Mycorrhizal Species Research Articles

Efectos De La Fertilización Nitrogenada Y Fosfatada Sobre Poblaciones De Micorrizas Asociadas Al Cultivo De Cacao

Cocoa is one of the most significant assets in the ecuadorian agricultural structure, which also provides a good source of income for thousands of farmworker families. However, fertilization research works in cocoa cultivation have been relatively scarce. Decades of global research have shown that mycorrhizal fungi determine the fertilization and conservation of agrosystems. Fertilization is considered to be among the cultural and agricultural practices affecting mycorrhizas, which diminishes or prevents the fungal colonization. The objectives of research works were the following: the characterization of mycorrhiza species associated with cocoa, to determine the effects of nitrogen and phosphate fertilization in plant population and to identify the critical dose affecting the fungus development. A factorial design was used (AxBxC), with two (2) application systems, four (4) doses of nitrogen fertilizer, and two (2) doses of phosphate fertilizer with three repetitions. The turkey’s test was used to evaluate means with confidence interval of 95%. The evaluated variables were: diameter and length of cocoa pods, number of cocoa pods per tree, index of cocoa beans and almond yield per hectare, as well as, mycorrhizal spore counting, percentage of mycorrhizal fungi colonization, visual density of endophyte, and characterization of mycorrhiza species. The results concluded that the application of 100 Kg/ha N + 70 kg/ha P in the system below the soil surface, achieved yield increments of 68% over the absolute witness. The same dose and application method, increased the number of spores per gram of soil, mycelium colonization and density of mycorrhizal endophyte in roots.

Growth media and mycorrhizal species effect on acclimatization and nutrient uptake of banana plantlets

The objective of this study was to investigate the acclimatization and performance of banana (Dwarf Cavendish) in two substrates inoculated with different AM fungi (Glomus. caledonium and G. macrocarpun) and assess the plantlets dependency on inoculation for phosphorus (P) and zinc (Zn) uptake along with biomass development. In addition, to investigate the role of mycorrhizal fungi in supporting acclimatization phase, a plant growth promotion study was set-up in greenhouse using micropropagated plantlets. Two growth media, as GM-I and GM-II were used accompanied by G. caledonium and G. macrocarpum. In first phase, 9 weeks acclimatization study was conducted and in second phase, acclimatized plants were propagated for 16 weeks in both inoculated and non-inoculated conditions. Plantlets acclimatization and nutrient uptake were recorded along with other parameters. Mycorrhizal inoculation significantly increased banana plantlets growth, root infection and P uptake. Plantlets inoculated with G. caledonium exhibited increase in shoot and root dry mass, P and Zn concentration, and root infection in the GM-I. The shoot and root dry mass, P and Zn concentration, and root infection were higher in GM-I than Konaktas soil series. Banana plantlets are mycorrhizal dependent (MD) and soil-grown banana plantlets are more MD than plants grown in the GM-I. Mycorrhizal inoculation seems to be a significant factor in decreasing mortality and increasing production of high-quality banana plantlets under micropropagation conditions.

Mycorrhizal status helps explain invasion success of alien plant species.

It is still debated whether alien plants benefit from being mycorrhizal, or if engaging in the symbiosis constrains their establishment and spread in new regions. We analyzed the association between mycorrhizal status of alien plant species in Germany and their invasion success. We compared whether the representation of species with different mycorrhizal status (obligate, facultative, or non-mycorrhizal) differed at several stages of the invasion process. We used generalized linear models to explain the occupied geographical range of alien plants, incorporating interactions of mycorrhizal status with plant traits related to morphology, reproduction, and life-history. Non-naturalized aliens did not differ from naturalized aliens in the relative frequency of different mycorrhizal status categories. Mycorrhizal status significantly explained the occupied range of alien plants; with facultative mycorrhizal species inhabiting a larger range than non-mycorrhizal aliens and obligate mycorrhizal plant species taking an intermediate position. Aliens with storage organs, shoot metamorphoses, or specialized structures promoting vegetative dispersal occupied a larger range when being facultative mycorrhizal. We conclude that being mycorrhizal is important for the persistence of aliens in Germany and constitutes an advantage compared to being non-mycorrhizal. Being facultative mycorrhizal seems to be especially advantageous for successful spread, as the flexibility of this mycorrhizal status may enable plants to use a broader set of ecological strategies.

