Native Entomopathogenic Nematodes Research Articles

Efficacy of native entomopathogenic nematodes against different white grubs in sweetpotato field in China

White grubs (Holotrichia parallela, Anomala corpulenta and Holotrichia oblita) are the main underground pests of sweetpotato in North China. The virulence of 26 entomopathogenic nematode (EPN) isolates belonging to 10 species against H. parallela, A. corpulenta and H. oblita was evaluated in the laboratory. Isolates showing greater efficacy were further tested at different concentrations, and their virulence against different developmental stages of different white grub species was also examined. Greenhouse and field experiments were conducted to identify the most effective and adaptable nematode isolates. The mortality of the white grubs was significantly affected by nematode isolates and concentrations. The tested Heterorhabditis beicherriana NCWZ1, H. bacteriophora HQ4 and H. beicherriana LJ24 caused more than 70% mortality of the insect larvae at an application rate of 60 infective juveniles (IJs)/cm2 in the laboratory. In general, the susceptibility of the first and second instar of the white grubs was overall higher than that of the third instar according to the bioassay. Holotrichia oblita were less susceptible to most of the EPNs than H. parallela and A. corpulenta. There were significant differences in susceptibility to the nematodes among the early stage and the late stage of the first instar larvae of H. oblita. The tested EPN species showed promising control efficacy in field experiments. Heterorhabditis beicherriana NCWZ1 provide the highest efficacy at an application rate of 2 × 109 IJs/ha in the second and third field experiments. Our findings indicate that native EPN have good potential for use in the integrated management of white grubs in China.

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Evaluation of cell-free supernatants from the symbiotic bacteria of entomopathogenic nematodes for controlling the colorado potato beetle [Leptinotarsa decemlineata (Say) (Coleoptera: Chrysomelidae)]

The Colorado potato beetle (CPB), Leptinotarsa decemlineata, poses a significant threat to potato crops globally and has developed resistance to numerous insecticides. Entomopathogenic nematodes (EPNs), from the genera Steinernema and Heterorhabditis, are promising biocontrol agents. This study aimed to identify the bacterial symbionts of ten native EPN isolates, evaluate the efficiency of cell free supernatants (CFSs) from their symbiotic bacteria against different developmental stages of CPB, and determine the effect of these CFSs on CPB developmental stages and lifespan. The recA gene region was utilized to determine the symbiotic bacteria of ten local EPNs. CFSs from these bacteria were applied orally and through contact to CPB’s various developmental stages (L1/L2, L3/L4 larval stages, and adults). Mortalities, developmental transition times, and lifespans of adults were observed. The CFSs showed significant toxicity to CPB, with higher efficiency against young larvae. The CFSs exhibited cumulatively lethal effects over time, particularly on L1/L2 larval stages. CFSs from X. bovienii exhibited the highest efficacy. In all cases, where larvae received CFSs orally or by contact, they failed to develop into pupae and adults. In contrast, the transition periods of old larvae to pupal and adult stages were comparable to those of the control group. Lifespans of adults differed based on bacterial isolates and application methods. This study shows the potential efficacy of CFSs from Xenorhabdus and Photorhabdus as biocontrol agents against CPB, particularly in its young larval stages. Further research is needed to unravel the mechanisms behind these effects and examine the impact on CPB mating and oviposition behaviors.

Steinernema yirgalemense (Steinernematidae) to control Phlyctinus callosus and Phlyctinus xerophilus (Curculionidae)

