explored using molecular (based on concatenated sequences of mitochondrial genes- COI, ND1 and 16S rRNA genes) as well as external morphological characters. Single-linkage cluster analysis of morphological data sets did not explain the relationships appropriately among the species of this genus as outgroup species were also retrieved within ingroup species. Interspecific genetic divergence, conserved, variable, parsimony-informative sites, nucleotide base composition and transition/transversion bias based on concatenated gene sequences have been calculated for these species. It is found that a multigene concatenation approach interprets phylogeny more appropriately than the morphological data alone. Presently, a COI gene fragment sequence for one species (the endemic Aciagrion hisopa), 16S rRNA gene fragments for four species and ND1 gene fragments for five species have been submitted for the first time to GenBank, and phylogenetic relationships based on three genes have also been determined for the first time. Aciagrion migratum is a new record from India.

Genomic insights into isolation of the threatened Florida crested caracara (Caracara plancus).

We conducted a population genomic study of the crested caracara (Caracara plancus) using samples (n = 290) collected from individuals in Florida, Texas, and Arizona, United States. Crested caracaras are non-migratory raptors ranging from the southern tip of South America to the southern United States, including a federally protected relict population in Florida long thought to have been isolated since the last ice age. Our objectives were to evaluate genetic diversity and population structure of Florida's apparently isolated population and to evaluate taxonomic relationships of crested caracaras at the northern edge of their range. Using DNA purified from blood samples, we conducted double-digest restriction site associated DNA sequencing and sequenced the mitochondrial ND2 gene. Analyses of population structure using over 9,000 SNPs suggest that two major clusters are best supported, one cluster including only Florida individuals and the other cluster including Arizona and Texas individuals. Both SNPs and mitochondrial haplotypes reveal the Florida population to be highly differentiated genetically from Arizona and Texas populations, whereas, Arizona and Texas populations are moderately differentiated from each other. The Florida population's mitochondrial haplotypes form a separate monophyletic group, while Arizona and Texas populations share mitochondrial haplotypes. Results of this study provide substantial genetic evidence that Florida's crested caracaras have experienced long-term isolation from caracaras in Arizona and Texas and thus, represent a distinct evolutionary lineage possibly warranting distinction as an Evolutionarily Significant Unit (ESU) or subspecies. This study will inform conservation strategies focused on long-term survival of Florida's distinct, panmictic population.

NARFL deficiency caused mitochondrial dysfunction in lung cancer cells by HIF-1α–DNMT1 axis

NARFL was reported to be a component of cytosolic iron–sulfur cluster assembly pathway and a causative gene of the diffused pulmonary arteriovenous malformations (dPAVMs). NARFL knockout dramatically impaired mitochondrial integrity in mice, which might promote mitochondrial dysfunction and lead to worse survival rate of lung cancer. However, the underlying molecular mechanism of NARFL deficiency in non-small cell lung cancer (NSCLC) is unknown. Knockdown assay was performed in A549 and H1299 cells. The protein levels of HIF-1α and DNMT1 were measured, and then Complex I activity, mtDNA copy numbers and mRNA levels of mtND genes were determined. Cisplatin resistance and cell proliferation were conducted using CCK8 assay. Cell migration and invasion were detected using wound heal assay and transwell assay. Survival analysis of lung cancer patients and KM plotter database were used for evaluating the potential value of NARFL deficiency. NARFL protein was expressed in two cell lines and knockdown assay significantly reduced its levels. Knockdown NARFL increased the protein levels of HIF-1α and DNMT1, and downregulated the mRNA levels of ND genes, mitochondrial Complex I activity, mtDNA copy number, and ATP levels. The mitochondrial dysfunction caused by NARFL deficiency were ameliorated by siHIF-1α and DNMT1 inhibitor. Knockdown NARFL increased the drug resistance and cell migration, and siHIF-1α reversed this effect. Moreover, NSCLC patients with NARFL deficiency had a poor survival rate using a tissue array and KM plotter database, and it would be a target for cancer prognosis and treatment. NARFL deficiency caused dysregulation of energy metabolism in lung cancer cells via HIF-1α–DNMT1 axis, which promoted drug resistance and cell migration. It provided a potential target for treatment and prognosis of lung cancer.

Analysis of the Complete Mitochondrial Genome of Pteronura brasiliensis and Lontra canadensis.