Field evaluation of arbuscular mycorrhizal fungi (AMF) for microbial activities and yield of maize under alluvial soil

A field experiment was conducted to evaluate the response of AMF species with different phosphorus (P) levels for root colonization, microbial population under maize in an alluvial soil. Of all the species of mycorrhizae taken under consideration, G. mosseae along with 75% RDF of P was found to perform better in terms of root colonization, number of spores and grain yield. Application of G. mosseae @ 10 kg ha-1 + 50% P + 100% NK produced significantly higher root colonization by 177.32, 55.20, 37.75 and 101.95 per cent over the treatments 100% RDF, G. mosseae @ 10 kg ha-1 + 75% P + 100% NK, G. coronatum @ 10 kg ha-1 + 75% P + 100% NK, G. decipien @ 10 kg ha-1 + 75% P + 100% NK and control, respectively. The similar trend was observed for number of spore count. The maximum number of bacteria (40×10-5 cfu g-1 soil) was found with the inoculation of G. mosseae @ 10 kg ha-1 + 75% P + 100% NK at flowering stage. The maximum grain yield (7656.61 kg ha-1) was recorded with the application of G. mosseae @ 10 kg ha-1 + 75% P + 100% NK, which was 111.92 per cent significantly higher the control treatment. G. mosseae along with 75% RDF of phosphorus inoculation proved to be effective in modifying the soil microbe population and community structure and also in enhancing the grain yield.

Arbuscular mycorrhizal fungi and mycorrhizal stimulant affect dry matter and nutrient accumulation in bean and soybean plants1

ABSTRACT The adoption of biological resources in agriculture may allow less dependence and better use of finite resources. This study aimed at evaluating the effects of inoculation with arbuscular mycorrhizal fungi native to the Brazilian Savannah associated with the application of mycorrhizal stimulant (7-hydroxy, 4'-methoxy-isoflavone), in the early growth of common bean and soybean. The experiment was carried out in a greenhouse, in a completely randomized design, with a 7 x 2 factorial arrangement, consisting of five arbuscular mycorrhizal fungi species, joint inoculation (junction of all species in equal proportions) and native fungi (without inoculation), in the presence and absence of stimulant. The following traits were evaluated: shoot dry matter, root dry matter, mycorrhizal colonization, nodules dry matter and accumulation of calcium, zinc and phosphorus in the shoot dry matter. The increase provided by the arbuscular mycorrhizal fungi and the use of stimulant reached over 200 % in bean and over 80 % in soybean plants. The fungi Acaulospora scrobiculata, Dentiscutata heterogama, Gigaspora margarita and Rhizophagus clarus, for bean, and Claroideoglomus etunicatum, Dentiscutata heterogama, Rhizophagus clarus and the joint inoculation, for soybean, increased the dry matter and nutrients accumulation.

Ellenberg indicator values for macromycetes – a methodological approach and first applications

Abstract Ellenberg indicator values (EIVs) describe the realized niche of species and habitat parameters, and are commonly used for vascular plants, bryophytes, and lichens. We provide a methodology for EIVs and an EIV list for nearly 650 species of macromycetes. We propose a new EIV scale, namely substrate openness (O). We also give the results of two applications and compare EIV values related to the Red List classification with those related to lifestyle classification. Mycorrhizal species on average have higher demands on substrate openness and are less tolerant of high nutrient levels than saprotrophic or parasitic species. Critically endangered species have on average distinctly higher demands on openness of habitat and substrate than not threatened or less strongly threatened species, which in turn have higher demands for nutrient availability. This pattern clearly highlights the points of threat for many macromycete species.