Summary Considerable progress has been made in the surveying, taxonomy, screening, mass production and formulation of entomopathogenic nematodes (EPN) and their associated symbiotic bacteria in South Africa. Steinernema yirgalemense isolate 157-C is one of the most promising native EPN candidates with regards to virulence, its broad insect-host spectrum, and can be readily mass-produced and formulated into a commercial product. The banded fruit weevils, Phlyctinus callosus sensu stricto and Phlyctinus xerophilus, previously grouped together under the Phlyctinus callosus sensu lato species concept, are native entimine weevils of economic importance to deciduous fruit, grapevine and berries in the Western Cape province of South Africa. This study investigated potential differences in baseline susceptibility of larvae and pupae of the two weevil species to S. yirgalemense in laboratory screenings. The test arena used was 24-well bioassay plates, with an inoculation concentration of 200 infective juveniles (IJ) insect−1 for larvae and 100 IJ insect−1 for pupae. Infection was determined 48 h and 96 h after inoculation. Field-efficacy of S. yirgalemense, applied at a concentration of 60 IJ cm−2, against larvae of the two weevil species was determined in an ecologically relevant semi-field trial. In all cases in vitro mass-produced IJ of S. yirgalemense were used. No baseline differential susceptibility between P. callosus and P. xerophilus larvae was obtained in laboratory screenings. Phlyctinus pupae were approximately twice as susceptible compared to larvae, with significant differences between bioassay batches. Approximately 45% control of P. xerophilus larvae was obtained after 96 h of exposure to S. yirgalemense in the field, differing significantly from the control and P. callosus treatment. Low levels of Phlyctinus larval infection by native EPN (confirmed as Heterorhabditis bacteriophora from one P. xerophilus cadaver) occurred in both control and EPN treatment groups under field conditions.

Biocontrol potential of six Heterorhabditis bacteriophora strains isolated in the Azores Archipelago.

Entomopathogenic nematodes (EPNs) are closely associated with Popillia japonica and potentially used as their biological control agents, although field results proved inconsistent and evoked a continual pursuit of native EPNs more adapted to the environment. Therefore, we surveyed the Azorean Archipelago to isolate new strains of Heterorhabditis bacteriophora and to evaluate their virulence against the model organism Galleria mellonella under laboratory conditions. Six strains were obtained from pasture and coastal environments and both nematode and symbiont bacteria were molecularly identified. The bioassays revealed that Az172, Az186, and Az171 presented high virulence across the determination of a lethal dose (LD50) and short exposure time experiments with a comparable performance to Az29. After 72 hours, these virulent strains presented a mean determination of a lethal dose of 11 infective juveniles cm-2, a lethal time (LT50) of 34 hours, and achieved 40% mortality after an initial exposure time of only 60 minutes. Az170 exhibited an intermediate performance, whereas Az179 and Az180 were classified as low virulent strains. However, both strains presented the highest reproductive potential with means of 1700 infective juveniles/mg of larvae. The bioassays of the native EPNs obtained revealed that these strains hold the potential to be used in biological control initiatives targeting P. japonica because of their high virulence and locally adapted to environmental conditions.

Biocontrol potential of native entomopathogenic nematodes against Gonioctena fornicata (Brüggemann, 1873) (Coleoptera, Chrysomelidae) in alfalfa

BackgroundGonioctena fornicata (Brüggemann, 1873) (Coleoptera: Chrysomelidae) inflicts substantial crop damage by consuming alfalfa leaves. The main aim of the study was to develop an efficient, sustainable control method against the pest, considering entomopathogenic nematodes (EPNs) as a potential control agent against soil-dwelling insect pests. This study investigated the impact of two native entomopathogenic nematodes (EPNs), Heterorhabditis bacteriophora (isolate Z-1) and Steinernema feltiae (isolate A-16), on mature larvae and adults of G. fornicata. Concentrations of 250, 500, and 1000 IJs/ml were used for adult and larval stages, and mortality rate was determined at the end of 144 h for larvae and 240 h for adults.ResultsThe highest effect was 94.7% at 120 h for isolate Z-1 and 91.0% at 168 h for isolate A-16 at a concentration of 1000 IJs/ml for adult stages. The highest effect on larval stage was 97.6% at 96 h for isolate Z-1 and 85.8% at 120 h for isolate A-16 at the concentration of 1000 IJs/ml. On the adult stage, isolate Z-1 showed 50.0–67.1% effect at concentrations of 250 and 500 IJs/ml, respectively, while isolate A-16 showed an effect ranging from 46.7 to 63.6%. In the larval stage, isolate Z-1 caused 39.7–77.6% mortality at 250 and 500 IJs/ml concentrations, respectively, while the rate was 32.9–63.9% for isolate A-16. In the trial, isolate Z-1 showed a high efficacy in both stages of G. fornicata.ConclusionsThis study represents the first laboratory investigation encompassing both adult and mature larval stages of G. fornicata. The obtained data offer valuable insights for alternative control strategies targeting G. fornicata.