P. brasiliensis and L. canadensis are two otter species, which successfully occupied semi-aquatic habitats and diverged from other Mustelidae. Herein, the full-length mitochondrial genome sequences were constructed for these two otter species for the first time. Comparative mitochondrial genome, selection pressure, and phylogenetic independent contrasts (PICs) analyses were conducted to determine the structure and evolutionary characteristics of their mitochondrial genomes. Phylogenetic analyses were also conducted to confirm these two otter species' phylogenetic position. The results demonstrated that the mitochondrial genome structure of P. brasiliensis and L. canadensis were consistent across Mustelidae. However, selection pressure analyses demonstrated that the evolutionary rates of mitochondrial genome protein-coding genes (PCGs) ND1, ND4, and ND4L were higher in otters than in terrestrial Mustelidae, whereas the evolutionary rates of ND2, ND6, and COX1 were lower in otters. Additionally, PIC analysis demonstrated that the evolutionary rates of ND2, ND4, and ND4L markedly correlated with a niche type. Phylogenetic analysis showed that P. brasiliensis is situated at the base of the evolutionary tree of otters, and then L. canadensis diverged from it. This study suggests a divergent evolutionary pattern of Mustelidae mitochondrial genome PCGs, prompting the otters' adaptation to semi-aquatic habitats.

Two new karst-adapted species in the Cyrtodactyluspulchellus group (Reptilia, Gekkonidae) from southern Thailand.

The exploration of unsurveyed areas in southern Thailand discovered two new karst-adapted species, Cyrtodactylussungaiupesp. nov. and Cyrtodactyluswangkhramensissp. nov., from Thung Wa and La-ngu Districts, Satun Province, respectively. These new species are members of the C.pulchellus group that occur along the Thai-Malay Peninsula. The new species can be distinguished from all other congeners by their key morphological characters and genetic divergence. Morphologically, Cyrtodactylussungaiupesp. nov. and Cyrtodactyluswangkhramensissp. nov. can be diagnosed from other members by having a combination of differences in body size; degree of dorsal tuberculation; absence of tubercles on ventral surfaces; number of ventral scales, paravertebral tubercles and femoroprecloacal pores in males only; deep precloacal groove only in males; absence of a scattered pattern of white dorsal tubercles; number of dark body bands; and the extent of caudal tubercles on an original tail. Although the two species are sister taxa and have nearly identical morphologies, they are considered to be different species, based on a relatively high uncorrected pairwise genetic divergence of the mitochondrial ND2 gene (6.59-6.89%), statistically significant univariate and multivariate morphological differences (PERMANOVA and ANOVA) and diagnostic characteristics of caudal tuberculation on the original tail. Moreover, Cyrtodactylussungaiupesp. nov. and Cyrtodactyluswangkhramensissp. nov. are currently restricted to their karstic type localities which may serve as a geographic barrier to dispersal and gene flow.

Return of the prodigal son: morphology and molecular phylogenetic relationships of a new Antarctic fish leech (Hirudinea: Piscicolidae) imply a bipolar biogeographic pattern

The bipolar distribution of fish leeches (Piscicolidae) has been considered and discussed by leech biologists for a long time. All cases of putative bipolar ranges of related taxa that occur in cold and temperate waters of both hemispheres and are absent in the tropics have been morphology-based hypotheses. Here, we present, for the first time, an instance of bipolar distribution substantiated by morphological and molecular data. The latter include the mitochondrial genes 12S rRNA, COI, ND1 and tRNA Leu, and the nuclear 28S rRNA. A new genus and species of Antarctic piscicolids, Austroplatybdellina prodiga, is described. The new leech was part of a Boreal-Arctic monophyletic group that is informally called ‘classic platybdellins’. That clade is the core of the non-monophyletic subfamily Platybdellinae. Austroplatybdellina prodiga gen. nov. sp. nov. was further classified as a member of a monophyletic group along with two Boreal genera, Crangonobdella and Beringobdella, which share a number of systematically important morphological features with its newly described relative. It is hypothesized that the Boreal ancestor of the new leech crossed warm tropical waters and colonized the Antarctic. The colonization was relatively recent as the low genetic distance between A. prodiga and its Boreal sister species suggests. This migration can be viewed as a return of a Boreal descendant of the Antarctic ancestor of Piscicolidae to the area of origin of the entire family, which follows from the basal position of the Antarctic Megaliobdella szidati in the family phylogenetic tree. This evolutionary scenario is reflected in the species epithet of the new leech. https://zoobank.org/urn:lsid:zoobank.org:pub:DA548F19-922A-4B5D-B7F1-4C3AF57B9824 https://zoobank.org/urn:lsid:zoobank.org:act:A35C365A-A475-4F3E-B28B-C799F618215D https://zoobank.org/urn:lsid:zoobank.org:act:BCE6411F-E38A-4A99-A726-DE5C33D9D658