Systematicness of glomalin in roots and mycorrhizosphere of a split-root trifoliate orange

Understanding the behavior of mycorrhiza-originated glomalin, either of plant or soil origin, is anticipated to facilitate better opportunities of modulating antioxidants and carbon distribution in plants. In this study, trifoliate orange seedlings with half of roots were colonized by Acaulospora scrobiculata and Funneliformis mosseae in a split-root rootbox. Mycorrhizal inoculation showed a significantly higher plant biomass of trifoliate orange, regardless of mycorrhizal species. Glomalin-related root protein showed a systematic increase in non-mycorrhiza-inoculated chamber under inoculation with A. scrobiculata and F. mosseae than under non-mycorrhizal inoculation. Similar increase was also observed in easily extractable glomalin-related soil protein and total glomalin-related soil protein as a result of F. mosseae colonization only. Mean weight diameter and soil organic carbon were significantly higher under mycorrhization than non-mycorrhization, irrespective of mycorrhized or non-mycorrhized chamber. Mycorrhizal inoculation stimulated an increase in soil protease activity in the mycorrhized chamber, without any distinctive change in the non-mycorrhized chamber. These results, hence, suggested that mycorrhization conferred a systematic increase in glomalin synthesis in roots and soils, collectively, aiding in better aggregate stability and soil carbon sequestration.

Enhancement of growth in mangrove plant (Ceriops tagal) by Rhizophagus clarus

ABSTRACTThe present study was conducted to investigate the growth response of Ceriops tagal Perr.) C.B. Robinson a mangrove species belonging to the family Rhizophoraceae. Three dominant native arbuscular mycorrhizal (AM) fungal species viz., Rhizophagus clarus, R. intraradices, and Acaulospora laevis were selected. The results revealed that the Mycorrhizal Plant Responsiveness (MGR) was greater in AM inoculated plants compared to control plants. Among AM fungal treatments, plants inoculated with R. clarus recorded significant increase in growth responses compared to remaining AM treatments. The study suggests that R. clarus was the most efficient AM species exhibiting greater influence on growth and biomass. Differences in growth parameters between AM inoculated treatments and control are reasonably linked to colonization levels. The result of the present study indicates that potential native AM fungal species can be use in mangrove reforestation programs as bio-inoculum.

Mycorrhizal Diversity: Methods and Constraints?

Background/Objectives: Arbuscular Mycorrhizae (AMF) form a symbiotic association with more than 80% terrestrial plants. It is not only important for natural ecosystems, but also for sustainable agricultural production under managed ecosystem. Disturbances produced in managed ecosystem influence mycorrhizal abundance and species composition. Methods/Statistical Analysis: The present study addresses to the constraints of recording abundance and identities, as determined from morphological characters of AM spores, biomarker (fatty acids methyl ester) and largely by ribosomal sequence marker. In order to overcome of these restrictions, the present method is the combined approach based on molecular, biochemical and morphological analysis. Findings: Integrated methodology shift towards holistic methods for define AM biodiversity in agriculture system. Our finding suggested suitable alternative molecular markers for identification of AM fungi up to lower taxon level. Current investigation also identifies the selection pressures that effect AMF diversity in agricultural land and look into induction of AMF diversity by different management practices under sustainable development. Applications/Improvements: Results forecast biodiversity study of AM fungi in complex habitat based on integration of molecular, morphological and biochemical approach. These integrated systematic and ecological researches look forward to the development of powerful and cost effective techniques for AM ecotype selection from complex environmental soil.

English

A study was undertaken along land use gradients with different soil types in subtropical ecosystem of Northern India to evaluate the accurance of arbuscular mycorrhizal fungi (AMF). The gradients was from natural land with forest tree, farmer’s field under chemically managed, farmer’s field under organically managed and Industrial wasteland with five different plant species. We investigate the total AMF species in land use system of different soil types and also in trap culture set from same land use system.Distribution of mycorrhizal species were calculated directly by quantification AMF spores and indirectly by sequencing the SSU-ITS and LSU regions of rDNA. A total 19 AMF morphotypes from direct field sampling and additional 35 morphotypes from trap culture were recovered, which represented seven genera and eighteen species. Result suggested that few Rhizophagus and Funneliformis species came from organically managed and natural land; most of the species came from sites representing chemically managed and industrial wasteland sites from which Gigaspora and Scutellospora species were absent. Organically managed land contributed the largest number of AMF species and diversity, even more than those found in natural sites, which suggests that factors contributing to the diversity of AMF are indeed complex: For example, chemically managed sites not only causes loss of fungal biodiversity but also selectively favors smaller spores of genera Rhizophagus and Funneliformis. Key words: Tillage, diversity, ribosomal dna, raised bed plantation, arbuscular mycorrhizal (AM), morphotypes.