Isolation of Native Strains of Entomopathogenic Nematodes against Fall armyworm, Spodoptera frugiperda (Smith.) in Maize

Entomopathogenic Nematodes (EPNs) found in a variety of soil types, geographical regions, and hosts, which belong to the genera Steinernematidae and Heterorhabditidae, have the potential to act as biocontrol agents. In comparison to chemical and microbial pesticides, they performed better. A total of 87 soil samples were taken from regions where maize was grown in Tuticorin district, Tamil Nadu, India and they were examined for the presence of EPN in 2022–2023. By using the Corcyra baiting approach, a total of 9 samples (10.33%) showed EPN-positive sites. A total of 8 Steinernema sp. (13.33%) and 1 Heterorhabditis sp. (5.00%) were isolated from that population. EPN is identified at a generic level using the cadaver’s colour. Heterorhabditis displays brick red, while Steinernema exhibits creamy white. At a dose of 100–600 IJs/larva for the third and fifth instar, the isolated efficient native EPN strain (Kayathar strain) demonstrated mortality of 95.00–100.00% and 94.50–99.80%. According to the study, EPN showed considerable potent against Spodoptera frugiperda. So, EPNs may be used as a promising bio-control agent to battle pests of the maize crop.

Molecular Identification and Phylogenetic Diversity of Native Entomopathogenic Nematodes, and Their Bacterial Endosymbionts, Isolated from Banana and Plantain Crops in Western Colombia

With the increasing negative impacts on worldwide food production caused by pests, the recovery of native entomopathogenic nematodes (EPNs) is relevant, since they are adapted to local environments, entomofauna, and significant virulence. Therefore, the present study was designed to recover and understand the phylogenetic diversity of EPNs and their associated bacterial endosymbionts, from banana and plantain crops, as alternatives for the control of weevil species. An extensive sampling of western Colombia covered 325 ha, yielding the recovery of three EPNs’ isolates (0.49% of the samples). The molecular characterization included four mitochondrial and nuclear loci, which, after merging with the sequences of 48 species, confirmed the presence of Steinernema carpocapsae, the first report of S. costaricense in South America, and monophyly in most of the Steinernema clades. The tree topologies were consistent for the nuclear loci but not for mitochondrial, probably due to the high nucleotide substitution rate, deficit in the number of species available for these loci, and incomplete lineage sorting. The endosymbiotic bacteria associated with S. carpocapsae were identified as Xenorhabdus nematophila. However, the S. costaricense bacterial symbiont presented a genetic similarity to X. koppenhoeferi and X. khoisanae, which are still uncertain in their classification. The identification of S. costaricense in South America indicates the wide range distribution of this species in the Americas and its ability to persist in different soil types. For the first time, EPN isolation and phylogenetic characterization are directed to plantain and banana crops. Leveraging EPNs’ diversity promises novel applications for crop protection, while the genetic resources from the bacterial endosymbionts may provide metabolites with a wide spectrum of uses, either for agricultural or medicinal purposes.

Efficacy of a native entomopathogenic nematode Heterorhabditis bacteriophora (isolate Z-1) against potato tuber moth (Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae) in Turkey

BackgroundPotato tuber worm (PTM) [Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae)] is one of the most significant and widespread pests of potato. PTM damages potatoes both in the field and in potato storage areas. Control of the pest is getting harder as it is developing resistance to pesticides. Several entomopathogenic nematode (EPN) species have been reported to successfully control numerous agricultural pests worldwide. The main aim of the study was to isolate native nematode/s as a biological control agent against P. operculella. Morphometric measurements of the infective juvenile (IJ) and sequencing and characterization of the internal transcribed spacer (ITS) region was used to identify the nematode isolate to species level. The efficacy of EPN isolate Z-1 obtained from Zonguldak province, Turkey was tested against different life stages of the pest. Experiments were conducted in 150 ml plastic pots containing sterile soil mixture. Four EPN concentrations (i.e., 0, 250, 500 and 1000 IJs/ml) were applied to the soil. Data relating to the mortality of different life stages were collected daily till 6 days after inoculation.ResultsMolecular analyses based on the ITS sequence and morphometric data revealed that isolate Z-1 was Heterorhabditis bacteriophora. Mortality rates of PTM larvae exposed to 250, 500, and 1000 IJs/ml concentrations of native EPN were 62.9 ± 9.8, 74.0 ± 3.7, and 92.5 ± 3.7%, respectively. There were non-significant differences among tested EPN concentrations for pupal mortality and the highest concentration (i.e., 1000 IJs/ml) caused 25.6% mortality.ConclusionsThe results revealed that the native H. bacteriophora isolate was effective against late-stage larvae of PTM under laboratory conditions. Therefore, it can be used as an alternative management option of the pest.

Biocontrol Potential of Turkish Entomopathogenic Nematodes Against the Citrus Mealybug, Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) Under Laboratory Conditions

The citrus mealybug, Planococcus citri (Risso, 1813) (Hemiptera: Pseudococcidae) is one of the major pests of Citrus orchards in Turkey. Management of P. citri is quite challenging due to its cryptic and polyphagous feeding behavior. In the current study, the control potential of native entomopathogenic nematodes (EPNs) species (Heterorhabditis indica 216-H, H. bacteriophora FLH-4H, Steinernema carpocapsae E-76, S. feltiae KCS-4S, and S. bicornotum MGZ-4S) against P. citri was evaluated under laboratory conditions at different concentrations [80, 100, 150, 200 (Infective juveniles) IJs Adult-1] and temperatures (20, 25, 30 ºC). The mortality rates ranged between 16 and 58% at the highest concentration 48 hours after treatment. The highest efficacy (68%) was obtained by Heterorhabditis indica 216-H at the highest concentration at 25 ºC. The mortality rates were generally higher at 25 ºC than other temperatures tested and H. indica 216-H performed better than other EPN species tested at this temperature at all concentrations. The results indicate that H. indica 216-H have a great potential in the control of P. citri.

Evaluation of Entomopathogenic Nematodes against Common Wireworm Species in Potato Cultivation

Wireworms (Coleoptera: Elateridae) are common insect pests that attack a wide range of economically important crops including potatoes. The control of wireworms is of prime importance in potato production due to the potential damage of the larvae to tuber quantity and quality. Chemical insecticides, the main control strategy against wireworms, generally fail to provide satisfactory control due to the lack of available chemicals and the soil-dwelling habits of the larvae. In the last decades, new eco-friendly concepts have emerged in the sustainable control of wireworms, one of which is entomopathogenic nematodes (EPNs). EPNs are soil-inhabitant organisms and represent an ecological approach to controlling a great variety of soil-dwelling insect pests. In this study, the susceptibility of Agriotes sputator Linnaeus and A. rufipalpis Brullé larvae, the most common wireworm species in potato cultivation in Türkiye, to native EPN strains [Steinernema carpocapsae (Sc_BL22), S. feltiae (Sf_BL24 and Sf_KAY4), and Heterorhabditis bacteriophora (Hb_KAY10 and Hb_AF12)] were evaluated at two temperatures (25 and 30 °C) in pot experiments. Heterorhabditis bacteriophora Hb_AF12 was the most effective strain at 30 °C six days post-inoculation and caused 37.5% mortality to A. rufipalpis larvae. Agriotes sputator larvae were more susceptible to tested EPNs at the same exposure time, and 50% mortality was achieved by two EPNs species, Hb_AF12 and Sc_BL22. All EPN species/strains induced mortality over 70% to both wireworm species at both temperatures at 100 IJs/cm2, 18 days post-treatment. The results suggest that tested EPN species/strains have great potential in the control of A. sputator and A. rufipalpis larvae.

Isolation, identification of entomopathogenic nematodes with insights into their distribution in the Syrian coast regions and virulence against Tuta absoluta.