Responses of field grown fennel (Foeniculum vulgare Mill.) to different mycorrhiza species under varying intensities of drought stress

The influence of colonization of fennel (Foeniculum vulgare Mill.) roots by two different species of arbuscular mycorrhizal (AM) fungi (Glomus mosseae and Glomus intraradices) and different irrigation treatments (well-watered, moderate water deficit stress, severe water deficit stress and very severe water deficit stress) were examined on growth, osmotic adjustment and qualitative and quantitative yield during two consecutive growing seasons. The experiments were conducted at Yasouj University, Yasouj, Iran located in semi-arid region of Iran. The results indicated that irrespective of mycorrhizal species and water deficit stress intensity, inoculated seeds produced taller plants, more dry matter and seed yield as well as seed essential oil content compared with non-inoculated plants. In both years of the experiment and in AM free plots, irrigation treatments showed a significant effect on leaf P concentration so that P concentration decreased with increasing water deficit stress intensity. Interestingly, mycorrhizal inoculation increased P accumulation and soluble sugars in fennel leaves compared with control plants. The data presented in this study suggest that different AM fungi species even within the same genus have distinct effects on fennel growth and yield. Overall, the results showed that G. mosseae was more efficient under water deficit stress. The application of AM fungi could be critical in cultivation of fennel under arid and semi-arid conditions, where water is the most important factor in determining plant growth and yield.

Ectomycorrhizal ecology is imprinted in the genome of the dominant symbiotic fungus Cenococcum geophilum.

The most frequently encountered symbiont on tree roots is the ascomycete Cenococcum geophilum, the only mycorrhizal species within the largest fungal class Dothideomycetes, a class known for devastating plant pathogens. Here we show that the symbiotic genomic idiosyncrasies of ectomycorrhizal basidiomycetes are also present in C. geophilum with symbiosis-induced, taxon-specific genes of unknown function and reduced numbers of plant cell wall-degrading enzymes. C. geophilum still holds a significant set of genes in categories known to be involved in pathogenesis and shows an increased genome size due to transposable elements proliferation. Transcript profiling revealed a striking upregulation of membrane transporters, including aquaporin water channels and sugar transporters, and mycorrhiza-induced small secreted proteins (MiSSPs) in ectomycorrhiza compared with free-living mycelium. The frequency with which this symbiont is found on tree roots and its possible role in water and nutrient transport in symbiosis calls for further studies on mechanisms of host and environmental adaptation.

Soil drying procedure affects the DNA quantification of Lactarius vinosus but does not change the fungal community composition.

Drying soil samples before DNA extraction is commonly used for specific fungal DNA quantification and metabarcoding studies, but the impact of different drying procedures on both the specific fungal DNA quantity and the fungal community composition has not been analyzed. We tested three different drying procedures (freeze-drying, oven-drying, and room temperature) on 12 different soil samples to determine (a) the soil mycelium biomass of the ectomycorrhizal species Lactarius vinosus using qPCR with a specifically designed TaqMan® probe and (b) the fungal community composition and diversity using the PacBio® RS II sequencing platform. Mycelium biomass of L. vinosus was significantly greater in the freeze-dried soil samples than in samples dried at oven and room temperature. However, drying procedures had no effect on fungal community composition or on fungal diversity. In addition, there were no significant differences in the proportions of fungi according to their functional roles (moulds vs. mycorrhizal species) in response to drying procedures. Only six out of 1139 operational taxonomic units (OTUs) had increased their relative proportions after soil drying at room temperature, with five of these OTUs classified as mould or yeast species. However, the magnitude of these changes was small, with an overall increase in relative abundance of these OTUs of approximately 2%. These results suggest that DNA degradation may occur especially after drying soil samples at room temperature, but affecting equally nearly all fungi and therefore causing no significant differences in diversity and community composition. Despite the minimal effects caused by the drying procedures at the fungal community composition, freeze-drying resulted in higher concentrations of L. vinosus DNA and prevented potential colonization from opportunistic species.