The occurrence and distribution of entomopathogenic nematodes (EPNs) in the Syrian coast regions remain relatively uncharted. To address this gap in our knowledge, an extensive survey of these ecosystems was essential. This study aims to isolate and identify EPNs from diverse ecosystems within the coastal regions. The distribution of EPNs in cultivated and natural environments was analyzed according to habitat, altitude, and sampling season factors. Between 2017 and 2020, EPNs were recovered from 27 out of 821 soil samples (3.28%) and collected from 24 out of 375 sampling sites (6.4%). Based on morphological, morphometric, and molecular (ITS) characteristics, four EPN species were identified: Heterorhabditis indica (51.85%), representing the first report of its occurrence in the coastal regions, H. bacteriophora (33.33%), H. pakistanense (7.4%), which is also reported for the first time in Syria, and Steinernema affine (7.4%). There were statistical differences in the abundance and recovery frequency of EPNs in each type of habitat. Additionally, there were statistical differences in the altitude and sampling season recovery frequency. Co-inertia analysis revealed correlation between the distribution and occurrence of EPNs in vegetation habitats, altitude, and sampling seasons, as well as some soil characteristics. H. indica and H. bacteriophora were associated with citrus orchards, low-altitude ranges, moderate organic matter, and acidic soil. More specifically, H. indica isolates were correlated with olive orchards, vegetable fields, autumn season, and clay, sandy, and sandy loam soils. Meanwhile, H. bacteriophora isolates were correlated with tobacco fields, grasslands, alkaline pH, spring season, silty loam, and clay loam soils. H. pakistanense was linked to pear orchards, vineyards, moderate pH, and low organic matter. S. affine occurred in walnut orchards, silty soil, higher altitudes, and winter season. The virulence levels of three native EPN isolates (S. affine, H. indica and H. bacteriophora) were evaluated against 3rd and 4th instar larvae (outside and inside mines) and pupae of T. absoluta, a destructive pest in Syria. All three native EPN species exhibited ability to infect and kill the insect, with observed significant differences in their virulence. This study provides an understanding of EPN occurrence, distribution, and their potential for application in sustainable pest control strategies in Syria.

Characterization of Steinernema feltiae (Rhabditida: Steinernematidae) Isolates in Terms of Efficacy against Cereal Ground Beetle Zabrus tenebrioides (Coleoptera: Carabidae): Morphometry and Principal Component Analysis.

One of the most dangerous pests of cereals is Zabrus tenebrioides and, in Poland, it is becoming a serious pest. Entomopathogenic nematodes (EPNs) seem to be a very promising, biological control agent for this pest. Native EPN populations are well adapted to local environmental conditions. The current study characterized three Polish isolates of the EPN Steinernema feltiae, which differed in their effectiveness against Z. tenebrioides. In the field, isolate iso1Lon reduced the pest population by 37%, compared with 30% by isolate iso1Dan and 0% by the iso1Obl isolate; the number of plants damaged by Z. tenebrioides in the presence of the different isolates reflected the results in terms of the decrease in pest population size. After incubation in the soil for 60 days, recovered EPN juveniles of all three isolates were able to infect 93-100% of the test insects, with isolate iso1Obl again showing the lowest effectiveness. The juveniles of isolate iso1Obl were also morphometrically distinct from the other two isolates, as revealed by principal component analysis (PCA), which helped to distinguish the EPN isolates. These findings showed the value of using locally adapted isolates of EPNs; two of the three isolates randomly selected from Polish soil outperformed a commercial population of S. feltiae.

Spreyleme ve Toprak Enjeksiyonu Yöntemleri ile Toprağa Uygulanan Entomopatojen Nematodların Şeftali Bahçesinde Kalıcılığının Belirlenmesi

Entomopathogenic nematodes (EPN) are effective biological control agents against underground and cryptic pests. Persistency and survival of EPN in soil after soil application is important for long term success of management programs. In this study, it was aimed to determine the soil persistency of 4 native EPN species after surface spraying and soil injection applications in a peach orchard. In the study, S. feltiae (96), S. carpocapsae 1133, H. bacteriophora 1144 and S. affine 47 species were applied in 30 l water with 140.000 IJ/tree dose per tree by surface spraying and soil injection methods. EPN were applied to soil with a watering can in surface spraying method and with a pulverizator into 5-15 cm depth in soil injection method. After the monthly application, soil samples were collected and EPN presence was tested with G. mellonella larvae and White traps in the laboratory. The study was conducted for 2 times in 2018 and 2019. At the end of the study, EPN persistency in soil was found to be 90 days in 2018 and 150 days in 2019.

Entomopathogenic Nematodes and Their Symbiotic Bacteria from the National Parks of Thailand and Larvicidal Property of Symbiotic Bacteria against Aedes aegypti and Culex quinquefasciatus.

Entomopathogenic nematodes (EPNs) are insect parasitic nematodes of the genera Het-erorhabditis and Steinernema. These nematodes are symbiotically associated with the bacteria, Photorhabdus and Xenorhabdus, respectively. National parks in Thailand are a potentially rich resource for recovering native EPNs and their symbiotic bacteria. The objectives of this study are to isolate and identify EPNs and their bacterial flora from soil samples in four national parks in Thailand and to evaluate their efficacy for controlling mosquito larvae. Using a baiting method with a Galleria mellonella moth larvae and a White trap technique, 80 out of 840 soil samples (9.5%) from 168 field sites were positive for EPNs. Sequencing of an internal transcribed spacer resulted in the molecular identification of Heterorhabditis nematode isolates as H. indica, H. baujardi and Heterorhabditis SGmg3, while using 28S rDNA sequencing, Steinernema nematode species were identified as S. guang-dongense, S. surkhetense, S. minutum, S. longicaudum and one closely related to S. yirgalemense. For the symbiotic bacterial isolates, based on recA sequencing, the Photorhabdus spp. were identified as P. luminescens subsp. akhurstii, P. luminescens subsp. hainanensis and P. luminescens subsp. australis. Xenorhabdus isolates were identified as X. stockiae, X. indica, X. griffiniae, X. japonica and X. hominickii. Results of bioassays demonstrate that Photorhabdus isolates were effective on both Aedes aegypti and Culex quinquefasciatus. Therefore, we conclude that soil from Thailand's national parks contain a high diversity of entomopathogenic nematodes and their symbiotic bacteria. Photorhabdus bacteria are larvicidal against culicine mosquitoes and may serve as effective biocontrol agents.

Evaluation of Indigenous Entomopathogenic Nematodes from Tea Soil of Assam as Potential Biocontrol Agents against Termite and Cockchafer Grub in Tea

This study aimed to isolate native entomopathogenic nematodes (EPN) in the tea growing areas of Assam and to determine their potential for control of Termite and Cockchafer grub Soil samples were collected from three tea estates of jorhat, Assam for EPN isolation.A total of 30 soil samples were tested for the study. Larva of meal moth, Corcyra cephalonica was use as insect bait. Out of 30 samples 9 were found to be positive for EPNs. The infected host larvae were separated for extraction using “white trap method”. All the isolates were evaluated to ascertain their pathogenicity against Termite and cockchafer grub. From the experiment the isolated strain @ 50IJ, 75IJ and 100 IJ was found to be highly pathogenic to Termite and cockchafer grub, which recorded 94- 100% mortality in termite and 100% in all concentrations against cockchafer grub. After infection to prove the cause of mortality EPN could be recovered from the termite and cockchafer cadavers.

Efficacy of entomopathogenic nematode isolates from Turkey against wheat stink bug, Aelia rostrata Boheman (Hemiptera: Pentatomidae) adults under laboratory conditions

BackgroundThe wheat stink bug, Aelia rostrata Boheman (Hemiptera: Pentatomidae), is one of the harmful insects that caused significant product losses in cereals due to outbreaks. Entomopathogenic nematodes (EPNs) are natural enemies of soil insect pests whose effects as a biocontrol agent against many harmful pests have been demonstrated by many laboratories and field/garden studies in the world. The present laboratory studies, using native EPNs [Steinernema carpocapsae (Black sea isolate), S. feltiae (isolate 09-31) (Aydin isolate) and Heterorhabditis bacteriophora (isolate 09-43) (Aydin isolate)] against the wheat stink bug adults, were carried out.ResultsIn the application of EPNs to the soil in plastic cups, the highest mortality rates (75 and 70%) on wheat stink bug occurred at 200 IJs cm−2 concentration of S. carpocapsae isolate at 15 and 12 °C, respectively. In other tested nematode species, the highest insect mortality was observed at 200 IJs cm−2 concentration of S. feltiae and H. bacteriophora isolates, with mortality rates of 65–35% and 55–25%, at 15 and 12 °C, respectively. S. carpocapsae (Black sea isolate) was the most pathogenic among the three nematodes tested.ConclusionsIt was concluded that S. carpocapsae had the potential as a biocontrol agent against the wheat stink bug, A. rostrata. The applications of S. carpocapsae were the great potential for the management of the pest. Effective use of EPNs should be evaluated in integrated pest management strategies between other biological control agents. According to EPNs laboratory experiments results, field trials should be conducted in future studies.