Acid and calcareous soils affect nitrogen nutrition and organic nitrogen uptake by beech seedlings (Fagus sylvatica L.) under drought, and their ectomycorrhizal community structure

The role of different soil types for beech productivity and drought sensitivity is unknown. The aim of this experimental study was to compare mycorrhizal diversity between acid sandy and calcareous soils and to investigate how this diversity affects tree performance, nitrogen uptake and use efficiency (NUE). Beech trees were germinated and grown in five different soil types (pH 3.8 to 6.7). One-and-a-half-year-old plants were exposed for 6 weeks to sufficient or low soil humidity. Tree biomass, root tip mycorrhizal colonization and community structure, root tip mortality, leaf area, photosynthesis, nitrogen concentrations, NUE and short-term 15N uptake from glutamine were determined. Soil type did not affect photosynthesis or biomass formation, with one exception in calcareous soil, where root mortality was higher than in the other soil types. Beech in acid soils showed lower mycorrhizal colonization, higher nitrogen tissue concentrations, and lower NUE than those in calcareous soils. Drought had no effect on nitrogen concentrations or NUE but caused reductions in mycorrhizal colonization. Mycorrhizal species richness correlated with nitrogen uptake and NUE. Nitrogen uptake was more sensitive to drought in calcareous soils than in acid soils. Beech may be more drought-susceptible on calcareous sites because of stronger decrease of organic nitrogen uptake than on acid soils.

Distribution patterns of arbuscular mycorrhizal and non-mycorrhizal plant species in Germany

We analysed the spatial distribution patterns of plant species’ arbuscular mycorrhizal status across an intermediate geographical scale (i.e. the country of Germany) and related these distributions to environmental drivers. Three levels of arbuscular mycorrhizal status of plant species could be defined: (1) obligate arbuscular mycorrhizal species that are always colonised by mycorrhizal fungi, (2) facultative arbuscular mycorrhizal species that are colonised under some conditions but not colonised under others and (3) non-mycorrhizal species that are never found to be colonised by mycorrhizal fungi. We aimed to investigate whether plant species assemblages at the studied grid cell scale are composed of different proportions of species regarding their arbuscular mycorrhizal status, and whether the variation of these proportions can be linked to the geographical variation of ecological and environmental factors. We fitted a vector generalised additive model (VGAM) for log-ratios of proportions of plant species’ arbuscular mycorrhizal status per grid cell (2859 grid cells, each c. 130km2). The spatially explicit plant arbuscular mycorrhizal status distribution model was based on environmental predictors related to climate, geology and land use. The spatial distribution of plant arbuscular mycorrhizal status can be explained as a function of nine environmental predictors (D2=0.54). Proportion of obligate arbuscular mycorrhizal plant species per grid cell increased with increasing temperature range, mean annual temperature, urban area and area of lime as geological parent material and decreased with increasing area of mixed forest and coniferous forest. Annual temperature range was by far the most important predictor. These results extend the comparative context of former studies that established relationships between mycorrhizal status and other plant characteristics at species level, including those describing species ecological requirements, to a context at the level of assemblages and species distributions. We encourage integrating plant mycorrhizal status as a functional trait in future macroecological analyses.

Primeros registros de Hysterangium inflatum (Phallomycetidae, Basidiomycota) y Descomyces varians (Agaricomycetidae, Basidiomycota) en plantaciones de Eucalyptus sp. en Jujuy, Argentina.

Estudios de diversidad de hongos en plantaciones de Eucalyptus, en la Provincia Fitogeográfica Selva de las Yungas en Jujuy, han permitido registrar la presencia de dos especies exóticas de hongos hipogeos micorrícicos: Hysterangium inflatum y Descomyces varians. Estascolecciones constituyen los primeros registros para el país y para la región de las Yungas en el Noroeste de Argentina, respectivamente. A su vez, ambas especies se registran por primera vez en la provinciade Jujuy.