Irrigation modulates entomopathogenic nematode community and its soil food web in olive groves under different agricultural managements

Entomopathogenic nematodes (EPNs) are biological control agents distributed worldwide in natural and agricultural soils. Recent evidence supports the hypothesis that stable rhizospheres of perennial crops can favor the occurrence of EPNs. However, different agricultural management practices can modulate their natural distribution in agroecosystems, hence should be considered in conservation biological control programs to support as high as possible native EPN populations. Cultivated olive (Olea europaea subsp. europaea), originally from the Mediterranean Basin, is a key perennial crop susceptible to a diverse range of arthropod pests that account for their life with at least one soil inhabitant stage. In this study, we investigated, for the first time, the occurrence of EPNs and associated soil organisms in olive groves managed with different practices. We surveyed 89 commercial olive groves located in Andalusia (Southern Spain) and differently handled for pest management (conventional vs. organic), soil management (tilling vs. cover cropping), and irrigation regime (rain feed vs. drip-irrigation). By using species-specific primers-probe sets and quantitative real-time PCR approaches, we screened the occurrence of nine species of EPNs, five free-living nematodes (FLNs), and six nematophagous fungi (NF). We found EPNs in 23.6% of the sites, identifying only two EPN species: Steinernema feltiae (15.7%) and Heterorhabditis bacteriophora (7.9%). Pest and soil management did not affect EPN abundance, but drip irrigation increased their occurrence (P < 0.025). On the contrary, we recorded lower FLN numbers in irrigated groves (P = 0.003), particularly for Oscheius tipulae and Pristionchus maupasi. Regarding NF, both organic management (P < 0.001) and drip irrigation (P < 0.035) enhanced their abundance. Four abiotic explanatory variables (extractable P, clay content, elevation, and precipitation) explained 85.6% of the EPN, FLN, and NF species variation in multivariate analysis. Overall, drip irrigation in the olive groves enhanced the EPN community but also NF growth, natural enemies of nematodes. Additional studies are required to determine the best combination of alternative strategies that will enhance a balanced soil biota in olive groves in Mediterranean regions and other areas where this crops is cultivated that enable conservation ecosystem services, such as those provided by the EPNs.

Organic mulching modulated native populations of entomopathogenic nematode in vineyard soils differently depending on its potential to control outgrowth of their natural enemies

The entomopathogenic nematodes (EPNs) are biological control agents that are widespread in crop soils. However, traditional agricultural management practices such as cultivation and agrochemical usage can alter the soil balance that enables their occurrence and activity. Alternative strategies like mulching are commonly employed to prevent weed growth, enhance below-ground biodiversity by improving soil, organic matter content, fertility, and moisture. We hypothesized that organic mulches would favor biotic conditions for nematofauna development in crop soil, including EPNs, compared to herbicide application or tillage. Traditional (insect baits) and molecular (qPCR analysis) tools were used in this study to assess the abundance and activity of native EPNs, and the abundance of potential natural enemies, such as free-living nematode (FLN) competitors, nematophagous fungi (NF), and ectoparasitic bacteria, in soils managed with different organic mulches or traditional practices. As a model agroecosystem, we selected the vineyard, one of the most intensively managed crop systems. We compared mulches of grape pruning debris (GPD-M), straw (Str-M), and spent mushroom compost (SMC-M) in two commercial vineyards, which employed either integrated or organic pest and disease management. Following a completely randomized design, we retrieved two composite samples per plot (n = 3 per treatment in each vineyard) in April, June, and October 2020. Numbers of EPNs and selected members of their soil food web were higher in the organic than the integrated managed vineyard. Supporting our hypothesis, organic mulching overall favored nematode occurrence in both vineyards. We found higher NF abundance for Str-M, and GPD-M in the organic vineyard, which plausibly explained the lower EPN activity and occurrence compared to SMC-M in both vineyards. We conclude that the organic mulches can provide appropriate conditions for increasing nematofauna numbers but, depending on the mulch type, may also adversely affect EPNs by increasing their natural enemies. Our findings highlight the need to explore alternative farming practices to unravel complex biotic interactions that affect beneficial soil organisms in agroecosystems.

Virulence of native entomopathogenic nematodes against major lepidopteran insect species of tomato (Solanum lycopersicum L.)

Evaluation of liquid formulations of Bt against gram pod borer, Helicoverpa armigera (Hubner) and spotted pod borer, Maruca vitrata (Geyer) in pigeonpeaG. V. Suneel Kumara, L. Vijaya Bhaskarb, Y. Satishc , S. J. Rehamand