First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

Crop-specific and single-species mycorrhizal inoculation is the best approach to improve crop growth in controlled environments

Arbuscular mycorrhizal fungi are root symbionts that play a key role in crop growth. A systematic quantitative analysis of the response of crops to arbuscular mycorrhizal inoculation, however, remains to be done. Additionally, little is known regarding the role of mycorrhizal specificity and the diversity of the inoculum on crop growth. Therefore, we collected data from 115 inoculation studies, including 435 experiments. We then used meta-analysis to examine the effect of crop identity, arbuscular mycorrhizal fungus identity, and mycorrhizal diversity on crop biomass increase, following inoculation. Our results show that total crop biomass was on average 34.9 % higher in inoculated versus non-inoculated plants. We found that specific combinations of arbuscular mycorrhizal fungus genera and host plant families were more beneficial for growth promotion as compared to other combinations. Moreover, a single-species inoculum increased crop growth response on average by 41.2 % compared to a multi-species inoculum. Overall, our findings show that a broad range of crops highly benefit from the inoculation with arbuscular mycorrhizal fungi. They also strongly suggest that selecting specific arbuscular mycorrhizal taxa for specific crops is the most promising approach to enhance crop growth. There is no “one-size-fits-all” arbuscular mycorrhizal fungus. Finally, and at least in stable and controlled environments, inoculation with a single arbuscular mycorrhizal species is more effective, compared to inoculation with a mixture of different arbuscular mycorrhizal taxa. This may be explained by fungi superior in extraradical growth, but less beneficial to the host, that outcompete the more mutualistic fungi. Therefore, it may be beneficial to maintain a high dominance of one beneficial arbuscular mycorrhizal taxon in simplified agricultural systems.

English

Chroogomphus roseolus is a common mycorrhizal species exclusively found with Pinus wallichiana which has been collected from Himalayan moist forests of Pakistan. Taxonomically, this species is previously not described from Pakistan and also first time reported outside Chinese territory. In this study, Pakistani collection has been characterized on morphological and molecular basis. Macrosopic characters like size, shape and colour of pileus, stipe and spore are compared in Cinese European and North American literature for its identification. Its Internal Transcribed Spacers (ITS) of ribosomal DNA sequence was amplified using universal primer pair (ITS1f and ITS4) and nucleotide sequences queried in GenBank database using BLAST analysis where it matches 99% with sequences of the same species from China. Phylogenetic analysis, description, photographs and line drawings of Pakistani collection confirmed as Chroogomphus roseolus. . The exclusive presence of this species Pinus wallichiana indicates that it can be used in mycorrhization control in afforestation and reforestation of Pinus wallichiana vegetation.

The legacy effect of cover crops on soil fungal populations in a cereal rotation

The use of rotations and minimum tillage in agriculture can permit more sustainable production through increasing soil organic matter and nutrients, and breaking of pathogen lifecycles. Soil fungal populations make an important physical and chemical contribution to soil. For example, mycorrhizal species are important in plant nutrition but are often overlooked when considering management practices for efficient soil function. We undertook DNA metabarcoding (Ion Torrent) using novel PCR primers and high-throughput sequencing of the D1 region of the large ribosomal subunit of the rRNA locus, to assess the effect of different forages and cereal tillage methods on the soil fungal community. The study comprised five forage treatments, perennial ryegrass (Lolium perenne) with either low or high N, chicory (Cichorium intybus), red clover (Trifolium pratense) or white clover (Trifolium repens) grown over 3 harvest years (2010–2012). Cultivation of chicory, red clover or white clover led to significantly divergent soil fungal communities, with a notably lower diversity of fungal populations under clover, suggesting a link to soil N dynamics. Consistent with this, was a negative correlation of soil nitrate-N levels with populations of arbuscular mycorrhizal fungi (AMF) and other root-associated fungal groupings (dark septate endophytes, ‘CHEG’, Sebacinales and Ceratobasidiaceae). In contrast, abundance of Fungi belonging to the genera Mortierella and Cryptococcus were positively correlated with soil nitrate-N, with Mortierella also being negatively correlated with soil P. Spring wheat was sown on the same plots (April 2013) followed by winter barley (October 2013). Half of each plot was sown either after ploughing or by direct drilling. A legacy effect of the preceding forage crop on the fungal community was detected after both cereal crops, with plots previously cultivated with ryegrass being most divergent. No overall effect of establishment method on fungal communities was detected but AMF and CHEG fungi were more abundant on direct-drilled plots and pathogenic fungi were more abundant on ploughed plots after the sowing of winter barley.